Skip to content

Latest commit

 

History

History
418 lines (355 loc) · 6.83 KB

File metadata and controls

418 lines (355 loc) · 6.83 KB
  1. Characterize the structure of an optimal solution

  2. Recursively define the value of an optimal solution

  3. Compute the calue of an optimal solution, typically in a bottom-up fashion

  4. Construct an optimal solution from computed information

15.1 ROD CUTING

std::vector<int> p ={ 0, 1,5,8,9,10,17,17,20,24,30 };

완전 탐색 $O(2^n)$

nt CUT_ROD(int p[], int n) // p는 index 1부터 저장되어있다.
{
	if (n == 0)
	{
		return 0;
	}
	int q = INT32_MIN;
	for (int i = 1; i <= n; i++)
	{
		q = std::max(q, p[i - 1] + CUT_ROD(p, n - i));
	}
}

메모이제이션 방법 (top-down with memoization) $O(n^2)$

int MEMOIZED_CUT_ROD(int p[], int n)
{
	int* r = new int[n + 1];
	for (int i = 0; i <= n; ++i)
	{
		r[i] = INT32_MIN;
	}
	int q = MEMOIZED_CUT_ROD_AUX(p, n, r);
	delete[]r;
	return q;
}
int MEMOIZED_CUT_ROD_AUX(int p[], int n, int r[])
{
	int q;
	if (r[n] >= 0)
	{
		return r[n];
	}
	if (n == 0)
	{
		q = 0;
	}
	else
	{
		q = INT32_MIN;
		for (int i = 1; i <= n; ++i)
		{
			q = std::max(q, p[i] + MEMOIZED_CUT_ROD_AUX(p, n - i, r));
		}
	}
	r[n] = q;
	return q;
}

bottm-up method(버튼업 /상향식)

int BOTTOM_UP_CUT_ROD(int p[], int n)
{
	int* r = new int[n + 1];
	r[0] = 0;
	for (int j = 1; j <= n; j++)
	{
		int q = INT32_MIN;
		for (int i = 1; i <= j; i++)
		{
			q = std::max(q, p[i] + r[j - i]);
		}
		r[j] = q;
	}
	delete[]r;
	return r[n];
}
std::vector<std::vector<int>> EXTENDED_BOTTOM_UP_CUT_ROD(int p[], int n)
{
	const int INF = 10000000;
	std::vector<std::vector<int>>rs; // r, s
	rs.resize(2);
	rs[0].resize(n + 1);
	rs[1].resize(n + 1);
	rs[0][0] = 0;
	for (int j = 1; j <= n; j++)
	{
		int q = -INF;
		for (int i = 1; i <= j; i++)
		{
			if (q < p[i] + rs[0][j - i])
			{
				q = p[i] + rs[0][j - i];
				rs[1][j] = i;
			}
		}
		rs[0][j] = q;
	}
	return rs;
}

void PRINT_CUT_ROD_COLUTION(int p[], int n)
{
	std::vector<std::vector<int>> rs = EXTENDED_BOTTOM_UP_CUT_ROD(p, n);
	while (n > 0)
	{
		std::cout << rs[1][n] <<' ';
		n = n - rs[1][n];
	}
	std::cout << std::endl;
}

15.2 Matrix_chain_multiplication

https://www.acmicpc.net/problem/11049

typedef std::pair<std::vector<std::vector<int>>,std::vector<std::vector<int>>> Set;

$O(n^3)$

Set MATRIX_CHAIN_ORDER(const std::vector<int> &p)
{
	const int INF = 1000000000;
	const int n = p.size()-1;
	std::vector<std::vector<int>> m(n+1, std::vector<int>(n+1, 0));
	std::vector<std::vector<int>> s(n+1, std::vector<int>(n+1, 0));
	for (int l = 2; l <= n; l++)
	{
		for (int i = 1; i <= n - l + 1; i++)
		{
			int j = i + l - 1;
			m[i][j] = INF;
			for (int k = i; k <= j - 1; k++)
			{
				int  q = m[i][k] + m[k + 1][j] + p[i - 1] * p[k] * p[j];
				if (q < m[i][j])
				{

					m[i][j] = q;
					s[i][j] = k;
				}
			}
		}
	}
	return std::make_pair(m, s);
}
void PRINT_OPTIMAL_PARENS(const std::vector<std::vector<int>> &s, int i, int j)
{
	if (i == j)
	{
		std::cout << "A" << i;
	}
	else
	{
		std::cout << '(';
		PRINT_OPTIMAL_PARENS(s, i, s[i][j]);
		PRINT_OPTIMAL_PARENS(s, s[i][j] + 1, j);
		std::cout << ')';
	}
}

15.3 Elements of dynamic programming

int RECURSIVE_MATRIX_CHAIN(const std::vector<int> &p, int i, int j)
{
	const int INF = 1000000000;
	const int n = p.size() -1 ;
	std::vector<std::vector<int>> m(n+1, std::vector<int>(n+1, 0));
	if (i == j)
	{
		return 0;
	}
	m[i][j] = INF;
	for (int k = i; k <= j - 1; k++)
	{
		int q = RECURSIVE_MATRIX_CHAIN(p, i, k) +
			RECURSIVE_MATRIX_CHAIN(p, k + 1, j) + p[i - 1] * p[k] * p[j];
		
		if (q < m[i][j])
		{
			m[i][j] = q;
		}
	}
	return m[i][j];
}
int LOOKUP_CHAIN(std::vector<std::vector<int>> &m,const std::vector<int> &p,int i,int j)
{
	const int INF = 1000000000;

	if (m[i][j] < INF)
	{
		return m[i][j];
	}
	if (i == j)
	{
		m[i][j] = 0;
	}
	else for (int k = i ; k <= j - 1; k++)
	{
		int q = LOOKUP_CHAIN(m, p, i, k)
			+ LOOKUP_CHAIN(m, p, k + 1, j) + p[i - 1] * p[k] * p[j];
		if (q < m[i][j])
		{
			m[i][j] = q;
		}
	}
	return m[i][j];
}

int MEMORIZED_MATRIX_CHAIN(const std::vector<int> &p)
{
	const int INF = 1000000000;
	const int n = p.size() - 1;
	std::vector<std::vector<int>> m(n+1, std::vector<int>(n+1, 0));
	for (int i = 1; i <= n; i++)
	{

		for (int j = 1; j <= n; j++)
		{
			m[i][j] = INF;
		}
	}
	return LOOKUP_CHAIN(m, p, 1, n);
}

15.4 Longest common subsequence

참고 : https://www.acmicpc.net/problem/9251 https://www.acmicpc.net/problem/9252

$O(mn)$

const char *X = "ABCBDAB";
const char *Y = "BDCABA";

const char *X = "ACCGGTCGAGTGCGCGGAAGCCGGCCGAA";
const char *Y = "GTCGTTCGGAATGCCGTTGCTCTGTAAA";
#include<string.h>
enum class arrow
{
    left_up ,
    up ,
    left
};

typedef std::pair<std::vector<std::vector<int>>,std::vector<std::vector<arrow>>> Set;

Set LCS_LENGTH(const char* XX,const char* YY , const int m, const int n)
{
    const char * X = XX-1;
    const char * Y = YY-1;
    std::vector<std::vector<arrow>> b(m+1,std::vector<arrow>(n+1,arrow::left_up)) ;
    std::vector<std::vector<int>> c(m+1,std::vector<int>(n+1,0)) ;
    for(int i = 1 ; i <= m ; i++)
    {
        c[i][0] = 0;
    }
    for(int j = 0 ; j <= n; j++)
    {
        c[0][j] = 0;
    }

    for(int i = 1 ; i <= m; i++)
    {

        for(int j = 1; j <= n;j++)
        {
            if(X[i] == Y[j])
            {
                c[i][j] = c[i-1][j-1] +1;
                b[i][j] = arrow::left_up;
            }else if(c[i-1][j] >= c[i][j-1])
            {
                c[i][j] = c[i-1][j];
                b[i][j] = arrow::up;
            }
            else
            {
                c[i][j] = c[i][j-1];
                b[i][j] = arrow::left;
            }
        }
    }
    return std::make_pair(c,b);
}


void PRINT_LCS(const std::vector<std::vector<arrow>> b ,const char* XX, int i , int j)
{
    const char * X = XX-1;
    if( i == 0 || j == 0 )
    {
        return;
    }
    if( b[i][j] == arrow::left_up)
    {
        PRINT_LCS(b, X+1, i-1 , j-1);
        std::cout << X[i] <<' ';
    }
    else if(b[i][j] == arrow::up)
    {
        PRINT_LCS(b,X+1,i-1, j);
    }
    else
        PRINT_LCS(b,X+1,i, j-1);
}
int table[1001][1001];
char arr[1002];
char brr[1002];


const int asize = strlen(arr);
const int bsize = strlen(brr);
for (int i = 1; i < asize + 1; i++)
{
	for (int j = 1; j < bsize + 1; j++)
	{
		if (arr[i - 1] == brr[j - 1])
		{
			table[i][j] = table[i - 1][j - 1] + 1;
		}
		else if (table[i - 1][j] > table[i][j - 1])
		{
			table[i][j] = table[i - 1][j];
		}
		else
		{
			table[i][j] = table[i][j - 1];
		}
	}
}


stack<char> stk;
int i = asize, j = bsize;
while(!(j == 0 || i == 0))
{
	if (arr[i-1] == brr[j-1])
	{
		i--; j--;
		stk.push(arr[i]);
	}
	else if (table[i-1][j] >= table[i][j-1])
	{
		i--;
	}
	else
	{
		j--;
	}
}

while(!stk.empty())
{
	cout << stk.top();
	stk.pop();
}
  • table[asize][bsize]
  • stk

https://www.acmicpc.net/problem/9252

15.5 Optimal binary search trees