diff --git a/cli_integration_tests/expected_results_pro/CRISPRessoBatch_on_FANC/CRISPResso_on_Cas9/Cas9.CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPRessoBatch_on_FANC/CRISPResso_on_Cas9/Cas9.CRISPResso2_report.html
index 3c52eeb3..a14e78d7 100644
--- a/cli_integration_tests/expected_results_pro/CRISPRessoBatch_on_FANC/CRISPResso_on_Cas9/Cas9.CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPRessoBatch_on_FANC/CRISPResso_on_Cas9/Cas9.CRISPResso2_report.html
@@ -801,12 +801,12 @@ <h5 class="text-center mb-3">Cas9</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:44:02</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:52:34</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>GGAATCCCTTCTGCAGCACC</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -o /Users/mckaybowcut/Edilytics/CRISPResso2_tests/cli_integration_tests/CRISPRessoBatch_on_FANC --name Cas9 --flash_command None --fastp_command fastp --prime_editing_gap_open_penalty -50 --config_file None --aln_seed_min 2 --conversion_nuc_to T --needleman_wunsch_gap_extend -2 --min_average_read_quality 0 --needleman_wunsch_aln_matrix_loc EDNAFULL --max_rows_alleles_around_cut_to_plot 50 --guide_seq GGAATCCCTTCTGCAGCACC --amplicon_name Reference --min_bp_quality_or_N 0 --flexiguide_gap_open_penalty -20 --trimmomatic_command None --prime_editing_pegRNA_extension_quantification_window_size 5 --base_editor_target_ref_skip_allele_count 0 --min_frequency_alleles_around_cut_to_plot 0.2 --halt_on_plot_fail --base_editor_output --min_paired_end_reads_overlap 10 --aln_seed_count 5 --max_paired_end_reads_overlap None --needleman_wunsch_gap_open -20 --place_report_in_output_folder --prime_editing_pegRNA_scaffold_min_match_length 1 --quantification_window_size 1 --flexiguide_seq None --file_prefix Cas9 --exclude_bp_from_right 15 --min_single_bp_quality 0 --config_json None --verbosity 3 --needleman_wunsch_gap_incentive 1 --prime_editing_gap_extend_penalty 0 --aln_seed_len 10 --amplicon_seq CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG --fastq_r1 inputs/FANC.Cas9.fastq --default_min_aln_score 60 --plot_window_size 20 --flexiguide_homology 80 --n_processes 1 --quantification_window_center -3 --flexiguide_gap_extend_penalty -2 --exclude_bp_from_left 15 --debug --conversion_nuc_from C</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -o /mnt/c/Users/Snic9/Edilytics/CRISPResso2_tests/cli_integration_tests/CRISPRessoBatch_on_FANC --name Cas9 --prime_editing_pegRNA_extension_quantification_window_size 5 --default_min_aln_score 60 --conversion_nuc_from C --fastq_r1 inputs/FANC.Cas9.fastq --flexiguide_gap_open_penalty -20 --plot_window_size 20 --min_single_bp_quality 0 --fastp_command fastp --amplicon_seq CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG --needleman_wunsch_gap_extend -2 --quantification_window_center -3 --needleman_wunsch_gap_open -20 --debug --prime_editing_gap_extend_penalty 0 --exclude_bp_from_right 15 --file_prefix Cas9 --verbosity 3 --base_editor_target_ref_skip_allele_count 0 --min_bp_quality_or_N 0 --place_report_in_output_folder --conversion_nuc_to T --guide_seq GGAATCCCTTCTGCAGCACC --flash_command None --min_frequency_alleles_around_cut_to_plot 0.2 --aln_seed_min 2 --n_processes 1 --config_file None --base_editor_output --min_paired_end_reads_overlap 10 --prime_editing_gap_open_penalty -50 --needleman_wunsch_gap_incentive 1 --exclude_bp_from_left 15 --flexiguide_gap_extend_penalty -2 --prime_editing_pegRNA_scaffold_min_match_length 1 --quantification_window_size 1 --config_json None --trimmomatic_command None --aln_seed_len 10 --amplicon_name Reference --flexiguide_homology 80 --max_rows_alleles_around_cut_to_plot 50 --halt_on_plot_fail --aln_seed_count 5 --min_average_read_quality 0 --needleman_wunsch_aln_matrix_loc EDNAFULL --flexiguide_seq None --max_paired_end_reads_overlap None</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -881,7 +881,7 @@ <h5 class="text-center mb-3">Cas9</h5>
 needleman_wunsch_gap_incentive: 1
 needleman_wunsch_gap_open: -20
 no_rerun: False
-output_folder: /Users/mckaybowcut/Edilytics/CRISPResso2_tests/cli_integration_tests/CRISPRessoBatch_on_FANC
+output_folder: /mnt/c/Users/Snic9/Edilytics/CRISPResso2_tests/cli_integration_tests/CRISPRessoBatch_on_FANC
 place_report_in_output_folder: True
 plot_histogram_outliers: False
 plot_window_size: 20
@@ -1391,14 +1391,15 @@ <h5 class="text-center mb-3">Cas9</h5>
     
       
   
-<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="Cas9.9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.pdf">
-            <img src="Cas9.9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_Cas9_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC"></div>
+        <script type="text/javascript">const allele_table_Cas9_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC = {"plot_type": "allele_table", "reference": "CATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAG", "total_alleles": 48, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72XvXKDMAzH36WzzWEDgY4+D3oBbbkMHdqpUz/ev7JJCE1w5CCDYfD5kH8nWf5LHI8v3iGAc+i9R/QI3tFLc1pED7RGqx4cvKgnPjV9rXpbNa2q4/Pz9ft+UkswrbUU9qqaamhUE0kfb5/fiyh9GRJUq0zVE/AhKZgv2SdIevHThkh2IIxJofRsiOJnVV0NnTKWD6A4Mc6slo/gzDuZWyaXJXfrkIMqE8Gbw9LMWHeLCdXSxcpmSRRjZLX1TQgXOVJ1Gln2LjOWUGVY5l4zklEU+9UtpWECJmUlVJfLx1V5mFKNDVhtk2YhRDtHG2hAh0gT8OMmPGsStIlVR5W/R/0/sjJpmCySKdUoeb3mG6RSfyXL8ixX6Co/FvmiqI5F+VIopk8rmBeGK/4FJb7jCnK5s7IcytHXAB6i8TgDwFRTOK+qZ+zsrKhXsw/7DKIJu0JGnGYoDJsEZ8bluJbh1lWeJxRdY5PdFYr03ZqnOlCROJnDs6wNL9eMJU2NIRslzsI+E7WHZFxQMFbozVFF1KnJQJVqdXmUk/4dX4WQRXm9R30M5uh3IpFVkN1gGMtKeNcJbtdy8cP9jmrqaTYvWdEi2I/qFEKajCCLsnmoSKFohkkBFO71Y3z6A/KDr0YkFAAA", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": ""}], "quantification_windows": [[19, 20]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Cas9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.txt">Allele frequency table</a></small></p>
@@ -2140,7 +2141,743 @@ <h5 class="text-center mb-3">Cas9</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
 
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_Cas9_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC") && typeof allele_table_Cas9_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC !== "undefined") {
+      await buildAlleleTable(allele_table_Cas9_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC, "allele_table_Cas9_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_Cas9_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPRessoBatch_on_FANC/CRISPResso_on_Untreated/Untreated.CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPRessoBatch_on_FANC/CRISPResso_on_Untreated/Untreated.CRISPResso2_report.html
index 673d6751..dcd49bd7 100644
--- a/cli_integration_tests/expected_results_pro/CRISPRessoBatch_on_FANC/CRISPResso_on_Untreated/Untreated.CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPRessoBatch_on_FANC/CRISPResso_on_Untreated/Untreated.CRISPResso2_report.html
@@ -801,12 +801,12 @@ <h5 class="text-center mb-3">Untreated</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:43:43</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:48:48</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>GGAATCCCTTCTGCAGCACC</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -o /Users/mckaybowcut/Edilytics/CRISPResso2_tests/cli_integration_tests/CRISPRessoBatch_on_FANC --name Untreated --flash_command None --fastp_command fastp --prime_editing_gap_open_penalty -50 --config_file None --aln_seed_min 2 --conversion_nuc_to T --needleman_wunsch_gap_extend -2 --min_average_read_quality 0 --needleman_wunsch_aln_matrix_loc EDNAFULL --max_rows_alleles_around_cut_to_plot 50 --guide_seq GGAATCCCTTCTGCAGCACC --amplicon_name Reference --min_bp_quality_or_N 0 --flexiguide_gap_open_penalty -20 --trimmomatic_command None --prime_editing_pegRNA_extension_quantification_window_size 5 --base_editor_target_ref_skip_allele_count 0 --min_frequency_alleles_around_cut_to_plot 0.2 --halt_on_plot_fail --base_editor_output --min_paired_end_reads_overlap 10 --aln_seed_count 5 --max_paired_end_reads_overlap None --needleman_wunsch_gap_open -20 --place_report_in_output_folder --prime_editing_pegRNA_scaffold_min_match_length 1 --quantification_window_size 1 --flexiguide_seq None --file_prefix Untreated --exclude_bp_from_right 15 --min_single_bp_quality 0 --config_json None --verbosity 3 --needleman_wunsch_gap_incentive 1 --prime_editing_gap_extend_penalty 0 --aln_seed_len 10 --amplicon_seq CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG --fastq_r1 inputs/FANC.Untreated.fastq --default_min_aln_score 60 --plot_window_size 20 --flexiguide_homology 80 --n_processes 1 --quantification_window_center -3 --flexiguide_gap_extend_penalty -2 --exclude_bp_from_left 15 --debug --conversion_nuc_from C</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -o /mnt/c/Users/Snic9/Edilytics/CRISPResso2_tests/cli_integration_tests/CRISPRessoBatch_on_FANC --name Untreated --prime_editing_pegRNA_extension_quantification_window_size 5 --default_min_aln_score 60 --conversion_nuc_from C --fastq_r1 inputs/FANC.Untreated.fastq --flexiguide_gap_open_penalty -20 --plot_window_size 20 --min_single_bp_quality 0 --fastp_command fastp --amplicon_seq CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG --needleman_wunsch_gap_extend -2 --quantification_window_center -3 --needleman_wunsch_gap_open -20 --debug --prime_editing_gap_extend_penalty 0 --exclude_bp_from_right 15 --file_prefix Untreated --verbosity 3 --base_editor_target_ref_skip_allele_count 0 --min_bp_quality_or_N 0 --place_report_in_output_folder --conversion_nuc_to T --guide_seq GGAATCCCTTCTGCAGCACC --flash_command None --min_frequency_alleles_around_cut_to_plot 0.2 --aln_seed_min 2 --n_processes 1 --config_file None --base_editor_output --min_paired_end_reads_overlap 10 --prime_editing_gap_open_penalty -50 --needleman_wunsch_gap_incentive 1 --exclude_bp_from_left 15 --flexiguide_gap_extend_penalty -2 --prime_editing_pegRNA_scaffold_min_match_length 1 --quantification_window_size 1 --config_json None --trimmomatic_command None --aln_seed_len 10 --amplicon_name Reference --flexiguide_homology 80 --max_rows_alleles_around_cut_to_plot 50 --halt_on_plot_fail --aln_seed_count 5 --min_average_read_quality 0 --needleman_wunsch_aln_matrix_loc EDNAFULL --flexiguide_seq None --max_paired_end_reads_overlap None</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -881,7 +881,7 @@ <h5 class="text-center mb-3">Untreated</h5>
 needleman_wunsch_gap_incentive: 1
 needleman_wunsch_gap_open: -20
 no_rerun: False
-output_folder: /Users/mckaybowcut/Edilytics/CRISPResso2_tests/cli_integration_tests/CRISPRessoBatch_on_FANC
+output_folder: /mnt/c/Users/Snic9/Edilytics/CRISPResso2_tests/cli_integration_tests/CRISPRessoBatch_on_FANC
 place_report_in_output_folder: True
 plot_histogram_outliers: False
 plot_window_size: 20
@@ -1391,14 +1391,15 @@ <h5 class="text-center mb-3">Untreated</h5>
     
       
   
-<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="Untreated.9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.pdf">
-            <img src="Untreated.9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_Untreated_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC"></div>
+        <script type="text/javascript">const allele_table_Untreated_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC = {"plot_type": "allele_table", "reference": "CATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAG", "total_alleles": 7, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72SMQqAMAxF7+IcpJVKcQx/yAX+Vjp6AdH7G7rWRdCSDOGRzyOQUiYozVQJgAQN6u2zQ8KcOYWpTfJidUlRtjyvWUKr87j2Kk2Gz2VRwpx60VMao0TUUSLz5BgRv74IP3xeJ6o3tuR+QOQCAAA=", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": ""}], "quantification_windows": [[19, 20]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Untreated.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.txt">Allele frequency table</a></small></p>
@@ -2104,7 +2105,743 @@ <h5 class="text-center mb-3">Untreated</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
 
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_Untreated_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC") && typeof allele_table_Untreated_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC !== "undefined") {
+      await buildAlleleTable(allele_table_Untreated_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC, "allele_table_Untreated_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_Untreated_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_Both.Cas9/CRISPResso_on_FAN_+-C_asdf_-/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_Both.Cas9/CRISPResso_on_FAN_+-C_asdf_-/CRISPResso2_report.html
index ac2fe40d..f7d0ca9b 100644
--- a/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_Both.Cas9/CRISPResso_on_FAN_+-C_asdf_-/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_Both.Cas9/CRISPResso_on_FAN_+-C_asdf_-/CRISPResso2_report.html
@@ -801,12 +801,12 @@ <h5 class="text-center mb-3">FAN_+-C_asdf_-</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:43:55</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:47:42</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>GGAATCCCTTCTGCAGCACC</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso --fastq_r1 CRISPRessoPooled_on_Both.Cas9/AMPL_FAN_+-C_asdf_-.fastq.gz --amplicon_seq CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG --guide_seq GGAATCCCTTCTGCAGCACC --name FAN_+-C_asdf_- --display_name FAN /+-C%_:@#%a😀sdf - --output_folder CRISPRessoPooled_on_Both.Cas9 --keep_intermediate --place_report_in_output_folder --debug --n_processes 2 --halt_on_plot_fail</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso --fastq_r1 CRISPRessoPooled_on_Both.Cas9/AMPL_FAN_+-C_asdf_-.fastq.gz --amplicon_seq CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG --guide_seq GGAATCCCTTCTGCAGCACC --name FAN_+-C_asdf_- --display_name FAN /+-C%_:@#%a😀sdf - --output_folder CRISPRessoPooled_on_Both.Cas9 --keep_intermediate --place_report_in_output_folder --debug --n_processes 2 --halt_on_plot_fail</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1391,14 +1391,15 @@ <h5 class="text-center mb-3">FAN_+-C_asdf_-</h5>
     
       
   
-<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.pdf">
-            <img src="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC"></div>
+        <script type="text/javascript">const allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC = {"plot_type": "allele_table", "reference": "CATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAG", "total_alleles": 48, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72XvXKDMAzH36WzzWEDgY4+D3oBbbkMHdqpUz/ev7JJCE1w5CCDYfD5kH8nWf5LHI8v3iGAc+i9R/QI3tFLc1pED7RGqx4cvKgnPjV9rXpbNa2q4/Pz9ft+UkswrbUU9qqaamhUE0kfb5/fiyh9GRJUq0zVE/AhKZgv2SdIevHThkh2IIxJofRsiOJnVV0NnTKWD6A4Mc6slo/gzDuZWyaXJXfrkIMqE8Gbw9LMWHeLCdXSxcpmSRRjZLX1TQgXOVJ1Gln2LjOWUGVY5l4zklEU+9UtpWECJmUlVJfLx1V5mFKNDVhtk2YhRDtHG2hAh0gT8OMmPGsStIlVR5W/R/0/sjJpmCySKdUoeb3mG6RSfyXL8ixX6Co/FvmiqI5F+VIopk8rmBeGK/4FJb7jCnK5s7IcytHXAB6i8TgDwFRTOK+qZ+zsrKhXsw/7DKIJu0JGnGYoDJsEZ8bluJbh1lWeJxRdY5PdFYr03ZqnOlCROJnDs6wNL9eMJU2NIRslzsI+E7WHZFxQMFbozVFF1KnJQJVqdXmUk/4dX4WQRXm9R30M5uh3IpFVkN1gGMtKeNcJbtdy8cP9jmrqaTYvWdEi2I/qFEKajCCLsnmoSKFohkkBFO71Y3z6A/KDr0YkFAAA", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": ""}], "quantification_windows": [[19, 20]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.txt">Allele frequency table</a></small></p>
@@ -1852,7 +1853,743 @@ <h5 class="text-center mb-3">FAN_+-C_asdf_-</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
 
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC") && typeof allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC !== "undefined") {
+      await buildAlleleTable(allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC, "allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_Both.Cas9/CRISPResso_on_HEK3/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_Both.Cas9/CRISPResso_on_HEK3/CRISPResso2_report.html
index 28f8125e..f3113609 100644
--- a/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_Both.Cas9/CRISPResso_on_HEK3/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_Both.Cas9/CRISPResso_on_HEK3/CRISPResso2_report.html
@@ -801,12 +801,12 @@ <h5 class="text-center mb-3">HEK3</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:43:55</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:48:42</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>GGAAACGCCCATGCAATTAGTCTATTTCTGCTGCAAGTAAGCATGCATTTGTAGGCTTGATGCTTTTTTTCTGCTTCTCCAGCCCTGGCCTGGGTCAATCCTTGGGGCCCAGACTGAGCACGTGATGGCAGAGGAAAGGAAGCCCTGCTTCCTCCAGAGGGCGTCGCAGGACAGCTTTTCCTAGACAGGGGCTAGTATGTGCAGCTCCTGCACCGGGATACTGGTTGACAAG</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>GGCCCAGACTGAGCACGTGA</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso --fastq_r1 CRISPRessoPooled_on_Both.Cas9/AMPL_HEK3.fastq.gz --amplicon_seq GGAAACGCCCATGCAATTAGTCTATTTCTGCTGCAAGTAAGCATGCATTTGTAGGCTTGATGCTTTTTTTCTGCTTCTCCAGCCCTGGCCTGGGTCAATCCTTGGGGCCCAGACTGAGCACGTGATGGCAGAGGAAAGGAAGCCCTGCTTCCTCCAGAGGGCGTCGCAGGACAGCTTTTCCTAGACAGGGGCTAGTATGTGCAGCTCCTGCACCGGGATACTGGTTGACAAG --guide_seq GGCCCAGACTGAGCACGTGA --name HEK3 --display_name HEK3 --output_folder CRISPRessoPooled_on_Both.Cas9 --keep_intermediate --place_report_in_output_folder --debug --n_processes 2 --halt_on_plot_fail</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso --fastq_r1 CRISPRessoPooled_on_Both.Cas9/AMPL_HEK3.fastq.gz --amplicon_seq GGAAACGCCCATGCAATTAGTCTATTTCTGCTGCAAGTAAGCATGCATTTGTAGGCTTGATGCTTTTTTTCTGCTTCTCCAGCCCTGGCCTGGGTCAATCCTTGGGGCCCAGACTGAGCACGTGATGGCAGAGGAAAGGAAGCCCTGCTTCCTCCAGAGGGCGTCGCAGGACAGCTTTTCCTAGACAGGGGCTAGTATGTGCAGCTCCTGCACCGGGATACTGGTTGACAAG --guide_seq GGCCCAGACTGAGCACGTGA --name HEK3 --display_name HEK3 --output_folder CRISPRessoPooled_on_Both.Cas9 --keep_intermediate --place_report_in_output_folder --debug --n_processes 2 --halt_on_plot_fail</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1391,14 +1391,15 @@ <h5 class="text-center mb-3">HEK3</h5>
     
       
   
-<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Alleles_frequency_table_around_sgRNA_GGCCCAGACTGAGCACGTGA.pdf">
-            <img src="9.Alleles_frequency_table_around_sgRNA_GGCCCAGACTGAGCACGTGA.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Alleles_frequency_table_around_sgRNA_GGCCCAGACTGAGCACGTGA"></div>
+        <script type="text/javascript">const allele_table_9_Alleles_frequency_table_around_sgRNA_GGCCCAGACTGAGCACGTGA = {"plot_type": "allele_table", "reference": "TGGGGCCCAGACTGAGCACGTGATGGCAGAGGAAAGGAAG", "total_alleles": 58, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72YyXKEIBCG3yVnsARxmSPFgRfgNjWHHJJTTlnePy0ucQzYaKPOlNY4wFf90w3d3O8vzsJljNFWG2e1NdpYeMLr/pW1WvubfWE7mopSMiWKjpX+8/358/Zg2yx9lFVXTIqilSiLz9dhuzpWFbID8zzq/fXjK8SaMDQNGyYL1bBuE+X7DzQCqgZUWQMRQ3GyZygmigZuuFWhASIoHmw6okoP20BxulUVoCT4IWbVwgeJKMQFhwGoCo6sTQX5IqwICoJ0RSeZEKnuzsmsNgFFdYzJLBxlqJM1olB3X/iFzoriide+nQRQSvSLfHkVq1XJrOO71shSZSrLkFlVql2knX9gNXUKi5pljBom+AY9oxlYcrXE9+1hZpy2fiTrYJzIzr8igfXYfPkAW0RyXEKqa8jAbsJxvz/G6lJYeaZLBLOnk+yKpE/BCIO+LvN8jQOEaDQNb0msLH4oNjOogIwUVouzyMXJtBym1wtUFFIvZFWwxlm5FFRIBpVxja+wZM3r5qZV62RULgHR2oRP/R1VQKwQ186Y/gtPeGG083/EMtBgVjeTKgmWpZQLy1U+414SZdEiS+xgEWfrtgNlLkBd5O5/KHsBKlMQJ7hF6EgtHlr/aMvQQlHUknVGoSWrzSRguc6pQ+dOxkGFDCm966tyMPPo2qRk8hmXPl1B313nUXDHia69gjR0N+eT7OnqOf/GPZ8GbbvfqulMap883YXit/+5jv9jS8WEevwCxMVRy1MYAAA=", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": ""}], "quantification_windows": [[19, 20]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGCCCAGACTGAGCACGTGA. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGCCCAGACTGAGCACGTGA. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Alleles_frequency_table_around_sgRNA_GGCCCAGACTGAGCACGTGA.txt">Allele frequency table</a></small></p>
@@ -1852,7 +1853,743 @@ <h5 class="text-center mb-3">HEK3</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
 
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_Alleles_frequency_table_around_sgRNA_GGCCCAGACTGAGCACGTGA") && typeof allele_table_9_Alleles_frequency_table_around_sgRNA_GGCCCAGACTGAGCACGTGA !== "undefined") {
+      await buildAlleleTable(allele_table_9_Alleles_frequency_table_around_sgRNA_GGCCCAGACTGAGCACGTGA, "allele_table_9_Alleles_frequency_table_around_sgRNA_GGCCCAGACTGAGCACGTGA")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Alleles_frequency_table_around_sgRNA_GGCCCAGACTGAGCACGTGA")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_pooled-mixed-mode-genome-demux/CRISPResso_on_GENOME/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_pooled-mixed-mode-genome-demux/CRISPResso_on_GENOME/CRISPResso2_report.html
index a4bab399..a60615f0 100644
--- a/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_pooled-mixed-mode-genome-demux/CRISPResso_on_GENOME/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_pooled-mixed-mode-genome-demux/CRISPResso_on_GENOME/CRISPResso2_report.html
@@ -801,12 +801,12 @@ <h5 class="text-center mb-3">GENOME</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:43:56</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:48:53</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CACCAGGAGAGGAGGGACCTGGCCCTTCAGGGTCGAGCTCAACAGAGGAAAAGATCTCAGGGCACCCAGAGCCCAGTGGCTTTCAGCACCTGCATGAAAATCAGAGATCAACCAGATTACCCCATATTGCCCAAGAGAAAACTGAGGCCAGAAAGTGATGGAGCTTGCCCAGGACCCCAGAGGGTGTTAGAGGCAGGCCAGAACCAGAGGACAGCTCTGTCCCAGC</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>ATCAGAGATCAACCAGATTA</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso --fastq_r1 CRISPRessoPooled_on_pooled-mixed-mode-genome-demux/MAPPED_REGIONS/REGION_chr9_1251_1477.fastq.gz --amplicon_seq CACCAGGAGAGGAGGGACCTGGCCCTTCAGGGTCGAGCTCAACAGAGGAAAAGATCTCAGGGCACCCAGAGCCCAGTGGCTTTCAGCACCTGCATGAAAATCAGAGATCAACCAGATTACCCCATATTGCCCAAGAGAAAACTGAGGCCAGAAAGTGATGGAGCTTGCCCAGGACCCCAGAGGGTGTTAGAGGCAGGCCAGAACCAGAGGACAGCTCTGTCCCAGC --guide_seq ATCAGAGATCAACCAGATTA --name GENOME --display_name GENOME --output_folder CRISPRessoPooled_on_pooled-mixed-mode-genome-demux --keep_intermediate --place_report_in_output_folder --debug --halt_on_plot_fail</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso --fastq_r1 CRISPRessoPooled_on_pooled-mixed-mode-genome-demux/MAPPED_REGIONS/REGION_chr9_1251_1477.fastq.gz --amplicon_seq CACCAGGAGAGGAGGGACCTGGCCCTTCAGGGTCGAGCTCAACAGAGGAAAAGATCTCAGGGCACCCAGAGCCCAGTGGCTTTCAGCACCTGCATGAAAATCAGAGATCAACCAGATTACCCCATATTGCCCAAGAGAAAACTGAGGCCAGAAAGTGATGGAGCTTGCCCAGGACCCCAGAGGGTGTTAGAGGCAGGCCAGAACCAGAGGACAGCTCTGTCCCAGC --guide_seq ATCAGAGATCAACCAGATTA --name GENOME --display_name GENOME --output_folder CRISPRessoPooled_on_pooled-mixed-mode-genome-demux --keep_intermediate --place_report_in_output_folder --debug --halt_on_plot_fail</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1391,14 +1391,15 @@ <h5 class="text-center mb-3">GENOME</h5>
     
       
   
-<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Alleles_frequency_table_around_sgRNA_ATCAGAGATCAACCAGATTA.pdf">
-            <img src="9.Alleles_frequency_table_around_sgRNA_ATCAGAGATCAACCAGATTA.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Alleles_frequency_table_around_sgRNA_ATCAGAGATCAACCAGATTA"></div>
+        <script type="text/javascript">const allele_table_9_Alleles_frequency_table_around_sgRNA_ATCAGAGATCAACCAGATTA = {"plot_type": "allele_table", "reference": "AAAATCAGAGATCAACCAGATTACCCCATATTGCCCAAGA", "total_alleles": 2, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA4uOVnIEghBnR3cgBFKOzkAmEABpICvEMSTEHcQASirpYFMKVIBNqZGlgYGOhYmehaWOARAa6aQl5hSnxupEk2AGCUpNDc10DE31DA3BthnolBSVpsbGAgDDPjVi3QAAAA==", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": ""}], "quantification_windows": [[19, 20]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA ATCAGAGATCAACCAGATTA. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA ATCAGAGATCAACCAGATTA. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Alleles_frequency_table_around_sgRNA_ATCAGAGATCAACCAGATTA.txt">Allele frequency table</a></small></p>
@@ -1852,7 +1853,743 @@ <h5 class="text-center mb-3">GENOME</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
 
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_Alleles_frequency_table_around_sgRNA_ATCAGAGATCAACCAGATTA") && typeof allele_table_9_Alleles_frequency_table_around_sgRNA_ATCAGAGATCAACCAGATTA !== "undefined") {
+      await buildAlleleTable(allele_table_9_Alleles_frequency_table_around_sgRNA_ATCAGAGATCAACCAGATTA, "allele_table_9_Alleles_frequency_table_around_sgRNA_ATCAGAGATCAACCAGATTA")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Alleles_frequency_table_around_sgRNA_ATCAGAGATCAACCAGATTA")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_pooled-mixed-mode/CRISPResso_on_FANC/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_pooled-mixed-mode/CRISPResso_on_FANC/CRISPResso2_report.html
index 860f651e..4690b9d3 100644
--- a/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_pooled-mixed-mode/CRISPResso_on_FANC/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_pooled-mixed-mode/CRISPResso_on_FANC/CRISPResso2_report.html
@@ -801,12 +801,12 @@ <h5 class="text-center mb-3">FANC</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:44:11</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:47:42</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>GGAATCCCTTCTGCAGCACC</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso --fastq_r1 CRISPRessoPooled_on_pooled-mixed-mode/MAPPED_REGIONS/REGION_chr11_1047_1270.fastq.gz --amplicon_seq CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG --guide_seq GGAATCCCTTCTGCAGCACC --name FANC --display_name FANC --output_folder CRISPRessoPooled_on_pooled-mixed-mode --keep_intermediate --place_report_in_output_folder --debug --halt_on_plot_fail</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso --fastq_r1 CRISPRessoPooled_on_pooled-mixed-mode/MAPPED_REGIONS/REGION_chr11_1047_1270.fastq.gz --amplicon_seq CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG --guide_seq GGAATCCCTTCTGCAGCACC --name FANC --display_name FANC --output_folder CRISPRessoPooled_on_pooled-mixed-mode --keep_intermediate --place_report_in_output_folder --debug --halt_on_plot_fail</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1391,14 +1391,15 @@ <h5 class="text-center mb-3">FANC</h5>
     
       
   
-<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.pdf">
-            <img src="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC"></div>
+        <script type="text/javascript">const allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC = {"plot_type": "allele_table", "reference": "CATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAG", "total_alleles": 48, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72XvXKDMAzH36WzzWEDgY4+D3oBbbkMHdqpUz/ev7JJCE1w5CCDYfD5kH8nWf5LHI8v3iGAc+i9R/QI3tFLc1pED7RGqx4cvKgnPjV9rXpbNa2q4/Pz9ft+UkswrbUU9qqaamhUE0kfb5/fiyh9GRJUq0zVE/AhKZgv2SdIevHThkh2IIxJofRsiOJnVV0NnTKWD6A4Mc6slo/gzDuZWyaXJXfrkIMqE8Gbw9LMWHeLCdXSxcpmSRRjZLX1TQgXOVJ1Gln2LjOWUGVY5l4zklEU+9UtpWECJmUlVJfLx1V5mFKNDVhtk2YhRDtHG2hAh0gT8OMmPGsStIlVR5W/R/0/sjJpmCySKdUoeb3mG6RSfyXL8ixX6Co/FvmiqI5F+VIopk8rmBeGK/4FJb7jCnK5s7IcytHXAB6i8TgDwFRTOK+qZ+zsrKhXsw/7DKIJu0JGnGYoDJsEZ8bluJbh1lWeJxRdY5PdFYr03ZqnOlCROJnDs6wNL9eMJU2NIRslzsI+E7WHZFxQMFbozVFF1KnJQJVqdXmUk/4dX4WQRXm9R30M5uh3IpFVkN1gGMtKeNcJbtdy8cP9jmrqaTYvWdEi2I/qFEKajCCLsnmoSKFohkkBFO71Y3z6A/KDr0YkFAAA", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": ""}], "quantification_windows": [[19, 20]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.txt">Allele frequency table</a></small></p>
@@ -1852,7 +1853,743 @@ <h5 class="text-center mb-3">FANC</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
 
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC") && typeof allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC !== "undefined") {
+      await buildAlleleTable(allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC, "allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_pooled-mixed-mode/CRISPResso_on_GENOME/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_pooled-mixed-mode/CRISPResso_on_GENOME/CRISPResso2_report.html
index 25c8d949..1d30bda0 100644
--- a/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_pooled-mixed-mode/CRISPResso_on_GENOME/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_pooled-mixed-mode/CRISPResso_on_GENOME/CRISPResso2_report.html
@@ -801,12 +801,12 @@ <h5 class="text-center mb-3">GENOME</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:44:25</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:52:43</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CACCAGGAGAGGAGGGACCTGGCCCTTCAGGGTCGAGCTCAACAGAGGAAAAGATCTCAGGGCACCCAGAGCCCAGTGGCTTTCAGCACCTGCATGAAAATCAGAGATCAACCAGATTACCCCATATTGCCCAAGAGAAAACTGAGGCCAGAAAGTGATGGAGCTTGCCCAGGACCCCAGAGGGTGTTAGAGGCAGGCCAGAACCAGAGGACAGCTCTGTCCCAGC</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>ATCAGAGATCAACCAGATTA</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso --fastq_r1 CRISPRessoPooled_on_pooled-mixed-mode/MAPPED_REGIONS/REGION_chr9_1251_1477.fastq.gz --amplicon_seq CACCAGGAGAGGAGGGACCTGGCCCTTCAGGGTCGAGCTCAACAGAGGAAAAGATCTCAGGGCACCCAGAGCCCAGTGGCTTTCAGCACCTGCATGAAAATCAGAGATCAACCAGATTACCCCATATTGCCCAAGAGAAAACTGAGGCCAGAAAGTGATGGAGCTTGCCCAGGACCCCAGAGGGTGTTAGAGGCAGGCCAGAACCAGAGGACAGCTCTGTCCCAGC --guide_seq ATCAGAGATCAACCAGATTA --name GENOME --display_name GENOME --output_folder CRISPRessoPooled_on_pooled-mixed-mode --keep_intermediate --place_report_in_output_folder --debug --halt_on_plot_fail</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso --fastq_r1 CRISPRessoPooled_on_pooled-mixed-mode/MAPPED_REGIONS/REGION_chr9_1251_1477.fastq.gz --amplicon_seq CACCAGGAGAGGAGGGACCTGGCCCTTCAGGGTCGAGCTCAACAGAGGAAAAGATCTCAGGGCACCCAGAGCCCAGTGGCTTTCAGCACCTGCATGAAAATCAGAGATCAACCAGATTACCCCATATTGCCCAAGAGAAAACTGAGGCCAGAAAGTGATGGAGCTTGCCCAGGACCCCAGAGGGTGTTAGAGGCAGGCCAGAACCAGAGGACAGCTCTGTCCCAGC --guide_seq ATCAGAGATCAACCAGATTA --name GENOME --display_name GENOME --output_folder CRISPRessoPooled_on_pooled-mixed-mode --keep_intermediate --place_report_in_output_folder --debug --halt_on_plot_fail</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1391,14 +1391,15 @@ <h5 class="text-center mb-3">GENOME</h5>
     
       
   
-<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Alleles_frequency_table_around_sgRNA_ATCAGAGATCAACCAGATTA.pdf">
-            <img src="9.Alleles_frequency_table_around_sgRNA_ATCAGAGATCAACCAGATTA.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Alleles_frequency_table_around_sgRNA_ATCAGAGATCAACCAGATTA"></div>
+        <script type="text/javascript">const allele_table_9_Alleles_frequency_table_around_sgRNA_ATCAGAGATCAACCAGATTA = {"plot_type": "allele_table", "reference": "AAAATCAGAGATCAACCAGATTACCCCATATTGCCCAAGA", "total_alleles": 2, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA4uOVnIEghBnR3cgBFKOzkAmEABpICvEMSTEHcQASirpYFMKVIBNqZGlgYGOhYmehaWOARAa6aQl5hSnxupEk2AGCUpNDc10DE31DA3BthnolBSVpsbGAgDDPjVi3QAAAA==", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": ""}], "quantification_windows": [[19, 20]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA ATCAGAGATCAACCAGATTA. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA ATCAGAGATCAACCAGATTA. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Alleles_frequency_table_around_sgRNA_ATCAGAGATCAACCAGATTA.txt">Allele frequency table</a></small></p>
@@ -1852,7 +1853,743 @@ <h5 class="text-center mb-3">GENOME</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
 
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_Alleles_frequency_table_around_sgRNA_ATCAGAGATCAACCAGATTA") && typeof allele_table_9_Alleles_frequency_table_around_sgRNA_ATCAGAGATCAACCAGATTA !== "undefined") {
+      await buildAlleleTable(allele_table_9_Alleles_frequency_table_around_sgRNA_ATCAGAGATCAACCAGATTA, "allele_table_9_Alleles_frequency_table_around_sgRNA_ATCAGAGATCAACCAGATTA")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Alleles_frequency_table_around_sgRNA_ATCAGAGATCAACCAGATTA")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_pooled-mixed-mode/CRISPResso_on_HEK3/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_pooled-mixed-mode/CRISPResso_on_HEK3/CRISPResso2_report.html
index 401871bb..cc27c95f 100644
--- a/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_pooled-mixed-mode/CRISPResso_on_HEK3/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_pooled-mixed-mode/CRISPResso_on_HEK3/CRISPResso2_report.html
@@ -801,12 +801,12 @@ <h5 class="text-center mb-3">HEK3</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:44:19</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:50:56</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>GGAAACGCCCATGCAATTAGTCTATTTCTGCTGCAAGTAAGCATGCATTTGTAGGCTTGATGCTTTTTTTCTGCTTCTCCAGCCCTGGCCTGGGTCAATCCTTGGGGCCCAGACTGAGCACGTGATGGCAGAGGAAAGGAAGCCCTGCTTCCTCCAGAGGGCGTCGCAGGACAGCTTTTCCTAGACAGGGGCTAGTATGTGCAGCTCCTGCACCGGGATACTGGTTGACAAG</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>GGCCCAGACTGAGCACGTGA</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso --fastq_r1 CRISPRessoPooled_on_pooled-mixed-mode/MAPPED_REGIONS/REGION_chr9_966_1198.fastq.gz --amplicon_seq GGAAACGCCCATGCAATTAGTCTATTTCTGCTGCAAGTAAGCATGCATTTGTAGGCTTGATGCTTTTTTTCTGCTTCTCCAGCCCTGGCCTGGGTCAATCCTTGGGGCCCAGACTGAGCACGTGATGGCAGAGGAAAGGAAGCCCTGCTTCCTCCAGAGGGCGTCGCAGGACAGCTTTTCCTAGACAGGGGCTAGTATGTGCAGCTCCTGCACCGGGATACTGGTTGACAAG --guide_seq GGCCCAGACTGAGCACGTGA --name HEK3 --display_name HEK3 --output_folder CRISPRessoPooled_on_pooled-mixed-mode --keep_intermediate --place_report_in_output_folder --debug --halt_on_plot_fail</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso --fastq_r1 CRISPRessoPooled_on_pooled-mixed-mode/MAPPED_REGIONS/REGION_chr9_966_1198.fastq.gz --amplicon_seq GGAAACGCCCATGCAATTAGTCTATTTCTGCTGCAAGTAAGCATGCATTTGTAGGCTTGATGCTTTTTTTCTGCTTCTCCAGCCCTGGCCTGGGTCAATCCTTGGGGCCCAGACTGAGCACGTGATGGCAGAGGAAAGGAAGCCCTGCTTCCTCCAGAGGGCGTCGCAGGACAGCTTTTCCTAGACAGGGGCTAGTATGTGCAGCTCCTGCACCGGGATACTGGTTGACAAG --guide_seq GGCCCAGACTGAGCACGTGA --name HEK3 --display_name HEK3 --output_folder CRISPRessoPooled_on_pooled-mixed-mode --keep_intermediate --place_report_in_output_folder --debug --halt_on_plot_fail</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1391,14 +1391,15 @@ <h5 class="text-center mb-3">HEK3</h5>
     
       
   
-<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Alleles_frequency_table_around_sgRNA_GGCCCAGACTGAGCACGTGA.pdf">
-            <img src="9.Alleles_frequency_table_around_sgRNA_GGCCCAGACTGAGCACGTGA.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Alleles_frequency_table_around_sgRNA_GGCCCAGACTGAGCACGTGA"></div>
+        <script type="text/javascript">const allele_table_9_Alleles_frequency_table_around_sgRNA_GGCCCAGACTGAGCACGTGA = {"plot_type": "allele_table", "reference": "TGGGGCCCAGACTGAGCACGTGATGGCAGAGGAAAGGAAG", "total_alleles": 58, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72YyXKEIBCG3yVnsARxmSPFgRfgNjWHHJJTTlnePy0ucQzYaKPOlNY4wFf90w3d3O8vzsJljNFWG2e1NdpYeMLr/pW1WvubfWE7mopSMiWKjpX+8/358/Zg2yx9lFVXTIqilSiLz9dhuzpWFbID8zzq/fXjK8SaMDQNGyYL1bBuE+X7DzQCqgZUWQMRQ3GyZygmigZuuFWhASIoHmw6okoP20BxulUVoCT4IWbVwgeJKMQFhwGoCo6sTQX5IqwICoJ0RSeZEKnuzsmsNgFFdYzJLBxlqJM1olB3X/iFzoriide+nQRQSvSLfHkVq1XJrOO71shSZSrLkFlVql2knX9gNXUKi5pljBom+AY9oxlYcrXE9+1hZpy2fiTrYJzIzr8igfXYfPkAW0RyXEKqa8jAbsJxvz/G6lJYeaZLBLOnk+yKpE/BCIO+LvN8jQOEaDQNb0msLH4oNjOogIwUVouzyMXJtBym1wtUFFIvZFWwxlm5FFRIBpVxja+wZM3r5qZV62RULgHR2oRP/R1VQKwQ186Y/gtPeGG083/EMtBgVjeTKgmWpZQLy1U+414SZdEiS+xgEWfrtgNlLkBd5O5/KHsBKlMQJ7hF6EgtHlr/aMvQQlHUknVGoSWrzSRguc6pQ+dOxkGFDCm966tyMPPo2qRk8hmXPl1B313nUXDHia69gjR0N+eT7OnqOf/GPZ8GbbvfqulMap883YXit/+5jv9jS8WEevwCxMVRy1MYAAA=", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": ""}], "quantification_windows": [[19, 20]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGCCCAGACTGAGCACGTGA. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGCCCAGACTGAGCACGTGA. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Alleles_frequency_table_around_sgRNA_GGCCCAGACTGAGCACGTGA.txt">Allele frequency table</a></small></p>
@@ -1852,7 +1853,743 @@ <h5 class="text-center mb-3">HEK3</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
 
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_Alleles_frequency_table_around_sgRNA_GGCCCAGACTGAGCACGTGA") && typeof allele_table_9_Alleles_frequency_table_around_sgRNA_GGCCCAGACTGAGCACGTGA !== "undefined") {
+      await buildAlleleTable(allele_table_9_Alleles_frequency_table_around_sgRNA_GGCCCAGACTGAGCACGTGA, "allele_table_9_Alleles_frequency_table_around_sgRNA_GGCCCAGACTGAGCACGTGA")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Alleles_frequency_table_around_sgRNA_GGCCCAGACTGAGCACGTGA")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_pooled-paired-sim/CRISPResso_on_Trimmed/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_pooled-paired-sim/CRISPResso_on_Trimmed/CRISPResso2_report.html
index f3064f0f..3e25db7b 100644
--- a/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_pooled-paired-sim/CRISPResso_on_Trimmed/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPRessoPooled_on_pooled-paired-sim/CRISPResso_on_Trimmed/CRISPResso2_report.html
@@ -795,10 +795,10 @@ <h5 class="text-center mb-3">Trimmed</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:43:56</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:48:34</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>TCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTT</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso --fastq_r1 CRISPRessoPooled_on_pooled-paired-sim/AMPL_Trimmed.fastq.gz --amplicon_seq TCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTT --name Trimmed --display_name Trimmed --output_folder CRISPRessoPooled_on_pooled-paired-sim --trim_sequences --fastp_options_string  --detect_adapter_for_pe --keep_intermediate --place_report_in_output_folder --debug --halt_on_plot_fail</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso --fastq_r1 CRISPRessoPooled_on_pooled-paired-sim/AMPL_Trimmed.fastq.gz --amplicon_seq TCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTT --name Trimmed --display_name Trimmed --output_folder CRISPRessoPooled_on_pooled-paired-sim --trim_sequences --fastp_options_string  --detect_adapter_for_pe --keep_intermediate --place_report_in_output_folder --debug --halt_on_plot_fail</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1792,7 +1792,6 @@ <h5 class="text-center mb-3">Trimmed</h5>
 </script>
 
 
-
       
       <div class="row">
       <div class="col-sm-1"></div>
diff --git a/cli_integration_tests/expected_results_pro/CRISPRessoWGS_on_Both.Cas9.fastq.smallGenome/CRISPResso_on_FANCF/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPRessoWGS_on_Both.Cas9.fastq.smallGenome/CRISPResso_on_FANCF/CRISPResso2_report.html
index 3736be9d..52d02250 100644
--- a/cli_integration_tests/expected_results_pro/CRISPRessoWGS_on_Both.Cas9.fastq.smallGenome/CRISPResso_on_FANCF/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPRessoWGS_on_Both.Cas9.fastq.smallGenome/CRISPResso_on_FANCF/CRISPResso2_report.html
@@ -801,10 +801,10 @@ <h5 class="text-center mb-3">FANCF</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:43:58</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:47:39</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>AGAGCCGTGCGAATGGGGCCATGCCGACCAAAGCGCCGATGGATGTGGCGCAGGTAGCGCGCCCACTGCAAGGCCCGGCGCACGGTGGCGGGGTCCCAGGTGCTGACGTAGGTAGTGCTTGAGACCGCCAGAAGCTCGGAAAAGCGATCCAGGTGCTGCAGAAGGGATTCCATGAGGTGCGCGAAGGCCCTACTTCCGCTTTCACCTTGGAGACGGCGACTCTCTGCGTACTGATTGGAACATCCGCGAA</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso --fastq_r1 CRISPRessoWGS_on_Both.Cas9.fastq.smallGenome/ANALYZED_REGIONS/REGION_FANCF.fastq.gz --amplicon_seq AGAGCCGTGCGAATGGGGCCATGCCGACCAAAGCGCCGATGGATGTGGCGCAGGTAGCGCGCCCACTGCAAGGCCCGGCGCACGGTGGCGGGGTCCCAGGTGCTGACGTAGGTAGTGCTTGAGACCGCCAGAAGCTCGGAAAAGCGATCCAGGTGCTGCAGAAGGGATTCCATGAGGTGCGCGAAGGCCCTACTTCCGCTTTCACCTTGGAGACGGCGACTCTCTGCGTACTGATTGGAACATCCGCGAA --name FANCF --output_folder CRISPRessoWGS_on_Both.Cas9.fastq.smallGenome --place_report_in_output_folder --debug --halt_on_plot_fail</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso --fastq_r1 CRISPRessoWGS_on_Both.Cas9.fastq.smallGenome/ANALYZED_REGIONS/REGION_FANCF.fastq.gz --amplicon_seq AGAGCCGTGCGAATGGGGCCATGCCGACCAAAGCGCCGATGGATGTGGCGCAGGTAGCGCGCCCACTGCAAGGCCCGGCGCACGGTGGCGGGGTCCCAGGTGCTGACGTAGGTAGTGCTTGAGACCGCCAGAAGCTCGGAAAAGCGATCCAGGTGCTGCAGAAGGGATTCCATGAGGTGCGCGAAGGCCCTACTTCCGCTTTCACCTTGGAGACGGCGACTCTCTGCGTACTGATTGGAACATCCGCGAA --name FANCF --output_folder CRISPRessoWGS_on_Both.Cas9.fastq.smallGenome --place_report_in_output_folder --debug --halt_on_plot_fail</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1798,7 +1798,6 @@ <h5 class="text-center mb-3">FANCF</h5>
 </script>
 
 
-
       
       <div class="row">
       <div class="col-sm-1"></div>
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_FANC.Cas9/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_FANC.Cas9/CRISPResso2_report.html
index 5f77d659..30f966a1 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_FANC.Cas9/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_FANC.Cas9/CRISPResso2_report.html
@@ -799,12 +799,12 @@ <h3>Analysis of genome editing outcomes from deep sequencing data</h3>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:43:37</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:45:25</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>GGAATCCCTTCTGCAGCACC</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/FANC.Cas9.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/FANC.Cas9.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1389,14 +1389,15 @@ <h3>Analysis of genome editing outcomes from deep sequencing data</h3>
     
       
   
-<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.pdf">
-            <img src="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC"></div>
+        <script type="text/javascript">const allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC = {"plot_type": "allele_table", "reference": "CATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAG", "total_alleles": 48, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72XvXKDMAzH36WzzWEDgY4+D3oBbbkMHdqpUz/ev7JJCE1w5CCDYfD5kH8nWf5LHI8v3iGAc+i9R/QI3tFLc1pED7RGqx4cvKgnPjV9rXpbNa2q4/Pz9ft+UkswrbUU9qqaamhUE0kfb5/fiyh9GRJUq0zVE/AhKZgv2SdIevHThkh2IIxJofRsiOJnVV0NnTKWD6A4Mc6slo/gzDuZWyaXJXfrkIMqE8Gbw9LMWHeLCdXSxcpmSRRjZLX1TQgXOVJ1Gln2LjOWUGVY5l4zklEU+9UtpWECJmUlVJfLx1V5mFKNDVhtk2YhRDtHG2hAh0gT8OMmPGsStIlVR5W/R/0/sjJpmCySKdUoeb3mG6RSfyXL8ixX6Co/FvmiqI5F+VIopk8rmBeGK/4FJb7jCnK5s7IcytHXAB6i8TgDwFRTOK+qZ+zsrKhXsw/7DKIJu0JGnGYoDJsEZ8bluJbh1lWeJxRdY5PdFYr03ZqnOlCROJnDs6wNL9eMJU2NIRslzsI+E7WHZFxQMFbozVFF1KnJQJVqdXmUk/4dX4WQRXm9R30M5uh3IpFVkN1gGMtKeNcJbtdy8cP9jmrqaTYvWdEi2I/qFEKajCCLsnmoSKFohkkBFO71Y3z6A/KDr0YkFAAA", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": ""}], "quantification_windows": [[19, 20]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.txt">Allele frequency table</a></small></p>
@@ -1850,7 +1851,743 @@ <h3>Analysis of genome editing outcomes from deep sequencing data</h3>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
 
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC") && typeof allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC !== "undefined") {
+      await buildAlleleTable(allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC, "allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_asym_both/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_asym_both/CRISPResso2_report.html
index 76a575bc..bdcf0f18 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_asym_both/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_asym_both/CRISPResso2_report.html
@@ -801,12 +801,12 @@ <h5 class="text-center mb-3">asym_both</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:43:31</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:45:27</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>GACATACATACA</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>GACATACATACA</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/asym.fastq -a GACATACATACA -g GACATACATACA --exclude_bp_from_left 0 --exclude_bp_from_right 0 -n asym_both --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/asym.fastq -a GACATACATACA -g GACATACATACA --exclude_bp_from_left 0 --exclude_bp_from_right 0 -n asym_both --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1391,14 +1391,15 @@ <h5 class="text-center mb-3">asym_both</h5>
     
       
   
-<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Alleles_frequency_table_around_sgRNA_GACATACATACA.pdf">
-            <img src="9.Alleles_frequency_table_around_sgRNA_GACATACATACA.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Alleles_frequency_table_around_sgRNA_GACATACATACA"></div>
+        <script type="text/javascript">const allele_table_9_Alleles_frequency_table_around_sgRNA_GACATACATACA = {"plot_type": "allele_table", "reference": "GACATACATACA", "total_alleles": 2, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA4uOVnJ3dHYMAWIQraQD54aAuYY6pgZ6BjogaKiTlphTnBqrE42mBrcWA52SotLU2FgAMcOFNGYAAAA=", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [0, 11], "name": ""}], "quantification_windows": [[8, 9]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA GACATACATACA. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA GACATACATACA. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Alleles_frequency_table_around_sgRNA_GACATACATACA.txt">Allele frequency table</a></small></p>
@@ -1852,7 +1853,743 @@ <h5 class="text-center mb-3">asym_both</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
 
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_Alleles_frequency_table_around_sgRNA_GACATACATACA") && typeof allele_table_9_Alleles_frequency_table_around_sgRNA_GACATACATACA !== "undefined") {
+      await buildAlleleTable(allele_table_9_Alleles_frequency_table_around_sgRNA_GACATACATACA, "allele_table_9_Alleles_frequency_table_around_sgRNA_GACATACATACA")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Alleles_frequency_table_around_sgRNA_GACATACATACA")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_asym_left/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_asym_left/CRISPResso2_report.html
index f66e5344..0d0df4ca 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_asym_left/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_asym_left/CRISPResso2_report.html
@@ -801,12 +801,12 @@ <h5 class="text-center mb-3">asym_left</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:43:34</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:45:27</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACG</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/FANC.Cas9.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g CGGATGTTCCAATCAGTACG --exclude_bp_from_left 0 -n asym_left --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/FANC.Cas9.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g CGGATGTTCCAATCAGTACG --exclude_bp_from_left 0 -n asym_left --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1391,14 +1391,15 @@ <h5 class="text-center mb-3">asym_left</h5>
     
       
   
-<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Alleles_frequency_table_around_sgRNA_CGGATGTTCCAATCAGTACG.pdf">
-            <img src="9.Alleles_frequency_table_around_sgRNA_CGGATGTTCCAATCAGTACG.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Alleles_frequency_table_around_sgRNA_CGGATGTTCCAATCAGTACG"></div>
+        <script type="text/javascript">const allele_table_9_Alleles_frequency_table_around_sgRNA_CGGATGTTCCAATCAGTACG = {"plot_type": "allele_table", "reference": "CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTC", "total_alleles": 6, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA4uOVnJ2d3cMcQ8JcXZ2dAxxdnQPcXR2B1IgGAJkOQPJEGclHWLVGRlZ6lia65mY6hiAYUlRaWqsTrRSCJWt0THQs0C3A4teRwrsMATaYWJM2A4UvY40tiOE1v5wplJYxQIAojKKBFwCAAA=", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [0, 19], "name": ""}], "quantification_windows": [[16, 17]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA CGGATGTTCCAATCAGTACG. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA CGGATGTTCCAATCAGTACG. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Alleles_frequency_table_around_sgRNA_CGGATGTTCCAATCAGTACG.txt">Allele frequency table</a></small></p>
@@ -1852,7 +1853,743 @@ <h5 class="text-center mb-3">asym_left</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
 
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_Alleles_frequency_table_around_sgRNA_CGGATGTTCCAATCAGTACG") && typeof allele_table_9_Alleles_frequency_table_around_sgRNA_CGGATGTTCCAATCAGTACG !== "undefined") {
+      await buildAlleleTable(allele_table_9_Alleles_frequency_table_around_sgRNA_CGGATGTTCCAATCAGTACG, "allele_table_9_Alleles_frequency_table_around_sgRNA_CGGATGTTCCAATCAGTACG")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Alleles_frequency_table_around_sgRNA_CGGATGTTCCAATCAGTACG")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_asym_right/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_asym_right/CRISPResso2_report.html
index f1028069..d970f560 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_asym_right/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_asym_right/CRISPResso2_report.html
@@ -801,12 +801,12 @@ <h5 class="text-center mb-3">asym_right</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:43:48</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:45:23</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>TCCATCGGCGCTTTGGTCGG</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/FANC.Cas9.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g TCCATCGGCGCTTTGGTCGG --exclude_bp_from_right 0 -n asym_right --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/FANC.Cas9.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g TCCATCGGCGCTTTGGTCGG --exclude_bp_from_right 0 -n asym_right --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1391,14 +1391,15 @@ <h5 class="text-center mb-3">asym_right</h5>
     
       
   
-<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Alleles_frequency_table_around_sgRNA_TCCATCGGCGCTTTGGTCGG.pdf">
-            <img src="9.Alleles_frequency_table_around_sgRNA_TCCATCGGCGCTTTGGTCGG.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Alleles_frequency_table_around_sgRNA_TCCATCGGCGCTTTGGTCGG"></div>
+        <script type="text/javascript">const allele_table_9_Alleles_frequency_table_around_sgRNA_TCCATCGGCGCTTTGGTCGG = {"plot_type": "allele_table", "reference": "ACATCCATCGGCGCTTTGGTCGG", "total_alleles": 21, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA62Uuw6DMAxF/4XZQYFABWPkwT/grerQoZ069fH/taOAiprySkGQSHEO18Y3x2Ph0TPqQ4SEzEyk8wKSK8aYAqreQmfLrgUrc3ldz7fH5QT7YA20ZX8QinOZqB5c2SnE2UxSDTG9toLqP6RDvV9TWBlJej/vr8jB3Yqmv86krzlFlZAaB66Gab29aJIoeTDIY/KyUUkDx5gkSTHf5Zb9GMN5sZsG0I++9B8pcBaJlBU04QZNyWZCXuuVJU1jvBR+HcnZhQbPzm6Mp7+RVtepaXNPp5HUTTVNbKc1wtjiG7PTWLWItoEOoeTzB0HaLMiygbQnxW3Bc/HDg7NlJYzf/v2w7+kNVvgmHBIGAAA=", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": ""}], "quantification_windows": [[19, 20]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA TCCATCGGCGCTTTGGTCGG. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA TCCATCGGCGCTTTGGTCGG. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Alleles_frequency_table_around_sgRNA_TCCATCGGCGCTTTGGTCGG.txt">Allele frequency table</a></small></p>
@@ -1852,7 +1853,743 @@ <h5 class="text-center mb-3">asym_right</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
 
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_Alleles_frequency_table_around_sgRNA_TCCATCGGCGCTTTGGTCGG") && typeof allele_table_9_Alleles_frequency_table_around_sgRNA_TCCATCGGCGCTTTGGTCGG !== "undefined") {
+      await buildAlleleTable(allele_table_9_Alleles_frequency_table_around_sgRNA_TCCATCGGCGCTTTGGTCGG, "allele_table_9_Alleles_frequency_table_around_sgRNA_TCCATCGGCGCTTTGGTCGG")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Alleles_frequency_table_around_sgRNA_TCCATCGGCGCTTTGGTCGG")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_bam-out-genome/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_bam-out-genome/CRISPResso2_report.html
index 1b40bf2b..80cef261 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_bam-out-genome/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_bam-out-genome/CRISPResso2_report.html
@@ -803,10 +803,10 @@ <h5 class="text-center mb-3">bam-out-genome</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:44:28</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:46:21</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTC,GGAAACGCCCATGCAATTAGTCTATTTCTGCTGCAAGTAAGCATGCATTTGTAGGCTTGATGCTTTTTTTCTGCTTCTCCAGCCCT</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/bam_test.fq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTC,GGAAACGCCCATGCAATTAGTCTATTTCTGCTGCAAGTAAGCATGCATTTGTAGGCTTGATGCTTTTTTTCTGCTTCTCCAGCCCT --bam_output -n bam-out-genome -x inputs/small_genome/smallGenome --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/bam_test.fq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTC,GGAAACGCCCATGCAATTAGTCTATTTCTGCTGCAAGTAAGCATGCATTTGTAGGCTTGATGCTTTTTTTCTGCTTCTCCAGCCCT --bam_output -n bam-out-genome -x inputs/small_genome/smallGenome --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -2171,7 +2171,6 @@ <h5>Indel Characterization for Amplicon1</h5>
 </script>
 
 
-
       
       <div class="row">
       <div class="col-sm-1"></div>
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_bam-out-parallel/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_bam-out-parallel/CRISPResso2_report.html
index f2a9dea0..fcb903a8 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_bam-out-parallel/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_bam-out-parallel/CRISPResso2_report.html
@@ -803,10 +803,10 @@ <h5 class="text-center mb-3">bam-out-parallel</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:44:25</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:45:38</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTC,GGAAACGCCCATGCAATTAGTCTATTTCTGCTGCAAGTAAGCATGCATTTGTAGGCTTGATGCTTTTTTTCTGCTTCTCCAGCCCT</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/bam_test.fq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTC,GGAAACGCCCATGCAATTAGTCTATTTCTGCTGCAAGTAAGCATGCATTTGTAGGCTTGATGCTTTTTTTCTGCTTCTCCAGCCCT --bam_output -n bam-out-parallel --n_processes max --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/bam_test.fq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTC,GGAAACGCCCATGCAATTAGTCTATTTCTGCTGCAAGTAAGCATGCATTTGTAGGCTTGATGCTTTTTTTCTGCTTCTCCAGCCCT --bam_output -n bam-out-parallel --n_processes max --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -2171,7 +2171,6 @@ <h5>Indel Characterization for Amplicon1</h5>
 </script>
 
 
-
       
       <div class="row">
       <div class="col-sm-1"></div>
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_bam-out/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_bam-out/CRISPResso2_report.html
index cecad724..740dc693 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_bam-out/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_bam-out/CRISPResso2_report.html
@@ -803,10 +803,10 @@ <h5 class="text-center mb-3">bam-out</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:43:41</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:45:23</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTC,GGAAACGCCCATGCAATTAGTCTATTTCTGCTGCAAGTAAGCATGCATTTGTAGGCTTGATGCTTTTTTTCTGCTTCTCCAGCCCT</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/bam_test.fq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTC,GGAAACGCCCATGCAATTAGTCTATTTCTGCTGCAAGTAAGCATGCATTTGTAGGCTTGATGCTTTTTTTCTGCTTCTCCAGCCCT --bam_output -n bam-out --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/bam_test.fq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTC,GGAAACGCCCATGCAATTAGTCTATTTCTGCTGCAAGTAAGCATGCATTTGTAGGCTTGATGCTTTTTTTCTGCTTCTCCAGCCCT --bam_output -n bam-out --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -2171,7 +2171,6 @@ <h5>Indel Characterization for Amplicon1</h5>
 </script>
 
 
-
       
       <div class="row">
       <div class="col-sm-1"></div>
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_bam-single/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_bam-single/CRISPResso2_report.html
index e01823de..13d9b93a 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_bam-single/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_bam-single/CRISPResso2_report.html
@@ -801,10 +801,10 @@ <h5 class="text-center mb-3">bam-single</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:44:07</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:46:00</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>None</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso --bam_input inputs/Both.Cas9.fastq.smallGenome.bam --bam_chr_loc chr9 --auto --n_processes 1 -n bam-single --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso --bam_input inputs/Both.Cas9.fastq.smallGenome.bam --bam_chr_loc chr9 --auto --n_processes 1 -n bam-single --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1389,14 +1389,15 @@ <h5 class="text-center mb-3">bam-single</h5>
     
       
   
-<div id="fig_allele_table_around_cut_Inferred_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Inferred_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Inferred.Alleles_frequency_table_around_Guessed_sgRNA.pdf">
-            <img src="9.Inferred.Alleles_frequency_table_around_Guessed_sgRNA.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Inferred_Alleles_frequency_table_around_Guessed_sgRNA"></div>
+        <script type="text/javascript">const allele_table_9_Inferred_Alleles_frequency_table_around_Guessed_sgRNA = {"plot_type": "allele_table", "reference": "TGGGGCCCAGACTGAGCACGTGATGGCAAAGGAAAGGAAG", "total_alleles": 50, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72Yy5KDIBBF/yVrsAR8JEuKBT/ALpXFLGZWs5rH/0+Lj2gGabRRktKEQE719dK03u8XZ6EZY7TVxlltjTYWztDddVmrtT/YC4sO1YuhopSsUoWUrPSvn6/f9we7b/iHDUNrxaQsqgZlWT61vawrU4W6QXwe9fH2+R1ijRSaiA2TRV0BMoby83saAVUDSkjWoChOtkbFRNGAgnhUIRuuoHiANaFKD4ugZrbYG5UClGwxX3gWWcGBJXEFHVXBARVV8Kkep0QF4RTXmgmRandOZrUJKOrFGsPCUYZ6sQYUaveZL3RWFA80+lYCqEoyGbA7jzQS65rCyhOXCKb3g+Jaz+8BEjGuWxKLtvOPrGgq/B8YidXiLHJFM7Ca9CKDikKKjKwK1jgrl4IVknYzJiiF7/z9ZkJfxyq9yKAKiBYZfJzvqAJi1bt2xnRvOEOH0c7/sLZtBdqMpLrIUmqMeebNmN9XWbSVJTawiFfrtgFlTkCdZPcnyp6AyrSIE2wR+ov1pRUY+lxaKIpa504otM61mQQsPQy5WTUOymqn4QMkQwhzb27yh7QbY324gn66zqPghsdA9gxSDzHHk+zh6jnf45a3kHH7LYAzUhtyetCzMNFREuDrsxIXyhXd12W22JuWxrAefyVCgiz1FAAA", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": "Guessed sgRNA"}], "quantification_windows": [[19, 20]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the Guessed sgRNA (GGCCCAGACTGAGCACGTGA). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the Guessed sgRNA (GGCCCAGACTGAGCACGTGA). Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Inferred.Alleles_frequency_table_around_Guessed_sgRNA.txt">Allele frequency table</a></small></p>
@@ -1850,7 +1851,743 @@ <h5 class="text-center mb-3">bam-single</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
 
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_Inferred_Alleles_frequency_table_around_Guessed_sgRNA") && typeof allele_table_9_Inferred_Alleles_frequency_table_around_Guessed_sgRNA !== "undefined") {
+      await buildAlleleTable(allele_table_9_Inferred_Alleles_frequency_table_around_Guessed_sgRNA, "allele_table_9_Inferred_Alleles_frequency_table_around_Guessed_sgRNA")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Inferred_Alleles_frequency_table_around_Guessed_sgRNA")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_bam/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_bam/CRISPResso2_report.html
index 3e8cb496..3c504d17 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_bam/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_bam/CRISPResso2_report.html
@@ -801,10 +801,10 @@ <h5 class="text-center mb-3">bam</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:44:28</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:46:09</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>None</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso --bam_input inputs/Both.Cas9.fastq.smallGenome.bam --bam_chr_loc chr9 --auto --name bam --n_processes 2 --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso --bam_input inputs/Both.Cas9.fastq.smallGenome.bam --bam_chr_loc chr9 --auto --name bam --n_processes 2 --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1389,14 +1389,15 @@ <h5 class="text-center mb-3">bam</h5>
     
       
   
-<div id="fig_allele_table_around_cut_Inferred_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Inferred_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Inferred.Alleles_frequency_table_around_Guessed_sgRNA.pdf">
-            <img src="9.Inferred.Alleles_frequency_table_around_Guessed_sgRNA.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Inferred_Alleles_frequency_table_around_Guessed_sgRNA"></div>
+        <script type="text/javascript">const allele_table_9_Inferred_Alleles_frequency_table_around_Guessed_sgRNA = {"plot_type": "allele_table", "reference": "TGGGGCCCAGACTGAGCACGTGATGGCAAAGGAAAGGAAG", "total_alleles": 50, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72Yy5KDIBBF/yVrsAR8JEuKBT/ALpXFLGZWs5rH/0+Lj2gGabRRktKEQE719dK03u8XZ6EZY7TVxlltjTYWztDddVmrtT/YC4sO1YuhopSsUoWUrPSvn6/f9we7b/iHDUNrxaQsqgZlWT61vawrU4W6QXwe9fH2+R1ijRSaiA2TRV0BMoby83saAVUDSkjWoChOtkbFRNGAgnhUIRuuoHiANaFKD4ugZrbYG5UClGwxX3gWWcGBJXEFHVXBARVV8Kkep0QF4RTXmgmRandOZrUJKOrFGsPCUYZ6sQYUaveZL3RWFA80+lYCqEoyGbA7jzQS65rCyhOXCKb3g+Jaz+8BEjGuWxKLtvOPrGgq/B8YidXiLHJFM7Ca9CKDikKKjKwK1jgrl4IVknYzJiiF7/z9ZkJfxyq9yKAKiBYZfJzvqAJi1bt2xnRvOEOH0c7/sLZtBdqMpLrIUmqMeebNmN9XWbSVJTawiFfrtgFlTkCdZPcnyp6AyrSIE2wR+ov1pRUY+lxaKIpa504otM61mQQsPQy5WTUOymqn4QMkQwhzb27yh7QbY324gn66zqPghsdA9gxSDzHHk+zh6jnf45a3kHH7LYAzUhtyetCzMNFREuDrsxIXyhXd12W22JuWxrAefyVCgiz1FAAA", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": "Guessed sgRNA"}], "quantification_windows": [[19, 20]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the Guessed sgRNA (GGCCCAGACTGAGCACGTGA). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the Guessed sgRNA (GGCCCAGACTGAGCACGTGA). Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Inferred.Alleles_frequency_table_around_Guessed_sgRNA.txt">Allele frequency table</a></small></p>
@@ -1850,7 +1851,743 @@ <h5 class="text-center mb-3">bam</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
 
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_Inferred_Alleles_frequency_table_around_Guessed_sgRNA") && typeof allele_table_9_Inferred_Alleles_frequency_table_around_Guessed_sgRNA !== "undefined") {
+      await buildAlleleTable(allele_table_9_Inferred_Alleles_frequency_table_around_Guessed_sgRNA, "allele_table_9_Inferred_Alleles_frequency_table_around_Guessed_sgRNA")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Inferred_Alleles_frequency_table_around_Guessed_sgRNA")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_base_editor/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_base_editor/CRISPResso2_report.html
index 38108f82..515a2e09 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_base_editor/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_base_editor/CRISPResso2_report.html
@@ -805,12 +805,12 @@ <h5 class="text-center mb-3">base_editor</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:44:18</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:50:25</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>GGAATCCCTTCTGCAGCACC</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/FANC.Cas9.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC -e CGGCCGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCTGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -c GGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTT --dump -q 30 --default_min_aln_score 80 -an FANC -n base_editor --base_editor_output -fg AGCCTTGCAGTGGGCGCGCTA,CCCACTGAAGGCCC --dsODN GCTAGATTTCCCAAGAAGA -gn hi -fgn dear -p max --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/FANC.Cas9.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC -e CGGCCGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCTGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -c GGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTT --dump -q 30 --default_min_aln_score 80 -an FANC -n base_editor --base_editor_output -fg AGCCTTGCAGTGGGCGCGCTA,CCCACTGAAGGCCC --dsODN GCTAGATTTCCCAAGAAGA -gn hi -fgn dear -p max --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1738,14 +1738,15 @@ <h5>Allele Plots for FANC</h5>
       
         
   
-<div id="fig_allele_table_around_cut_FANC_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_FANC_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.FANC.Alleles_frequency_table_around_hi.pdf">
-            <img src="9.FANC.Alleles_frequency_table_around_hi.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_FANC_Alleles_frequency_table_around_hi"></div>
+        <script type="text/javascript">const allele_table_9_FANC_Alleles_frequency_table_around_hi = {"plot_type": "allele_table", "reference": "CATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAG", "total_alleles": 20, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72UPQ6DMAyF79LZRoQUSkfLgy/grWLo0E6d+nP/moBQh0BUEQUYIiv2p/fCy+VyYFIRImVmVVZhss/WVlQWq1mVheQAf2x1nYdTX/kT1OF9Pz+3AWIwRNwL68FXfQs+kO7XxyuKMhDu1tVAXZ07OG6jxn6TlQXVpFGxASsojG6dUTW4KMqMUwldZO0oSqq2EJ5GpFWN1s9bjVAd+6DJralCzHJWM6rbNDArqk2iOBcqEasgq4SokOBcotL/OpHlOJd/bhul4xCRMILn2lqsIs8PqmkSrGlAicOSKc0ZUD6Nor0X0+KgS6IYS+RqbFcuRNJy9i33U8ZYDV98zrLmXQgAAA==", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": "hi"}, {"interval": [99, 119], "name": "dear"}, {"interval": [98, 112], "name": ""}], "quantification_windows": [[19, 20], [100, 101], [116, 117]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the hi (GGAATCCCTTCTGCAGCACC). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the hi (GGAATCCCTTCTGCAGCACC). Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="FANC.Alleles_frequency_table_around_hi.txt">Allele frequency table</a></small></p>
@@ -1755,14 +1756,15 @@ <h5>Allele Plots for FANC</h5>
       
         
   
-<div id="fig_allele_table_around_cut_FANC_sg1" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_FANC_sg1" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.FANC.Alleles_frequency_table_around_dear.pdf">
-            <img src="9.FANC.Alleles_frequency_table_around_dear.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_FANC_Alleles_frequency_table_around_dear"></div>
+        <script type="text/javascript">const allele_table_9_FANC_Alleles_frequency_table_around_dear = {"plot_type": "allele_table", "reference": "CGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATC", "total_alleles": 15, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72TuwrDMAxF/yWzMPWjdjoKDfoBbSFDh3bq1Mf/1zaldGhIU2whDMLYHK7u1TQNxMxEIkzIUvpSgvmqNISEQuUMsOGpjR7SaHyCXa379XGaoRMsgS8kX0nn4+XWD+XBmhAqyGqhrJYqpzfAvQIqyzGHCGERhe3inlFh1Mj6m+Rc9wS+WHGjV/Q/6scVFiWvqJFXKxvMX/6TNBclLUPx6dT8BKcTWA1GBgAA", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [-94, -75], "name": "hi"}, {"interval": [2, 22], "name": "dear"}, {"interval": [1, 15], "name": ""}], "quantification_windows": [[-78, -77], [3, 4], [19, 20]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the dear (AGCCTTGCAGTGGGCGCGCTA). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the dear (AGCCTTGCAGTGGGCGCGCTA). Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="FANC.Alleles_frequency_table_around_dear.txt">Allele frequency table</a></small></p>
@@ -1772,14 +1774,15 @@ <h5>Allele Plots for FANC</h5>
       
         
   
-<div id="fig_allele_table_around_cut_FANC_sg2" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_FANC_sg2" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.FANC.Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC.pdf">
-            <img src="9.FANC.Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_FANC_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC"></div>
+        <script type="text/javascript">const allele_table_9_FANC_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC = {"plot_type": "allele_table", "reference": "CCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTAC", "total_alleles": 13, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA4uOVnIGAndnZ0cgGeIOYrm7A4kQINsRKOAOEnJ3DnF0VtIhQamhmYmOuYWehamOARiWFJWmxurQyDILHWOQTcZgm9ISc4ppZ5WxjqGeiQnYIkN6WWVIL18Z0S8ATelgFdA7epZmOiZEW+VIfnIHWmViQY+0DrfJyIjmKRBqlxk5ceVMprdITOzu9ImrEErCD7lcigUAIGDW8nEFAAA=", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [-78, -59], "name": "hi"}, {"interval": [18, 38], "name": "dear"}, {"interval": [17, 31], "name": ""}], "quantification_windows": [[-62, -61], [19, 20], [35, 36]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA CCCACTGAAGGCCC. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA CCCACTGAAGGCCC. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="FANC.Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC.txt">Allele frequency table</a></small></p>
@@ -2717,14 +2720,15 @@ <h5>Allele Plots for HDR</h5>
       
         
   
-<div id="fig_allele_table_around_cut_HDR_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_HDR_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.HDR.Alleles_frequency_table_around_hi.pdf">
-            <img src="9.HDR.Alleles_frequency_table_around_hi.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_HDR_Alleles_frequency_table_around_hi"></div>
+        <script type="text/javascript">const allele_table_9_HDR_Alleles_frequency_table_around_hi = {"plot_type": "allele_table", "reference": "GCGCACCTCATGGAATCCCTTCTGCAGCTTTTCCGAGCTT", "total_alleles": 11, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72TPQ7CMAyF79LZqRqIEIyWB1/AW9WBASYmfu6PkxZIoU3aIjVZouRZn/3s1HXBxIREQijMiEJ6FvJn0RfRRcTIVMColNCYvnQLtnQOqrDv18epgWFSwPSCRZKkb+kGqvKwCxwL5+PlNop6xcd1ZVDGr7c0QqWLGs50WVEJEobs/muUVZLbQ9uqvH0fO+YX1aGm2xfcX4UU+5cfiUg6m8TsryeRlOJhS0k+eJ0+xeOXI3UfqpX+kponEyGoQpEEAAA=", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": "hi"}, {"interval": [110, 130], "name": "dear"}, {"interval": [109, 123], "name": ""}], "quantification_windows": [[19, 20], [111, 112], [127, 128]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the hi (GGAATCCCTTCTGCAGCACC). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the hi (GGAATCCCTTCTGCAGCACC). Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="HDR.Alleles_frequency_table_around_hi.txt">Allele frequency table</a></small></p>
@@ -2734,14 +2738,15 @@ <h5>Allele Plots for HDR</h5>
       
         
   
-<div id="fig_allele_table_around_cut_HDR_sg1" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_HDR_sg1" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.HDR.Alleles_frequency_table_around_dear.pdf">
-            <img src="9.HDR.Alleles_frequency_table_around_dear.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_HDR_Alleles_frequency_table_around_dear"></div>
+        <script type="text/javascript">const allele_table_9_HDR_Alleles_frequency_table_around_dear = {"plot_type": "allele_table", "reference": "GGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG", "total_alleles": 4, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA4uOVnJ3dwbBEEdn5xAQw9nR2THEGYTBMiEhIe7uILaSDglKDY10TPXMzXUMwLCkqDQ1VodGVhnpGOhZmoHtMdRJS8wppp1VhkCrTCx0TMCWYVjlTAOrkMIvFgCGlemurAEAAA==", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [-105, -86], "name": "hi"}, {"interval": [2, 22], "name": "dear"}, {"interval": [1, 15], "name": ""}], "quantification_windows": [[-89, -88], [3, 4], [19, 20]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the dear (AGCCTTGCAGTGGGCGCGCTA). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the dear (AGCCTTGCAGTGGGCGCGCTA). Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="HDR.Alleles_frequency_table_around_dear.txt">Allele frequency table</a></small></p>
@@ -2751,14 +2756,15 @@ <h5>Allele Plots for HDR</h5>
       
         
   
-<div id="fig_allele_table_around_cut_HDR_sg2" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_HDR_sg2" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.HDR.Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC.pdf">
-            <img src="9.HDR.Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_HDR_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC"></div>
+        <script type="text/javascript">const allele_table_9_HDR_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC = {"plot_type": "allele_table", "reference": "GCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCA", "total_alleles": 6, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA4uOVnJ3dnZ3BxIhIe7Oju4hIDYIhjgChUAMZ0dnxxAgqaRDglJDQx1TPSNLHQMwLCkqTY3VgVjlTHWrdAz0TCzA9hjqpCXmFMOtch/6VpmALSNolTOVfIUaVTDtzjQIP6hNsQDjujQDgQIAAA==", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [-89, -70], "name": "hi"}, {"interval": [18, 38], "name": "dear"}, {"interval": [17, 31], "name": ""}], "quantification_windows": [[-73, -72], [19, 20], [35, 36]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA CCCACTGAAGGCCC. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA CCCACTGAAGGCCC. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="HDR.Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC.txt">Allele frequency table</a></small></p>
@@ -3666,7 +3672,773 @@ <h5>Substitution Analysis for HDR</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
 
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
+
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_FANC_Alleles_frequency_table_around_hi") && typeof allele_table_9_FANC_Alleles_frequency_table_around_hi !== "undefined") {
+      await buildAlleleTable(allele_table_9_FANC_Alleles_frequency_table_around_hi, "allele_table_9_FANC_Alleles_frequency_table_around_hi")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_FANC_Alleles_frequency_table_around_hi")
+    }
+    
+    if (document.getElementById("allele_table_9_FANC_Alleles_frequency_table_around_dear") && typeof allele_table_9_FANC_Alleles_frequency_table_around_dear !== "undefined") {
+      await buildAlleleTable(allele_table_9_FANC_Alleles_frequency_table_around_dear, "allele_table_9_FANC_Alleles_frequency_table_around_dear")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_FANC_Alleles_frequency_table_around_dear")
+    }
+    
+    if (document.getElementById("allele_table_9_FANC_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC") && typeof allele_table_9_FANC_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC !== "undefined") {
+      await buildAlleleTable(allele_table_9_FANC_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC, "allele_table_9_FANC_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_FANC_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC")
+    }
+    
+    if (document.getElementById("allele_table_9_HDR_Alleles_frequency_table_around_hi") && typeof allele_table_9_HDR_Alleles_frequency_table_around_hi !== "undefined") {
+      await buildAlleleTable(allele_table_9_HDR_Alleles_frequency_table_around_hi, "allele_table_9_HDR_Alleles_frequency_table_around_hi")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_HDR_Alleles_frequency_table_around_hi")
+    }
+    
+    if (document.getElementById("allele_table_9_HDR_Alleles_frequency_table_around_dear") && typeof allele_table_9_HDR_Alleles_frequency_table_around_dear !== "undefined") {
+      await buildAlleleTable(allele_table_9_HDR_Alleles_frequency_table_around_dear, "allele_table_9_HDR_Alleles_frequency_table_around_dear")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_HDR_Alleles_frequency_table_around_dear")
+    }
+    
+    if (document.getElementById("allele_table_9_HDR_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC") && typeof allele_table_9_HDR_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC !== "undefined") {
+      await buildAlleleTable(allele_table_9_HDR_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC, "allele_table_9_HDR_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_HDR_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_basic-parallel/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_basic-parallel/CRISPResso2_report.html
index e8154c47..84657801 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_basic-parallel/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_basic-parallel/CRISPResso2_report.html
@@ -801,12 +801,12 @@ <h5 class="text-center mb-3">basic-parallel</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:43:39</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:45:47</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>GGAATCCCTTCTGCAGCACC</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/FANC.Cas9.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC -p 2 -n basic-parallel --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/FANC.Cas9.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC -p 2 -n basic-parallel --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1391,14 +1391,15 @@ <h5 class="text-center mb-3">basic-parallel</h5>
     
       
   
-<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.pdf">
-            <img src="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC"></div>
+        <script type="text/javascript">const allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC = {"plot_type": "allele_table", "reference": "CATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAG", "total_alleles": 48, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72XvXKDMAzH36WzzWEDgY4+D3oBbbkMHdqpUz/ev7JJCE1w5CCDYfD5kH8nWf5LHI8v3iGAc+i9R/QI3tFLc1pED7RGqx4cvKgnPjV9rXpbNa2q4/Pz9ft+UkswrbUU9qqaamhUE0kfb5/fiyh9GRJUq0zVE/AhKZgv2SdIevHThkh2IIxJofRsiOJnVV0NnTKWD6A4Mc6slo/gzDuZWyaXJXfrkIMqE8Gbw9LMWHeLCdXSxcpmSRRjZLX1TQgXOVJ1Gln2LjOWUGVY5l4zklEU+9UtpWECJmUlVJfLx1V5mFKNDVhtk2YhRDtHG2hAh0gT8OMmPGsStIlVR5W/R/0/sjJpmCySKdUoeb3mG6RSfyXL8ixX6Co/FvmiqI5F+VIopk8rmBeGK/4FJb7jCnK5s7IcytHXAB6i8TgDwFRTOK+qZ+zsrKhXsw/7DKIJu0JGnGYoDJsEZ8bluJbh1lWeJxRdY5PdFYr03ZqnOlCROJnDs6wNL9eMJU2NIRslzsI+E7WHZFxQMFbozVFF1KnJQJVqdXmUk/4dX4WQRXm9R30M5uh3IpFVkN1gGMtKeNcJbtdy8cP9jmrqaTYvWdEi2I/qFEKajCCLsnmoSKFohkkBFO71Y3z6A/KDr0YkFAAA", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": ""}], "quantification_windows": [[19, 20]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.txt">Allele frequency table</a></small></p>
@@ -1852,7 +1853,743 @@ <h5 class="text-center mb-3">basic-parallel</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
 
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC") && typeof allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC !== "undefined") {
+      await buildAlleleTable(allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC, "allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_basic-write-bam-out-parallel/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_basic-write-bam-out-parallel/CRISPResso2_report.html
index d8a791d8..044bc086 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_basic-write-bam-out-parallel/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_basic-write-bam-out-parallel/CRISPResso2_report.html
@@ -801,12 +801,12 @@ <h5 class="text-center mb-3">basic-write-bam-out-parallel</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:43:46</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:45:46</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>GGAATCCCTTCTGCAGCACC</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/FANC.Cas9.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC --bam_output --n_processes 2 -n basic-write-bam-out-parallel --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/FANC.Cas9.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC --bam_output --n_processes 2 -n basic-write-bam-out-parallel --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1391,14 +1391,15 @@ <h5 class="text-center mb-3">basic-write-bam-out-parallel</h5>
     
       
   
-<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.pdf">
-            <img src="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC"></div>
+        <script type="text/javascript">const allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC = {"plot_type": "allele_table", "reference": "CATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAG", "total_alleles": 48, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72XvXKDMAzH36WzzWEDgY4+D3oBbbkMHdqpUz/ev7JJCE1w5CCDYfD5kH8nWf5LHI8v3iGAc+i9R/QI3tFLc1pED7RGqx4cvKgnPjV9rXpbNa2q4/Pz9ft+UkswrbUU9qqaamhUE0kfb5/fiyh9GRJUq0zVE/AhKZgv2SdIevHThkh2IIxJofRsiOJnVV0NnTKWD6A4Mc6slo/gzDuZWyaXJXfrkIMqE8Gbw9LMWHeLCdXSxcpmSRRjZLX1TQgXOVJ1Gln2LjOWUGVY5l4zklEU+9UtpWECJmUlVJfLx1V5mFKNDVhtk2YhRDtHG2hAh0gT8OMmPGsStIlVR5W/R/0/sjJpmCySKdUoeb3mG6RSfyXL8ixX6Co/FvmiqI5F+VIopk8rmBeGK/4FJb7jCnK5s7IcytHXAB6i8TgDwFRTOK+qZ+zsrKhXsw/7DKIJu0JGnGYoDJsEZ8bluJbh1lWeJxRdY5PdFYr03ZqnOlCROJnDs6wNL9eMJU2NIRslzsI+E7WHZFxQMFbozVFF1KnJQJVqdXmUk/4dX4WQRXm9R30M5uh3IpFVkN1gGMtKeNcJbtdy8cP9jmrqaTYvWdEi2I/qFEKajCCLsnmoSKFohkkBFO71Y3z6A/KDr0YkFAAA", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": ""}], "quantification_windows": [[19, 20]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.txt">Allele frequency table</a></small></p>
@@ -1852,7 +1853,743 @@ <h5 class="text-center mb-3">basic-write-bam-out-parallel</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
 
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC") && typeof allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC !== "undefined") {
+      await buildAlleleTable(allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC, "allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_basic-write-bam-out/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_basic-write-bam-out/CRISPResso2_report.html
index 66e7fd43..f1aad63f 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_basic-write-bam-out/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_basic-write-bam-out/CRISPResso2_report.html
@@ -801,12 +801,12 @@ <h5 class="text-center mb-3">basic-write-bam-out</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:43:52</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:45:23</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>GGAATCCCTTCTGCAGCACC</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/FANC.Cas9.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC --bam_output -n basic-write-bam-out --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/FANC.Cas9.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC --bam_output -n basic-write-bam-out --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1391,14 +1391,15 @@ <h5 class="text-center mb-3">basic-write-bam-out</h5>
     
       
   
-<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.pdf">
-            <img src="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC"></div>
+        <script type="text/javascript">const allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC = {"plot_type": "allele_table", "reference": "CATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAG", "total_alleles": 48, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72XvXKDMAzH36WzzWEDgY4+D3oBbbkMHdqpUz/ev7JJCE1w5CCDYfD5kH8nWf5LHI8v3iGAc+i9R/QI3tFLc1pED7RGqx4cvKgnPjV9rXpbNa2q4/Pz9ft+UkswrbUU9qqaamhUE0kfb5/fiyh9GRJUq0zVE/AhKZgv2SdIevHThkh2IIxJofRsiOJnVV0NnTKWD6A4Mc6slo/gzDuZWyaXJXfrkIMqE8Gbw9LMWHeLCdXSxcpmSRRjZLX1TQgXOVJ1Gln2LjOWUGVY5l4zklEU+9UtpWECJmUlVJfLx1V5mFKNDVhtk2YhRDtHG2hAh0gT8OMmPGsStIlVR5W/R/0/sjJpmCySKdUoeb3mG6RSfyXL8ixX6Co/FvmiqI5F+VIopk8rmBeGK/4FJb7jCnK5s7IcytHXAB6i8TgDwFRTOK+qZ+zsrKhXsw/7DKIJu0JGnGYoDJsEZ8bluJbh1lWeJxRdY5PdFYr03ZqnOlCROJnDs6wNL9eMJU2NIRslzsI+E7WHZFxQMFbozVFF1KnJQJVqdXmUk/4dX4WQRXm9R30M5uh3IpFVkN1gGMtKeNcJbtdy8cP9jmrqaTYvWdEi2I/qFEKajCCLsnmoSKFohkkBFO71Y3z6A/KDr0YkFAAA", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": ""}], "quantification_windows": [[19, 20]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.txt">Allele frequency table</a></small></p>
@@ -1852,7 +1853,743 @@ <h5 class="text-center mb-3">basic-write-bam-out</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
 
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC") && typeof allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC !== "undefined") {
+      await buildAlleleTable(allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC, "allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_nhej_native_merge/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_nhej_native_merge/CRISPResso2_report.html
index f6745476..6b1ed471 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_nhej_native_merge/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_nhej_native_merge/CRISPResso2_report.html
@@ -801,10 +801,10 @@ <h5 class="text-center mb-3">nhej_native_merge</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:43:35</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:46:33</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>AATGTCCCCCAATGGGAAGTTCATCTGGCACTGCCCACAGGTGAGGAGGTCATGATCCCCTTCTGGAGCTCCCAACGGGCCGTGGTCTGGTTCATCATCTGTAAGAATGGCTTCAAGAGGCTCGGCTGTGGTT</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/nhej.r1.fastq.gz -r2 inputs/nhej.r2.fastq.gz -a AATGTCCCCCAATGGGAAGTTCATCTGGCACTGCCCACAGGTGAGGAGGTCATGATCCCCTTCTGGAGCTCCCAACGGGCCGTGGTCTGGTTCATCATCTGTAAGAATGGCTTCAAGAGGCTCGGCTGTGGTT -n nhej_native_merge --crispresso_merge --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/nhej.r1.fastq.gz -r2 inputs/nhej.r2.fastq.gz -a AATGTCCCCCAATGGGAAGTTCATCTGGCACTGCCCACAGGTGAGGAGGTCATGATCCCCTTCTGGAGCTCCCAACGGGCCGTGGTCTGGTTCATCATCTGTAAGAATGGCTTCAAGAGGCTCGGCTGTGGTT -n nhej_native_merge --crispresso_merge --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1798,7 +1798,6 @@ <h5 class="text-center mb-3">nhej_native_merge</h5>
 </script>
 
 
-
       
       <div class="row">
       <div class="col-sm-1"></div>
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_params-deletions/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_params-deletions/CRISPResso2_report.html
index aace9c93..bd31f4f8 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_params-deletions/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_params-deletions/CRISPResso2_report.html
@@ -803,12 +803,12 @@ <h5 class="text-center mb-3">params-deletions</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:43:56</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:47:49</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>GGAATCCCTTCTGCAGCACC</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/FANC.Cas9.deletions.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC -e CGGCCGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCTGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -c GGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTT --dump -qwc 20-30_45-50 -q 30 --default_min_aln_score 80 -an FANC -n params-deletions --base_editor_output -fg AGCCTTGCAGTGGGCGCGCTA,CCCACTGAAGGCCC --dsODN GCTAGATTTCCCAAGAAGA -gn hi -fgn dear -p max --base_editor_consider_changes_outside_qw --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/FANC.Cas9.deletions.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC -e CGGCCGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCTGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -c GGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTT --dump -qwc 20-30_45-50 -q 30 --default_min_aln_score 80 -an FANC -n params-deletions --base_editor_output -fg AGCCTTGCAGTGGGCGCGCTA,CCCACTGAAGGCCC --dsODN GCTAGATTTCCCAAGAAGA -gn hi -fgn dear -p max --base_editor_consider_changes_outside_qw --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1670,14 +1670,15 @@ <h5>Allele Plots for FANC</h5>
       
         
   
-<div id="fig_allele_table_around_cut_FANC_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_FANC_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.FANC.Alleles_frequency_table_around_hi.pdf">
-            <img src="9.FANC.Alleles_frequency_table_around_hi.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_FANC_Alleles_frequency_table_around_hi"></div>
+        <script type="text/javascript">const allele_table_9_FANC_Alleles_frequency_table_around_hi = {"plot_type": "allele_table", "reference": "CATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAG", "total_alleles": 1, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA4uOVnJ2DHF3d3QMcXZ2DglxDnF3dgQiIBsoGOLsDhQDijq7O7or6ZCg1EjH0MBAz0AHAkuKSlNjYwFnATnlbAAAAA==", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": "hi"}, {"interval": [99, 119], "name": "dear"}, {"interval": [98, 112], "name": ""}], "quantification_windows": [[-52, -42], [-27, -22]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the hi (GGAATCCCTTCTGCAGCACC). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the hi (GGAATCCCTTCTGCAGCACC). Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="FANC.Alleles_frequency_table_around_hi.txt">Allele frequency table</a></small></p>
@@ -1687,14 +1688,15 @@ <h5>Allele Plots for FANC</h5>
       
         
   
-<div id="fig_allele_table_around_cut_FANC_sg1" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_FANC_sg1" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.FANC.Alleles_frequency_table_around_dear.pdf">
-            <img src="9.FANC.Alleles_frequency_table_around_dear.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_FANC_Alleles_frequency_table_around_dear"></div>
+        <script type="text/javascript">const allele_table_9_FANC_Alleles_frequency_table_around_dear = {"plot_type": "allele_table", "reference": "CGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATC", "total_alleles": 1, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA4uOVnJ2d3d3dg4JcXd2dA8BsUEwxBEoBGI4Ozo7hjiDsJIOCUqNdAwNDPQMdCCwpKg0NTYWAMLUHtxsAAAA", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [-94, -75], "name": "hi"}, {"interval": [2, 22], "name": "dear"}, {"interval": [1, 15], "name": ""}], "quantification_windows": [[-149, -139], [-124, -119]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the dear (AGCCTTGCAGTGGGCGCGCTA). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the dear (AGCCTTGCAGTGGGCGCGCTA). Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="FANC.Alleles_frequency_table_around_dear.txt">Allele frequency table</a></small></p>
@@ -1704,14 +1706,15 @@ <h5>Allele Plots for FANC</h5>
       
         
   
-<div id="fig_allele_table_around_cut_FANC_sg2" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_FANC_sg2" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.FANC.Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC.pdf">
-            <img src="9.FANC.Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_FANC_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC"></div>
+        <script type="text/javascript">const allele_table_9_FANC_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC = {"plot_type": "allele_table", "reference": "CCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTAC", "total_alleles": 1, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA4uOVnIGAndnZ0cgGeIOYrm7A4kQINsRKOAOEnJ3DnF0VtIhQamRjqGBgZ6BDgSWFJWmxsYCAFmo6ZVsAAAA", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [-78, -59], "name": "hi"}, {"interval": [18, 38], "name": "dear"}, {"interval": [17, 31], "name": ""}], "quantification_windows": [[-133, -123], [-108, -103]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA CCCACTGAAGGCCC. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA CCCACTGAAGGCCC. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="FANC.Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC.txt">Allele frequency table</a></small></p>
@@ -2628,7 +2631,755 @@ <h5>Substitution Analysis for FANC</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
 
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
+
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_FANC_Alleles_frequency_table_around_hi") && typeof allele_table_9_FANC_Alleles_frequency_table_around_hi !== "undefined") {
+      await buildAlleleTable(allele_table_9_FANC_Alleles_frequency_table_around_hi, "allele_table_9_FANC_Alleles_frequency_table_around_hi")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_FANC_Alleles_frequency_table_around_hi")
+    }
+    
+    if (document.getElementById("allele_table_9_FANC_Alleles_frequency_table_around_dear") && typeof allele_table_9_FANC_Alleles_frequency_table_around_dear !== "undefined") {
+      await buildAlleleTable(allele_table_9_FANC_Alleles_frequency_table_around_dear, "allele_table_9_FANC_Alleles_frequency_table_around_dear")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_FANC_Alleles_frequency_table_around_dear")
+    }
+    
+    if (document.getElementById("allele_table_9_FANC_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC") && typeof allele_table_9_FANC_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC !== "undefined") {
+      await buildAlleleTable(allele_table_9_FANC_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC, "allele_table_9_FANC_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_FANC_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_params/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_params/CRISPResso2_report.html
index ce5bfae2..5bf3490d 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_params/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_params/CRISPResso2_report.html
@@ -805,12 +805,12 @@ <h5 class="text-center mb-3">params</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:44:18</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:50:50</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>GGAATCCCTTCTGCAGCACC</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/FANC.Cas9.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC -e CGGCCGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCTGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -c GGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTT --dump -qwc 20-30_45-50 -q 30 --default_min_aln_score 80 -an FANC -n params --base_editor_output -fg AGCCTTGCAGTGGGCGCGCTA,CCCACTGAAGGCCC --dsODN GCTAGATTTCCCAAGAAGA -gn hi -fgn dear -p max --base_editor_consider_changes_outside_qw --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/FANC.Cas9.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC -e CGGCCGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCTGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -c GGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTT --dump -qwc 20-30_45-50 -q 30 --default_min_aln_score 80 -an FANC -n params --base_editor_output -fg AGCCTTGCAGTGGGCGCGCTA,CCCACTGAAGGCCC --dsODN GCTAGATTTCCCAAGAAGA -gn hi -fgn dear -p max --base_editor_consider_changes_outside_qw --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1721,14 +1721,15 @@ <h5>Allele Plots for FANC</h5>
       
         
   
-<div id="fig_allele_table_around_cut_FANC_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_FANC_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.FANC.Alleles_frequency_table_around_hi.pdf">
-            <img src="9.FANC.Alleles_frequency_table_around_hi.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_FANC_Alleles_frequency_table_around_hi"></div>
+        <script type="text/javascript">const allele_table_9_FANC_Alleles_frequency_table_around_hi = {"plot_type": "allele_table", "reference": "CATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAG", "total_alleles": 20, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72UPQ6DMAyF78IcIygtpKP1Bl/AG2LsBar2/jUEdQp/ApkwRJbtT+8lTt8XYBVhVgCqUAHbb3sLKsRiFoWwFOFAat02oYtl04VqWp/39zWEHIyIzsJiaMr42CAZh07LuoWqfLabmgQmyomUq18gUTZ1nWSuqUxFbNUkyqq2EaQO25pG3+fU2kj3uKqJ6JJz2kFSXxJcSMluciGxk3tjObPNrw9Jxx4iUwfMsaV5ynz7SancQ1MaYhcSn32N9pPgpkmdbjnUzb3/s3SdpuEHm5i9OUwIAAA=", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": "hi"}, {"interval": [99, 119], "name": "dear"}, {"interval": [98, 112], "name": ""}], "quantification_windows": [[-52, -42], [-27, -22]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the hi (GGAATCCCTTCTGCAGCACC). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the hi (GGAATCCCTTCTGCAGCACC). Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="FANC.Alleles_frequency_table_around_hi.txt">Allele frequency table</a></small></p>
@@ -1738,14 +1739,15 @@ <h5>Allele Plots for FANC</h5>
       
         
   
-<div id="fig_allele_table_around_cut_FANC_sg1" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_FANC_sg1" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.FANC.Alleles_frequency_table_around_dear.pdf">
-            <img src="9.FANC.Alleles_frequency_table_around_dear.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_FANC_Alleles_frequency_table_around_dear"></div>
+        <script type="text/javascript">const allele_table_9_FANC_Alleles_frequency_table_around_dear = {"plot_type": "allele_table", "reference": "CGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATC", "total_alleles": 7, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA4uOVnJ2d3d3dg4JcXd2dA8BsUEwxBEoBGI4Ozo7hjiDsJIOCUoNLcx0LCz1TIx0DMCwpKg0NVYHxTJH6lmmY6BnYoHbJuzanWltUwid/ORMl9Bzx6LdOYTqNoXQKEXEAgARcTrf6gIAAA==", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [-94, -75], "name": "hi"}, {"interval": [2, 22], "name": "dear"}, {"interval": [1, 15], "name": ""}], "quantification_windows": [[-149, -139], [-124, -119]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the dear (AGCCTTGCAGTGGGCGCGCTA). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the dear (AGCCTTGCAGTGGGCGCGCTA). Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="FANC.Alleles_frequency_table_around_dear.txt">Allele frequency table</a></small></p>
@@ -1755,14 +1757,15 @@ <h5>Allele Plots for FANC</h5>
       
         
   
-<div id="fig_allele_table_around_cut_FANC_sg2" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_FANC_sg2" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.FANC.Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC.pdf">
-            <img src="9.FANC.Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_FANC_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC"></div>
+        <script type="text/javascript">const allele_table_9_FANC_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC = {"plot_type": "allele_table", "reference": "CCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTAC", "total_alleles": 5, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA4uOVnIGAndnZ0cgGeIOYrm7A4kQINsRKOAOEnJ3DnF0VtIhQamhhYWOpYGesYWOARiWFJWmxurgtcyRfMt0DPRMSLAJSbszXWxyp4+fQqgUerEAbgv0QBYCAAA=", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [-78, -59], "name": "hi"}, {"interval": [18, 38], "name": "dear"}, {"interval": [17, 31], "name": ""}], "quantification_windows": [[-133, -123], [-108, -103]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA CCCACTGAAGGCCC. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA CCCACTGAAGGCCC. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="FANC.Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC.txt">Allele frequency table</a></small></p>
@@ -2664,14 +2667,15 @@ <h5>Allele Plots for HDR</h5>
       
         
   
-<div id="fig_allele_table_around_cut_HDR_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_HDR_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.HDR.Alleles_frequency_table_around_hi.pdf">
-            <img src="9.HDR.Alleles_frequency_table_around_hi.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_HDR_Alleles_frequency_table_around_hi"></div>
+        <script type="text/javascript">const allele_table_9_HDR_Alleles_frequency_table_around_hi = {"plot_type": "allele_table", "reference": "GCGCACCTCATGGAATCCCTTCTGCAGCTTTTCCGAGCTT", "total_alleles": 13, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72UvQ4CIQzH3+XmYriLMTo2HfoC3cgNDjo5+fH+tnqeaMwBpwJLIf/2B20hhIaJCYmEUJgRhdRWQ8gxiQ4iRrMa+CgVVRO+Szvwi80KvM4W9tvDaddDmPTX1RgkgXI2RmkZimOOxppEOfcqzUTh7XzfoVpFLdfZCXwmpLxWhahHAeqg4gym2yKSlqOYbTsLpRijzUaZd6VaxT2YQg3v6i6dgarXgb9AeTgfL//7LCJSN1yqvwLSvSYFbwUAAA==", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": "hi"}, {"interval": [110, 130], "name": "dear"}, {"interval": [109, 123], "name": ""}], "quantification_windows": [[-44, -34], [-19, -14]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the hi (GGAATCCCTTCTGCAGCACC). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the hi (GGAATCCCTTCTGCAGCACC). Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="HDR.Alleles_frequency_table_around_hi.txt">Allele frequency table</a></small></p>
@@ -2681,14 +2685,15 @@ <h5>Allele Plots for HDR</h5>
       
         
   
-<div id="fig_allele_table_around_cut_HDR_sg1" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_HDR_sg1" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.HDR.Alleles_frequency_table_around_dear.pdf">
-            <img src="9.HDR.Alleles_frequency_table_around_dear.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_HDR_Alleles_frequency_table_around_dear"></div>
+        <script type="text/javascript">const allele_table_9_HDR_Alleles_frequency_table_around_dear = {"plot_type": "allele_table", "reference": "GGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG", "total_alleles": 4, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA4uOVnJ3dwbBEEdn5xAQw9nR2THEGYTBMiEhIe7uILaSDglKDY11zPSMTHUMgNBQJy0xpzg1VodWdukY6JlYgK0yop9VBjolRaUoNjnTyCZY+MUCAJMCmpStAQAA", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [-105, -86], "name": "hi"}, {"interval": [2, 22], "name": "dear"}, {"interval": [1, 15], "name": ""}], "quantification_windows": [[-152, -142], [-127, -122]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the dear (AGCCTTGCAGTGGGCGCGCTA). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the dear (AGCCTTGCAGTGGGCGCGCTA). Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="HDR.Alleles_frequency_table_around_dear.txt">Allele frequency table</a></small></p>
@@ -2698,14 +2703,15 @@ <h5>Allele Plots for HDR</h5>
       
         
   
-<div id="fig_allele_table_around_cut_HDR_sg2" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_HDR_sg2" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.HDR.Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC.pdf">
-            <img src="9.HDR.Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_HDR_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC"></div>
+        <script type="text/javascript">const allele_table_9_HDR_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC = {"plot_type": "allele_table", "reference": "GCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCA", "total_alleles": 6, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA4uOVnJ3dnZ3BxIhIe7Oju4hIDYIhjgChUAMZ0dnxxAgqaRDglJDQx1TPSNLHQMgNNRJS8wpTo3VgdjlTHW7dAz0TCywWeVOQ6uM6GeVgU5JUSlem5xpG37ONIyqWABZWyJVgwIAAA==", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [-89, -70], "name": "hi"}, {"interval": [18, 38], "name": "dear"}, {"interval": [17, 31], "name": ""}], "quantification_windows": [[-136, -126], [-111, -106]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA CCCACTGAAGGCCC. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA CCCACTGAAGGCCC. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="HDR.Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC.txt">Allele frequency table</a></small></p>
@@ -3613,7 +3619,773 @@ <h5>Substitution Analysis for HDR</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
 
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
+
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_FANC_Alleles_frequency_table_around_hi") && typeof allele_table_9_FANC_Alleles_frequency_table_around_hi !== "undefined") {
+      await buildAlleleTable(allele_table_9_FANC_Alleles_frequency_table_around_hi, "allele_table_9_FANC_Alleles_frequency_table_around_hi")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_FANC_Alleles_frequency_table_around_hi")
+    }
+    
+    if (document.getElementById("allele_table_9_FANC_Alleles_frequency_table_around_dear") && typeof allele_table_9_FANC_Alleles_frequency_table_around_dear !== "undefined") {
+      await buildAlleleTable(allele_table_9_FANC_Alleles_frequency_table_around_dear, "allele_table_9_FANC_Alleles_frequency_table_around_dear")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_FANC_Alleles_frequency_table_around_dear")
+    }
+    
+    if (document.getElementById("allele_table_9_FANC_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC") && typeof allele_table_9_FANC_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC !== "undefined") {
+      await buildAlleleTable(allele_table_9_FANC_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC, "allele_table_9_FANC_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_FANC_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC")
+    }
+    
+    if (document.getElementById("allele_table_9_HDR_Alleles_frequency_table_around_hi") && typeof allele_table_9_HDR_Alleles_frequency_table_around_hi !== "undefined") {
+      await buildAlleleTable(allele_table_9_HDR_Alleles_frequency_table_around_hi, "allele_table_9_HDR_Alleles_frequency_table_around_hi")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_HDR_Alleles_frequency_table_around_hi")
+    }
+    
+    if (document.getElementById("allele_table_9_HDR_Alleles_frequency_table_around_dear") && typeof allele_table_9_HDR_Alleles_frequency_table_around_dear !== "undefined") {
+      await buildAlleleTable(allele_table_9_HDR_Alleles_frequency_table_around_dear, "allele_table_9_HDR_Alleles_frequency_table_around_dear")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_HDR_Alleles_frequency_table_around_dear")
+    }
+    
+    if (document.getElementById("allele_table_9_HDR_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC") && typeof allele_table_9_HDR_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC !== "undefined") {
+      await buildAlleleTable(allele_table_9_HDR_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC, "allele_table_9_HDR_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_HDR_Alleles_frequency_table_around_sgRNA_CCCACTGAAGGCCC")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_prime_editor/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_prime_editor/CRISPResso2_report.html
index 66074543..0c423eea 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_prime_editor/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_prime_editor/CRISPResso2_report.html
@@ -805,7 +805,7 @@ <h3>Analysis of genome editing outcomes from deep sequencing data</h3>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:44:24</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:46:31</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>ACGTCTCATATGCCCCTTGGCAGTCATCTTAGTCATTACCTGAGGTGTTCGTTGTAACTCATATAAACTGAGTTCCCATGTTTTGCTTAATGGTTGAGTTCCGTTTGTCTGCACAGCCTGAGACATTGCTGGAAATAAAGAAGAGAGAAAAACAATTTTAGTATTTGGAAGGGAAGTGCTATGGTCTGAATGTATGTGTCCCACCAAAATTCCTACGT</pre></p>
   
   <p><strong>Command used:</strong> <pre class='pre-scrollable'>CRISPResso --fastq_r1 prime_editor.fastq.gz --amplicon_seq ACGTCTCATATGCCCCTTGGCAGTCATCTTAGTCATTACCTGAGGTGTTCGTTGTAACTCATATAAACTGAGTTCCCATGTTTTGCTTAATGGTTGAGTTCCGTTTGTCTGCACAGCCTGAGACATTGCTGGAAATAAAGAAGAGAGAAAAACAATTTTAGTATTTGGAAGGGAAGTGCTATGGTCTGAATGTATGTGTCCCACCAAAATTCCTACGT --prime_editing_pegRNA_spacer_seq GTCATCTTAGTCATTACCTG --prime_editing_pegRNA_extension_seq AACGAACACCTCATGTAATGACTAAGATG --prime_editing_nicking_guide_seq CTCAACCATTAAGCAAAACAT --prime_editing_pegRNA_scaffold_seq GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC --write_cleaned_report --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
@@ -1500,14 +1500,15 @@ <h5>Allele Plots for Reference</h5>
       
         
   
-<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Reference.Alleles_frequency_table_around_PE_Extension.pdf">
-            <img src="9.Reference.Alleles_frequency_table_around_PE_Extension.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Reference_Alleles_frequency_table_around_PE_Extension"></div>
+        <script type="text/javascript">const allele_table_9_Reference_Alleles_frequency_table_around_PE_Extension = {"plot_type": "allele_table", "reference": "CATTACCTGAGGTGTTCGTTGTAACTCATATAAACTGAGT", "total_alleles": 368, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72dvZLkKAyA3+Xi9pbBdtsdUgS8ANnWBhfcRRfdz/tf28YY/4EQQrO1WzM9tr8VCCGEkH/+/E0ra5XW1ihjrLFWf/8aq5S23998/8zffX9nf3tlXCq6XsjX0P2Y+le7/Pn37//++PU64jQVbpCv9ocUEZShQnWfL0q8Iyh/vy5EyWFGLRzx+vP3v/65QRkaqWT3RbUfgFTNzVceSsyo6SVX2oNcmkiudoUBemu7HyuXGGfU+ITSlKMrjjrdb4tQ/Yx6x5XQPaBUM8Q8itvhJWVMM6hgixr2L2c1orBinZ9mVveSb4BgjobuMccCofz9RWKJMYtVJBZED+dPTs95QG1SHy8dN9QEkqpEMd4zSsLNEx8J31OONDAohUN1PYKlcaxTAy4dQSzVAGvA5v4Lg5LpzjJUrA4whBnl2ljbA9AsgBFURJoBMYJakbSg+IBYX4M7P2Px3L4/2YhYc1sfcIFYXdq2z6OtvAUlzGCQ6CCGhRRLdHBDqAmUMHsmMWwkm5jyj926a+BYfdIKtJ0PxcYaZe5cbDlUMPgJpBjbpZ40L4RAUmnLNLCOn4DV/UASURfXkurg7Tzy4MTgUL2zuI9WsIl+YVh9zOISszoOj3Brw5FhDZ7sL0J/xrEWhQf7TrZID0eg61QyknvYSN5Y5/90inW41LM+0CCGfwyyBUXP4Kdtows8cZXLBZ+4wmckSGHYCEFCR4FyLMb1AU3d9gP4nvcm05PkROg6JVhdX91N86xecLFEpku4fQBtw+XS3RCCPPjzz0DWeunOeqdZVxkBrP3SnSVD1nofqL8acIxq2QQSjwa+IXSfHKqbMl011Jbdynp2MxSdyvsmfDBQ5C04PE+Rik0qOvfTkcbUxK9opYq6aXRiTenNJs0mFkGYdRvFItuBzw8GOdZiBtNe9erqBs+JG93Tpb4JR4hTff4IPvebACU+IJY5OKANVjNkEnV5SEysy6UeNaSlMmVLoL0FAUuga4NmbQ161vT9NoW69EIEdb3Uo9I+oWGzGMbwSWVpjJP4wDfdS1nANRAJq89YbzUEFiNrvbr8mLUG8iSZNk6lqTpbb33y1iU8Lehu15WctJvbFRvJYMdwi4ktKLhUBw1ExBY0U/she2piyMXYukrwsbo3H6uXfKwJk8/y9QKgrKZM3Q2LubDV1qnH2/2PsOnKXbo7nQN0XzDEplnBpTsLGLI7Nk6Udb7UswCRLXXpiFqLrBsZs3Zx9xbsQax9f6tIB5N+jK3VgraSZTqPLE1vA2VkDGs20v3ebSHpMdeYMrLqWH3WJnihXBH3TLH01nqaxDCRDBvpXg0raOD6gJOul0mV2PbR1C0YCV1QDqwuka1Aykrmr9KxAIcT6FgcJzw21pDLKlD5DsaiUHlQ0gxNEw7AmDtJd7Xg+H4xC47CR6dlTnR6O0xSphlvUHwfmrJ9P+a9WF399PCdBROr4OiP3OP76c4qi4TLjEi4InHTgMFpCuMEDgKpms4T1dkpiQgBccyQ/gHlZhAaLlE8fYWPt28KiDh+hmahwqv1+wqZjSaDnZjamW+7aZeMrIGR9WZkffhYDNmDMiOQRoUSLZ9YoudjSQE4NU3Fmrjk+rzYugszn8y/QVrefKthOWbklWQ1Uqr8Q2jW8sxdhsGnMWye7uGzuu1nefx3rbU6JHFl5VDvUo2AqeTyn06ywkvzppLw0EVTd4bkW61qjpCuQ12ekrXbKVO7nbb+ZpNm20AzPKQ1IQZEAp9MkLfppKpGLbGlLtBJJlWlRtodaD+SkALt+3kYkFaGR6LvNZq8MtoOOloIzSXSzQHsSiLNtzfhgWxLR7pOGoq0Vt5j40V28nHFvDJAtlYvGdLaF3GScb00q8T3pmY5ELNqxpyfBSTNerWRxL0ToVgGE/Xh/BXUjbl1ANAyyeeMPWqpIhUHDgUUCHoqkst5SB2hQD2nkGiyvNu4/u0gW9OY33orus6QirpFhgtUue1KNS+y03JCWcvQTbpu6y3ThiaoVgMjGTK7F8tPMZet5uT+b3AMJ7h0E2qKC3XY1LbKrRKzIi0bScrq5WNc+42RMAHxxNsyFMVxKBlHkZyodahYQILoqLozSanSyIRaMaCqMJPOu7Ey1oYYdK9+WK8PlE1JonwjuPRTRU9svV9zTPI32Y1FQiWz5dTNwUwcakhJpdnazyrKyaN2NQFnZieGgtwraugwKJxWAKTSpYerN61Ixuh16YGajQTYw6axSpCTfoppUIVVSPwDHpvvygqcv29XwUjY8kG+o9L5NTQoAWJdkoVxg6qHJ/CijgXnaQVVVFvCSAUlM7xWZOQkF1laAc5JDtZkhjCwXYvUsZAkPKM7DCjgFqQduA6NVql5Kkjobq7zVAdPHXdpGjYzX80LNWQIZWtPiR61f46TKgOFzPPHNGAhquv4UO9aKDeaA7XoMs5kVAspBaiz4cFKBak6ezIJWYUdPWqEoSwTyhAEEATMsF8el1WqwEsFGcKGTy3YHFt9LYSYVX/Bo9I5z7owIWlDAeySMU2o+EgFhLgwhq/5TFnVuQ015Bfhwsd6gKjCZcEAPrw1b+m43ExU+FSAXrGlKEI9HUN5b4caMlH4ngJmpSueUMXhDWUVdi4Pd6tqySGnu3UxCJrPb7hEYpoMt4SD4ONay8QNxShV8Gkt19mh5td5oY5QeVTGaa1kfaDLUVAbehMZxztxSe++p1r4MSPNMKZKXmvgIi9t/ns0OWRS1fZ87+6nTcmM3K24QNo2HL2UGE33J5CxIIOMzaLe1KnzimuiZcoBlfTSXC+fC4ScmybkGU74CyCCGbf2cdF9s6NlIo1spImNJPia72smuHRCMDbghw0l+fpKdnzjd2CTirSWQhzVt2yogcsucRQw3jMleUigt4EQoXo2qSRfV8nsEtpl2wIi882wua/m8qg8W6F5VqKpbKHjAu+cLZQH4pIIU2bATx45uqe54gX+NziZcjTPcMm0bA3UB2nLFNXBvsN0A33Ab3MOPsTpA7RSEv59hNlGD18gJFiMAlGlvgR82rU8gXqmDfIl3Ylri8jwCWXZNjowRWNucoRaEIoncbH68cCwDg4bydYnWYoajHGSJnzhZtQgab5TdIbwlYDx5AzDVWcgBtKUwWbLJJENT9AZshSGGxW3ilUkfxhfW5rJ/XTYYs2Vtuvt9ni71pSWSDvFM9trD1TgsGjEK5UeZwz75MaSdtP8xKWblm/smha75n8s/+r1fUdI0DsQSa+NtyQm2uDwYZBpYqP1xMGNZ4JyMepURnz9xBbsTYYky1RMynJVrTrcGwedDsiWgNyKCQJaX16RsxPlff0q22v74unX/zT150KCmQAA", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [-9, 19], "name": "PE Extension"}, {"interval": [-11, 8], "name": "PE spacer sgRNA"}, {"interval": [44, 64], "name": "PE nicking sgRNA"}], "quantification_windows": [[5, 6], [15, 24], [46, 47]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the PE Extension (AACGAACACCTCATGTAATGACTAAGATG). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the PE Extension (AACGAACACCTCATGTAATGACTAAGATG). Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Reference.Alleles_frequency_table_around_PE_Extension.txt">Allele frequency table</a></small></p>
@@ -1517,14 +1518,15 @@ <h5>Allele Plots for Reference</h5>
       
         
   
-<div id="fig_allele_table_around_cut_Reference_sg1" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg1" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Reference.Alleles_frequency_table_around_PE_spacer_sgRNA.pdf">
-            <img src="9.Reference.Alleles_frequency_table_around_PE_spacer_sgRNA.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Reference_Alleles_frequency_table_around_PE_spacer_sgRNA"></div>
+        <script type="text/javascript">const allele_table_9_Reference_Alleles_frequency_table_around_PE_spacer_sgRNA = {"plot_type": "allele_table", "reference": "GCAGTCATCTTAGTCATTACCTGAGGTGTTCGTTGTAACT", "total_alleles": 336, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA8Wdu7LbOAyG3yW1nTFJyZJLDgq+ALpMii02Vaq9vP/qQl18PQQo/JszmfHJWP4CAgRBEKB//PiWKCamyMQ8v+BIxCmmxImZhr+JYyT+dhK81YXGXU9t+N5fT5fp55+//v3z5+kTjvS4tjldvntfjEp6VOgGlGuLUevzJEb5CeUmkDv9+uP33xOLLRTm25ElkCqpSWEgXW4CFKlRbkT1Yl2dpz8qlJ8FW5X15hOobnaNyrpc5TY4PM9CVLOhdjYYbZzGyFJMLbm63KSuZlJbgboOgvlXMDp4EC8zDGDz/UgKJ38VjyFrWQqUeAQz6sHiLVGuexaLjmZ1m1iv7SLCSB8eP8NIZTIt02IleXsDzKzQKIydKOnk6u9QbCeWInAqFWogTUJdR9LobIP5DM6oVqIqrkK98UtsINUHVcWDSO2XJKbJVI8iiTQ1o8WLVUb5VjiBk54VxMuVntVJ/RJwCDlW2aDMXVBUiuVu8uBinAKqIdSETEqxAo7lvWEouBjsahnjNgjG6nEsD2SNmRPj1XhjAVEwlmsBu5/MajyO1b1isZW+vo4+z09/RKQmO6hCZ3gEqyl3vNWsgIigljHsAOkZob6q1v9mi6AcBjWtJlKWYMO1Z43j58Uo2XLSqJfJgcWkY93M81uLthpABLVMZEQEtamrw7FCY750razGoVgOsSTrHe/wASkqbeMqZY2vlSz/mcUH2sZzqJGMrPCBxHb2/jZ8ooNI0yFQ0UkkwUhLZkYbOmVS6AEhYWaVhjMRNYIxHSBVK1kfd5/0hrX+X+7eukp1M49zM6qTLfuxVlmCeLBGrF56ukowsVRJyWUaO8BOIbOm5UoavksDp3UIO7FYapQmfCdSsm5iFkvii7RjtVJUItwQjr/qWP3wUoYaXhaj0n4eS4P3BHMZKeGkYq13cjdAOcYSZGi2CUpW0wG2q9vcckBWi2N5aYamhhWAcl3Nt8ZLUAPYhS9T+QJkORzLeyDrhmOFK47Vq6qDEigwnH5TesNGwVKv/0JnyEeNYDIzjOfNeDq6Bt7LSGxAmh8nGGl+nGCkQ04iM6mwyPkQVoM49VzkKl0eI0Zbw+MPn/Ep7fT0Vi/cQkaUULO3gpAYZezzB1SyRCcyVD+CxZvVOrGC6CS8kiWsaakyDWl4VsPygMqFxQwDjiUvyExnceXiYhvyNKtWrFaVZq1YtsQVGTrWVVWRIYvc/ZYjvKBQvsWxgmn9zANLri1WiuXkyX5p8tOrk59ROY9V+Uidd3KAdOQ6gFccKnggqwWykGN4w7EABUhenS/Ro9wFJ5ZrcCzvzHvSNlaPkguRZF38riYBn1g5uxRmOPygZhduQSbEtjWj1Moq8/AMygYlRJYw2ecjk22ONVqsjtONC48WYUpycpS0nmVB+W7vKObHi6Sa33ouuUUiox5MIh5/58dr0JvrD8gMxOYSpaMz0yLQ5I0gID4exBFkdTz1o2BACQXiiAIRn1GgdNw1WxvoZaCSUCJ9qKGnY0VaSJTDlLScTsQKkd7GrtHWgb8GWWppOnYGgWaPZGvhb0lGIk3vPQz0xe4ili9Kz6fte1JBte15f8MLs8Vkyo/HygqOQj296LFhIz1RQlkEpezz5rhv8HlnDcmV7NcjZDrVV1TMIN8AijdmVOhK25PuP+AD6vz0VsnwpXqZirvwdxilSRRXa24krfUVF6ESyNA3EFt6iePiFQypvBiFLANL603nhwt9CaGnpC9DyU62uAol6Q+v11SRN0Mth7QLqi/M81YvUl1xorx6kboArlXJKC9BKVslM6o8JV8plKQVibQttNkqWkDZX0YpKgyVqpKUM+w+4CvSEAxsb5U52opeZ2E4MT8P8elc69OlFXhRU+KSUa1MKoKNH8c6ny5BFRr6XMT5YOje/PLKrKkecE9mduk4VCuuyiR51+yiKuExNcnbjtbsTmN/DfyEkreIRdD0za91wyctGtOinDHr0VU0xjXBWarG8JaHR6vw5sXHWShE8fFqgAGHasxrj6XbtyNQAYfCDWDASSWuL5Vfs7j59QAhec0ETqydwNLhSzq3pJFKem/KKpW8TyEBBxC12staB+5Q0upmEpcPvqwVK7q5J6kPjoTzN+GGL0lvPlpQrXmPR96AAK6c2W21rbtJNptwxte+zqQb4ILZvCkNOJTuZvRoeCJx9zSB7DwSyKGXow4YPZ3rs2/BWUfP7ovCDlEUKJ6oQsEG8AqTyjscCmcWvofpyt/Me4qUOeEKUgcj9TCSww3fEJM5FAo4gEBLx+nKB5iufAuTKlxhqOYCQ7Uov4S4+m+rc8CQFJc0q1ENTCp/waFaHEp1R2PCxdAJc9Y3lnLDNovHdDqaooLdd+3Ky/uf2tcJZRRsSCKTdseXIFhBXqq6NV6SO2VQJwHH/wE0/ou6s+TzGf3LjyroANreunN8742cQb1nDGlyI1TPYwYRFpTLJdmkuDCl872Jp/V7CtQZ+9ckfvB5NoM33mgyi7D2g40p7VrQ0xpIXzweD1PTnmRqeYxoW6d3S+DRIE6Y6x9SxIDYrsrv8fpPvv9ONhrNjqZFj6ZfxtWv4kDquifRQqK5fnoijI/zrp46Vs7an/8B6LE/pTqMAAA=", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [5, 33], "name": "PE Extension"}, {"interval": [3, 22], "name": "PE spacer sgRNA"}, {"interval": [58, 78], "name": "PE nicking sgRNA"}], "quantification_windows": [[19, 20], [29, 38], [60, 61]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the PE spacer sgRNA (GTCATCTTAGTCATTACCTG). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the PE spacer sgRNA (GTCATCTTAGTCATTACCTG). Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Reference.Alleles_frequency_table_around_PE_spacer_sgRNA.txt">Allele frequency table</a></small></p>
@@ -1534,14 +1536,15 @@ <h5>Allele Plots for Reference</h5>
       
         
   
-<div id="fig_allele_table_around_cut_Reference_sg2" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg2" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Reference.Alleles_frequency_table_around_PE_nicking_sgRNA.pdf">
-            <img src="9.Reference.Alleles_frequency_table_around_PE_nicking_sgRNA.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Reference_Alleles_frequency_table_around_PE_nicking_sgRNA"></div>
+        <script type="text/javascript">const allele_table_9_Reference_Alleles_frequency_table_around_PE_nicking_sgRNA = {"plot_type": "allele_table", "reference": "ATATAAACTGAGTTCCCATGTTTTGCTTAATGGTTGAGTT", "total_alleles": 360, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72dudLjKBCA32VjecoCyZZDioAXIJuaYIPdaKM93n8NAglJiLO7Z4Kp+X+jzw3N0Rf6+fM3ob9/hZBaCaW1lFLo779aK6m/P9fq+x/7m9+Gio+OfOLzMPMfHz487d9///7vj18DEu49Ds8f7GNB4/Dn73/9Y1mP6J9OFjOs5zI43AYT+kIC6MeXgb0o+nCcPWpcQrnOQsHAmIHNA2PnTsSQzI7Y9OVMCcGAWM+VZbSkVDDZCyPQjo8nvdGHa0MtdCijj2SsqYalu1ihXkSWwn6pFkPiA3sd1f2B0YOO9brOrMgaD4Ia3wTLk2M9zailUes61bNPrqi5QSrRhqLY/D1pRh+qDcVuO1BBsezOzyg6cCO90DtwQ42UrJs9SyKwMguuXZu6SPNK4vmjbr9UjnU+pMVEAmPNSRbMaGVZgFroWCM/rbkSQePn6JIRNsyQwo8mlWhOLU6gloIjJTZiidt9l+bxWd0kVIH1E3vGDWs995w/uknF0VfcDWUsLioWW+hY/E3ForCLHSp9GtToU0vjr4FSU62239+rbxu5NjFtQPUv793yO1gjanLHi+yWv1taopM18QJWbxd6ueYsq3+4pqLDIIRiOBLL9SAk603HSvUg0MLkSNblGZtbkAuGZ003PYjAuvYg+DJ4r4Mai/U+DlbUAxRMaEh1tw+Atn2mgoPnrXhNy+CUP144b4b5v2mvza/vD56Rr7VJNRWdBgV2DwbNJRlJd49VpQNIEcjkm9t/ykhnnah3aikamTp6b8S3sHbWTMdihHLxsuCIRl8rFNG6bmwEEpJGPliU/KkicUMah+ldaor0s94THWsZW1iVo+VYc6FcXZrhWLxIrk4tdCwSY8SzXgSeaccaPynvvoRnReRa91xvEtsz4OERt6zr4O4sFpMLeC/x43X2uCP24Wnd9S0LpPIfzX6pOMl9UYnQfzd7iSAjqYP3B0bXn/d2D1jEIiPV2hxyJ+GvtDUHuhvnHdNwO2TeShWQozUWZF9s+0qHEhb59nejW7oPVBnfm1i87PAOMFyFptbuZkWaWkFzhTuJz80FGcka31QkG2OlImlJRjIyPchIDTIx/KzEnfWiY/EkSyNvwhpJqmPAESFpOiCxvfvMGleq7MUJLlGhKkhKhPG0atIhAJ0mnXzkRap+6D/7+DKprukfVVKheBNY/FyGyZpZSZlFZ6qql4sTeC4cqyA4DFA+4lgFcnUvGJ61EAS9HYvNBLmCXi5GxyII5vseTGd2wmxaLGr1YKOQY/m+AxlBfJ1F9+JNHgTUGF8xUFhsJAjmO9br0oVoqDedVOx5ZhXFOEUxy2zdN6Nl/YHfOaWK5DKkgrmxKfzyPdzsqEOGwMF3IUXwuDLfhfvohmLvUDOSSR6taR6+C/PFnGDHjEjNI9p2fLF/BJbCR0hB47wKBunVtaRL/4EtuXepsZGTRjdrufUKIh9mDs0FslbszSUZSQOV3jjSJ+W+hbUSliyKpP8k6AE3SRJUOiEvcRGUlWJ7gKCSSkgykgZzKRQkJJrqpcOJAejMnjuXdKlFSYFP5HFFxyX/0U2sfGF57GtnWeFHd1ZB/iiKjRpt78NkrdEyVhktk8cvmxTrcfooq4wjCPRZ3Jds+egjtco04tdH7awPHYvNdCzOCFmUcpGN1ziQqSGnQ6XSZMBZDZWOimwl1OgkTbK6a4rT4Lb3hj9s24fZGN/zFb7fwjXXJCRF4Iux3jiX0Ins/w4a5lDXgvo6oXx0WBWT8lGNKCms6NWrHacE3FZ1COWj7op3AXYjXGGAfR2sStLxAUnSyT6vlGkr3cgH8s8ugEoS2TihhPHtdXjDzOsyBtpuqLOossB6pyffoZYalO5ClXdgx32CFjXVZgsI1A7svyXRotg7n0cChOKZQhGYux9X1LOwTkT0d+BYWZIim1HpihRQVMMVUAJDKrDrR1fUK5oqEKLWyx6DKaxqi16DeRVHAV6quko13XYgOOpeLVBQRFItBMkqDsVu1AIedbMwAV/ru6ImMlTsaLbmWRgL4QELYpEqObnZIv0X4rjey5JWq6f/uPksJDn76vtkpUSq7CCI5/ovtZM4co3hSopWTqKQxkKU8/OYB7TuHpEtEf5G7lUoTnBpsDN2Tk7Gb1OT6aBNnb9YLWD/x3SfqcmXX61s1PPXkRSP8UVqQbdsj4bl6BwtzYPCIG4V6MiJxfrUqbp1DxZnQaHbL0LK1dFWkMIrMhFqoOKgRGaebszM86BjYp7UwoYpMbZBforI5q152XiSbXjHgoTY3COFpqX5a7pO9U7esfJEuYTT6gYkkRbXq2MbPHXSqcPz5up3CpkEjheJxTOHMEzQaKjDeVmAQdFUFAH7apR7maTAUIibLIAHhe6d7kPorq6Km9QoVy84VOIdG3D5rfFjxN5cIIxUnCSJdMIUAhCBBJVEarv6GsSjnUggu39Zg4AVSUMViWVBp70Xwr+HfbWI2wjLbzHpXowyaTtCAIR4s8rnSQQ6Ie9GqunEksvYAQzb5HKDAG68LlOJGEpiocI81v3HVZk0XicYzyTPQs2pJX9XT+xpVYVh20lszt/VA+Yezb6fgWKdsE6W4428IpGbFr83cOu+BT13e1O/JSeVilx21KTpPHuBiSIbqtiPyoXK2xzhcyNJd20rRT4ZONI3adTpox6Vf4vG9erptuVvepagzqNegNo/ug1Vvv+O93lZg6RtqJYGlMJD6cK7IWPnggBFSBqz169dVD3TfceP7j7ZfGozxOG5KAtYgix+Rbe5S/wDrXs3piLqPE01SttF+Bp3i9LXfO22FaKwsEOR6ENfxVRV75kXj3XmHxWLJKn6Toc5Iaggc5kYiUR4Tp371gpV7SBIbbclFqcM9YOIJKoPfjYMktM7447DF6l+CZ/xX2tXfsiDI01EpKVdI2pDUE86FKNDcTIUG+n0b6JDfchQ/EmH4mSoiUot+EA1g18D1Ui9yUhjQ7m1pDpeKmxjwxyXaWwA2W99loEUiVUTvixKEIDQu07DBMUTIAl4YE6BTNbjtchQNZc33M4k+84/ilCrjnWehikE2JtLqvwSiXDcu3GKKriX/yVlMrMnfLm6kdK3lgpsmCRNqqVNY4+1luAeRE2UPSrDWYsJUlT5sF/TnwIkNVGGr1r1+5gBu+/oZtVod7aF90kUXV0hIUiY5sVhKkmqE57dXO2CJ9zSug6T3m+d0Y2H1vEo0jmHvfg2iUdlEvulPqw0Wz5V4R24IcLXQmC8ftkZgaekuorrJI6npVqN0NdXj+pT+Yl9o1aj6k1nkWR8V9fdO9NhnPxt0/Dm5rGQ0Mbm0LzKxwml3cxVx5lr2z8OU3dLQ68Qynffr/8Bp0572/+VAAA=", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [-36, -8], "name": "PE Extension"}, {"interval": [-38, -19], "name": "PE spacer sgRNA"}, {"interval": [17, 37], "name": "PE nicking sgRNA"}], "quantification_windows": [[-22, -21], [-12, -3], [19, 20]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the PE nicking sgRNA (CTCAACCATTAAGCAAAACAT). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the PE nicking sgRNA (CTCAACCATTAAGCAAAACAT). Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Reference.Alleles_frequency_table_around_PE_nicking_sgRNA.txt">Allele frequency table</a></small></p>
@@ -2051,14 +2054,15 @@ <h5>Allele Plots for Prime-edited</h5>
       
         
   
-<div id="fig_allele_table_around_cut_Prime-edited_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Prime-edited_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Prime-edited.Alleles_frequency_table_around_PE_Extension.pdf">
-            <img src="9.Prime-edited.Alleles_frequency_table_around_PE_Extension.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_Extension"></div>
+        <script type="text/javascript">const allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_Extension = {"plot_type": "allele_table", "reference": "CATTACATGAGGTGTTCGTTGTAACTCATATAAACTGAGT", "total_alleles": 307, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA9Wdy5LsJgxA/yXr7ls2ptvuJcWCH2B3K4ssklVWefx//MA27QdIQqgqc+tOzUyDTwuEEELQP3/+Yo33ZvzmjHPeeW/H/84bY/34x/Hf9NP4mv/lgSg6DKp/dK8funs0879//vr3918f17TnxReK9h4pP9Tr0bUz64/f/vz7BLNcoqlhhLVtQi7HhnpPKFILIkntZyQ1w6Md7luQrbsmyI+mf6i77rKMmthObdi8JdSw1QtKfVKN6JjkmnS+eeXkel5/4VBqQalXXjnc+PAyuQKsA7D2Byw6j2Y1E0sn29DydNcnT/qqTu8tLIlFpvamp573X7j5ZEJ16ZHFzNIKbwrx8+TCat+wkcXShkm5bhoQK1cfWPlRXN5fgdV9BKauVS5Af1095Ia1TNjHooHVPHR1seY5UoFUPn6Ap1iNwMrbp6vHJBrw2IgRabgSynCawhdAqNOYKiHlLAaLJQysrhMYWSurkWP1WsDqBpZqsawC3QD5TkxyQf00BrmgLk25VO8GaggL5n6kVKF6gVQEl9AKyLT9mDHusX2PSPNSHDJluUrW/TSOCuYRHUZwf6t/zyeXnxtYXWIm4WbpJum/88zFGqKDrC2oBebilfXCs6gtqBq8915B469YZaNLIVilI1nCn1lHl0azDFmul4DvpDE+Bg+r/YBmfkmWYWlDIOv4hATreSq6Wd4W6zyRxRrgK1ZycFxjnZr4L3mnJnpTewMO8HW4lFRrdWpfkSKSVozkapJ8ZXdmrX58FkT7tqK79nUA7fNcTtp17Nh7Zt/z1gI6xjjQZWcd6yZIF35IjnTXV082oeadptQ2pOXa1MqSfOQBcpDSsyIrqhdYJARUNojGyHq1UGe6ehPuPqddArwFqBfWDaSj2hbO8iJiGVuy95MfxMfqhSoI9W3jvWIyq8FtkRSxXjiWeVYxudfV5x9ESONrciRq67W4nipj9XIs1cmx5tiWCAs7sKp5GKyoVgmyNHKrOLwAXg5PJnPXQoxmQGIX61SwF8XbjOg3kFRr0X0ca6BUtqJDvVd3XK57mxPKGjHU+UG5vvoquqE+ua66er8p1KnohvrS9enFJVdhVIKx5ab649J7jim46bVpye/slBixRKvDKgk2rt6jkxGxju80sU49+/jZmSQWa3ZluU2TulF2K0ZaqxsxkmPbelR5w27EpHJcEYUsyRspmZbUX8dKanOxi8JFfkBl893+pyyd3VniY3UaxSobxKC8Sx41zKMMm2r0+Smfrbsk0kkD69UJsnpCWrMlqqFEWnNgvT/g4OD+O1HlUcHBstHVEwJ2xBYELn1s3TnyYn9YgGTLp5IPYSe6tlSmdCJB7Hl7YiLfRgIn8tEDxus8ggqU7H9DBS82uVT94LQiBjxTOfWHokep8KFVIZlWXV/TtxCkVhHDZzRWyxaqy2kgZ8A4w5rTSaVY9QPhO0sOJSiV0oKst2BvKUGWpFyCuqHF2nAQ2LeARhcYWV0rxxo0geVqO4VbdcRecYmbkTxl+V10ydmgkwRc6rl6eI048Q8onfBWSConsiSJfwe231J0d9Kgpv3rD9C+mosq3K5+0Yni3bTnUU4gRr2iTs8CtOBeFOW+u9N7r6cZ5+ZJsw5FM/6gF9nP8vV2ziK9WOsBUMd8SQDqywjOT6+3quu+N2+90C7nUstCrs45bA+lrkeZSCelsPwiXYPGPpYCjbWNFMhKgaLQOhvoLsj5lBLpfMShFojxpO0CSiwHTHxlmOGRqUUe6aWRUjmqlu1irVz7Rbe7WS6duGk/x3UjVEb79lvk1o2rcpC+E4l5QN0nwzqupSi49Uoz6HIgz2wkNOyGK4Z+Sp874JVqQKIKpEruw0Vj1/h6YzdxbZxlBoWcIsdmjRQwpahQ+TTk5NUKot7vt6DSu32O2ZqryqlLYd7tgVlS5UINgqT0Loth7ahkXMKIkayU8nGkHgJl8mxqnt+pt/EivUAonWu+6zmROsfXTmML7Qe7z5dDKQA5bMbashv9VvXLhrWv3jcs0BeKbq7sq3oCW+ipBpkrVzD3KjCqVCneEjcGA7zZLd/PrVllheavy5OKgtqb/imIUDHKYxOVVhQgF+CiVe5Ql0U3qQCkU0dkhYqL5peiXmx9fUWatldMPZKXcTLPlyFVtUmldyGBfYpvFH+49FhdZE4834NEaj74/quE8duyT6VaLzypRszgBIKeZH1eGln4hnzxbAgFZXdCT7dazUXxIEs7cLxNhYjzxs6IDCZybnCwrz3p3oraChGnFtcHWQEVX0Cw4+ez8NRBu7xNIyRRygO7viCOCnJEBW9IyXaIW99KZMImFGwzYP1s6s3mDWIoXT8tcmvATg7VM2b0Z1CDmFSdHEpMLSTycnFrDQ5UJ4bqSEnU4PljOSpEt7VeZkZ0ln0z7y572hpU9jQNRLgxNLKyGNOXvonl+uMOSDJNl6Q4CQfJiSyf5uje/Apthn/jPtwHnE2/xlMJMkV/pMkEPzRKvQNoRX3AJIGg5YaqlsFwAtGO924ywT+mg3qx1obScJRITxVdQYVSPy+xuTtVn9bS4dyDnVLuaKO3g6GkhBq/WcgFXmvM+7voSgLEjs7PQ50ZiVYcgHMcxxaqNqbOPXCPuii6KUX2qrUpvWqeC8MF2XSdeN+TvBPINvEyycyW8fOPcyAnBfLVM3F9nTzw4awOnvsm9TuZvMiRCuuFDok4IVD80c2gA0r7yQssSEqi+Wu+1G/9WrJIXcGnYlwa1uVoUq0A6ZcDttQSQRVezOn887jKNV9BN5VG+YDyEFQqRtC1WzLBr/8BS1BJow6AAAA=", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [-9, 19], "name": "PE Extension"}, {"interval": [-11, 8], "name": "PE spacer sgRNA"}, {"interval": [44, 64], "name": "PE nicking sgRNA"}], "quantification_windows": [[5, 6], [15, 24], [46, 47]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the PE Extension (AACGAACACCTCATGTAATGACTAAGATG). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the PE Extension (AACGAACACCTCATGTAATGACTAAGATG). Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Prime-edited.Alleles_frequency_table_around_PE_Extension.txt">Allele frequency table</a></small></p>
@@ -2068,14 +2072,15 @@ <h5>Allele Plots for Prime-edited</h5>
       
         
   
-<div id="fig_allele_table_around_cut_Prime-edited_sg1" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Prime-edited_sg1" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Prime-edited.Alleles_frequency_table_around_PE_spacer_sgRNA.pdf">
-            <img src="9.Prime-edited.Alleles_frequency_table_around_PE_spacer_sgRNA.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_spacer_sgRNA"></div>
+        <script type="text/javascript">const allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_spacer_sgRNA = {"plot_type": "allele_table", "reference": "GCAGTCATCTTAGTCATTACATGAGGTGTTCGTTGTAACT", "total_alleles": 274, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA9WdyZLbOAyG3yVnOyUuWnxk8cAX4C2Vwxwmp5xmef8RJVKS2602AIp/1TjptrtL0heAIAmCIPLjx7fgXYjeRR/j+iG6+VtwIcQQo5+/QnTOx283xqXTNI03038fplu3/Pnnr3///Hmj0O7Li0UbzK37rvubUQvr1x+//34D83LR9DjDlCLLFXCoChWqx4zqppuaqCqsgU0JNt40rb18lSmqIcEGiBLtitKPZ7liiy5WYHS5ghilE6rnqfBeXiKU7rl2GGaUUC6DsPkusexijkzB0hNkMHqDealtPLikeAFJkfR3P75401dCmZd+3JJltcTghXJpkQ3SmquoILPmxlJUlliHY5aL25ErWOYBGDSKXOwxY30Iub3Czupu9gPKXd6TlxlZQzzDlcTvXOs7y+A3qaYjyrUYCvszBXoY6fV2ByPl26WjRSbxZuI6lkG4GIXV4VijBcxamdXjUMrgWFrxJ2MxyzSc+D+whlMz9NexLGPQuH98SUhqJGrwApYhD1D1LNsxXF1Ea9UNu5mkO8AQX1rLAlk9wNEtFt8BWRrIGpms/AwKa/4nrZduFm+az8hFrB4w+5dBAzH7W/nUJdbhQzBNIllOqEMRy3ky6+4PJq+ahxh2lAWyJhxriYK29daKaUwS0whSHRo2K8p9DUq0MMZqF4rYu0Jjh9ddZBhpT60j7z3dYaRlOwhD2m1CSuIMuJWoEeB+ZhQzwlDF6hXAJZSoUDjtF7FwKKUA0f6tZ+mp+ZS1sVQHZI04ljY4lulRrP4Ga64HDqUsjqU7IEsDWUDTEK2BgtzPUDyUdzBU+iAb4x/MvbSFR0eFA+rt6ORTXktcHN+5lebvzp0p8P7J64AaZuP4lBWuH3Vf/U/faHw/kpJuL98h1GcyBRgp3bW1aHPSdruHkcrtDkaq2VLQ3JnRwaR6fhRhnNgv3UhLkJogVZCvU5lSRYfSX8WueyYxc1n+NyzLjE9X9SwgyzD92/IDZQ7eLt37luGu9aUWz91OcBVmODKds/wI2k5TvnRToW6++1M0iMiAy6zeAFkjYFcrswb+amThScd42zjkpOWBtNmVbzxzSWNbGhBvemUNQNaIY2mgDjVQLgNsL9M+FrmzcCigVNoCWQOwtTSQhZQLaBsWpsMJEPYsSwaNY+kBxzIKx7IPHGuyjfMxnpZd7NEwVMQZuGHqEIPQrWF35CQYyl1LbzIWYyzcn/MWVRbl/hjromzmRkgANF4Zav3aBD99ljhWeMqKgKi4j+umUntSBEX6A2RPITb0L55I0YFIyx00UtlOEZKOPeK60+6J9OLFNEQ9y7TeTNLeeuldCDo/xBeuleir04IeAPJNJAqXlz44AaVDTNeWczgHpb8g0JIKCwHF9VzxFRVZ3oEW80NItKZvgECzx4YCzXc7FMijQIcDgRUg2pLwjhIpLQExoKoDjiuIvHZ3x5nCSWVSjU9SriR6LpuvKCbD099hcPVym1C0pAcPsb7deeDvh+0gSxOpukOp9mVksklYScUamS/OiLxVSsU5I1erQEZM9mDprqGlr95reqvoUpomUibVdF5FJxHLrOzTdLqUq7xYaXuaf4RHiuLEfP1eF+8davdzvEB9oXo419Ro5f7pbbTteCl7lK0oT7fO8aMor0yivwlI4mz1uggZJdLtDkbyIDtHjbHi83DZzLl7hn7tmQKU5amvzAlSD0m1Lva46k9SS1VmFOz0uHRwglnfrJgf84Df+qOIpPrmeXgragBk/AnciTqU4LQYYi2Q70+rUunwZ7ikKLQ/zRdKiGInJC1aoaHypZtUbNK5Q/ZGf+0rtogcMlluq7gD8+u1cGKLV5CEhz0h84cgURJPesBISuNQhpurI0ZpBZNKDzCUbZ8udmgrGGpsZhYvqAkmlcGhYGaByI3MpA6HGmEoSLnUvIAT5cwyD/BXzFYREapIt3uhV2EkKJRQ1PIHxSstJHZtlvQL2Vw/8lOAgxDFzjamlt2MS16zOxgFs1BF2tOR2sRAJcUAiJ1GTBqAb5u48+H/AGq+tfxZQhyxmMh66WbjA6FuSd7Iab7rkUqkJLtzUVgiZetO6t2OeXU1loM79nU8OF6VhDK961Gxvu4gzf4iJJ/Lo1LhAgoULzlAv60Pz7tTgKQRekgGZkDs/sdma6hnkXwAgQIIFBwKVF5x+7QU5Dn8mhzoO/eJfv4HZPtLy2hyAAA=", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [5, 33], "name": "PE Extension"}, {"interval": [3, 22], "name": "PE spacer sgRNA"}, {"interval": [58, 78], "name": "PE nicking sgRNA"}], "quantification_windows": [[19, 20], [29, 38], [60, 61]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the PE spacer sgRNA (GTCATCTTAGTCATTACCTG). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the PE spacer sgRNA (GTCATCTTAGTCATTACCTG). Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Prime-edited.Alleles_frequency_table_around_PE_spacer_sgRNA.txt">Allele frequency table</a></small></p>
@@ -2085,14 +2090,15 @@ <h5>Allele Plots for Prime-edited</h5>
       
         
   
-<div id="fig_allele_table_around_cut_Prime-edited_sg2" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Prime-edited_sg2" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Prime-edited.Alleles_frequency_table_around_PE_nicking_sgRNA.pdf">
-            <img src="9.Prime-edited.Alleles_frequency_table_around_PE_nicking_sgRNA.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_nicking_sgRNA"></div>
+        <script type="text/javascript">const allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_nicking_sgRNA = {"plot_type": "allele_table", "reference": "ATATAAACTGAGTTCCCATGTTTTGCTTAATGGTTGAGTT", "total_alleles": 296, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72dzZLjKAyA32XOzpTBjuMcKQ68ALepPexh97Sn/Xn/tTEQ28EgsKR01fx0oL9IyCAkQf/69UPZ5UspbY0y1mqtlV3+ttZou3zfmuU/7p0fXUXTeZ7Hbnj+nKaud1///v3fH791v348Ll63aJPs+p/y2Q3Csf78/a9/HIxENDkssP7tSOLD2suCxhLvlTV3Yj4KdtQdFmxeYa9OcmhRPFfY1A05wcLrLmvcWPKdhSEJttpi/+wWc2SEvTmGTKywRZfdfGZtZo/J6gNrP3mQiPUOpLFsiNurfVZcUUM3yrzR48zAG0tesVBn+40lJgYr9KzemSNsvFZpm1ivjTW8i5PUfbk8S05XLEQdBhZo8j3KWb82ryxZsnkcuTyLYdKIpHUGJrb4D2vgYr0SD7KlEgviHp5fVaTnRpr6anNvZr1GEOueBj1r6Bl8qMAqThkIluFZhekJxwoDSzAsk8+MxeM+W54kEhpEnzICK7P4a1INlrorNtLWvW3GYFi0IkmQryMRNfCh3nwo0TOypgzLcjxWmngKNKT6q3Yvakmj93BHsHvRLpVnyRnKsvdZbxjr1mh51vBkcJsCCzBet60wsKYCC8PiR0a3ybPEmyEuWWJhzhqB9eJjyQv3XVHIlX6+cGfe8WrmRZ/jg1RfsQWC9SSwTqOlKML+48V6zEfauhM8xWU3VyOSBNhJU7RCnborNtINmZ7kPm5EiZGRNfOxJJsOCwkgS/YIa1IFkscGXTJXdE8BdKjvSOVZY8+QTvCsfGwQabQ8iyGu5UniPFoUNhgs4/RgHfrmUYemudhoUoFK8wm171lA7ZtmjTUtlCVI03lSKgmOvlENrD4x315vwu+xnqm5nWa+uPQvFLYJXnsyho209mYiWaTghScB6j2wlqsnIKmf+IEXqFSIZac/t/HOs9Z/rR/Srm9o1wTKcs5BZA0g50wR20Wiu2Ijrd2Xb4JJB/2R70QiSdK77MGzOAV+XC8Yy70PquJJatB9Th0+cJZ0nFWqrWJBQPW3rqD3fUBcj116L/rNkM33rOfAyHrxsaZaHTbVy/rxqtShucEa3gy7ucDiSCN4lnxd1hzjpREk5EnWiCQ5MexRiyzMCvGsBjHTqZ4kklJh171fSYVfYe+l+p4xLBXrxZBB2ClwTCUQqMdKEY7ViaTg6tt2ss2kNQZjH0QyTcuEsfc7CRLfYV6SpT0+2VhtJA6r+HRnkelr543iM+XPGCEdFAgz4Ahh4Whwzm/zMVUoy+cE0FjzWGQpTCMUgKAMgocrZDkqE8Mju+9XRUqiWLKYnkt97CJr3zSyyqV1Kd1csxJNI6tYnLiJdow5talwLJ4T0BqLNZRZ35bRahpFHaYido1yTWUW25O8Cz/GdxpVWBQr9ZHzrFPTyIKFV5ke5O8hMOiLf9ahgZfGYZHoZWrQHv0Rpgr7Q0MtS6RgYzHKJXtGFqNc5dkdkcUmlxgbzsRaSzwPasLt1q67pdvYGZ7NquXaFluuDbjhCABVnOgw4PjXBSl4l/gynTLf5+75vNmh6eNetB3l6Ii7vWFLV4iK1IhpRo09QxbGSzW3nFExGo56RJRoQjVJJTguR3Eo+WJDubEqWaDFkWpmyM3tnivqok4vlWQ4TAQyC6S7XgDGrjFRsudDyaZ8o2lAXS0hmLfybDJdHNLDvWzIoYSEn1fS91Ap9WFfoORAb4ZcbU57NKiUVIoE1bvALW2q1gs1JrLCq/+sEAv3PkIlk8LoM9I5U6uN2pKoS8dDb3US6bhqQkDLlL6XaRcvrYjLNcm0U0Yh+/yVdKoB+c4Q0zvk7Kolcl44iY2PLv73GST/GYme29NpRroJ4gA6HtnIgk5HNppBRYk+TbNuVAB9BRhjDv1BrDxL5JuLV/G0BodMHMqjX9n3x0+on6arapFQ7eBiBkggRSNR+rgpwf4pHb3UDHPe1lsh3lOUBRn0DbXorwPnyyumlqPr7wJVqlV50wXJdVfEw7S2URz2kKlRsjg+MkmJkkeVK6841Kf0g2eckIqufHilVHN1EfFDiHl899c86tMXP67qaNrOA6uo7boxUuf7e0oohexGnFFuRY/93R8tKEC9WqJUqKqiJu47Z/ISsg01lyvIFJ6hi1JN1/fPgqgvNo2WXi7pStR0tY3Uq76iq9m5lMS1Y2BSytSb1Df2gHIurpFKHSoEow4zLeC0583yxYCSgOspNctCtfbGWD1AIMNk53ikcrGJunOPUw3IMA3SAUQrkWIao7XGmQ20754FPU5N60DubgzipT10b74hpVIk31txgbb7RXhA7SECjBLjBwOISyIG1fGMEfwORwwQi0T1IdGBvFo6ougvxYv+neBDjXyoiQ019kwojl8dFDbtXCTR8ovULNP6ZPDSdkSoepksA8iyOGCWxUu2GJNR1hosqpucEckee1sCkOXJ2RmN9/tS8qCLMxQGFaTtF8iZN/oYGY5akqXBrjrGeGmQQIccpKVb1A/X926lX8DLwJR61ICO92e4cHjNHqNZpmXnqjWoLutRrbzhsFsPuVsAamtTUz93OOditC8c0OsDqneFe4efsSlPRdghDHpuukuYyMOdd+At2i3b+2TZAbbnmzZVBJ7Tj7C79fytve0gDQflqk5KIKjqXK3Zo111Bg5qqHGMN5UDjOGUHq8EbSUdIFC8ubl0C88X6Lf/ATW89bZaewAA", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [-36, -8], "name": "PE Extension"}, {"interval": [-38, -19], "name": "PE spacer sgRNA"}, {"interval": [17, 37], "name": "PE nicking sgRNA"}], "quantification_windows": [[-22, -21], [-12, -3], [19, 20]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the PE nicking sgRNA (CTCAACCATTAAGCAAAACAT). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the PE nicking sgRNA (CTCAACCATTAAGCAAAACAT). Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Prime-edited.Alleles_frequency_table_around_PE_nicking_sgRNA.txt">Allele frequency table</a></small></p>
@@ -2584,14 +2590,15 @@ <h5>Allele Plots for Scaffold-incorporated</h5>
       
         
   
-<div id="fig_allele_table_around_cut_Scaffold-incorporated_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Scaffold-incorporated_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Scaffold-incorporated.Alleles_frequency_table_around_PE_Extension.pdf">
-            <img src="9.Scaffold-incorporated.Alleles_frequency_table_around_PE_Extension.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Scaffold_incorporated_Alleles_frequency_table_around_PE_Extension"></div>
+        <script type="text/javascript">const allele_table_9_Scaffold_incorporated_Alleles_frequency_table_around_PE_Extension = {"plot_type": "allele_table", "reference": "CATTACATGAGGTGTTCGTTGTAACTCATATAAACTGAGT", "total_alleles": 163, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72bu5LlKAyG32Xi4y6D8bmEFIFfgGxqgg12o832/asWfAFs7MMvMPSZ6erx0P4sJCQh5N+/fymptTTfJjlNetJamb+TklJpc9F87E/m//Svx/lQfTb0wx/9z/B69ObDHv/89e9/f/95XLFUdMMLVnf4WoZyg/lhzJKe5lsCJpWa1l+3zz0RBeNGop/+PQvGK7PY27KWSRwQ1v4e16z1ecKhTFjWcyYxlGWvKfMvrRGFrUIaljWOfrQKG7BJpMPWLwObFSasYIApnt2BoDFrib2RaUDMvnAWV9Y8iYh1lCxnxwKMPl7OqL7moV6sV3oxx4+OsdahnjVWdxxPy+Jm+vpaJu8sw6Gw5XV83i+seOjK6h8CmEE5r69cIxw3FLa2ZlA5qraTX1GzteOG4a6SfKETi3PM3i3LX85kDRBruU0LdRW5J4dC3JMsS2w8C8hrCiOXWFiiYuRyjyU2uYYRN0P/5CRf6FgMMEMXu5Z7UM1QeDNMBuT4VmmxgqFeLAZEyVtMgwtoeZWxBstiDyEgMwwxdK+xshiHWPMNwlvCJh+w+jmnx1jaXpbLzwBrkzFkcUBfdjp09vLyLMjLH9VScQ6Vim5Atw04AZDS/Cky+Z4S/2UqWQs2eZ0f6lA5e7yOtJ8sQtGyGo8aCOEkL3Q5Fn/dyDqZwq5wCnU1banIlhMzuB/qUMAinqZu5z0yHTwWj493uJTqbKi3C0Cq4Hm/+ovuZMsVoIDkKZ6WqwnszoZ6j4tsxY93uJbqZGhggWmULtqyOpSonlXzBTU7C1LtKWMTxEnpTDenMzpp7hur68Kh3K8sKHMK4nCmWD2cpO2ukpy7Q2Hb4zssY97ZcSor0zIEmGLcIFffFjW0QY00sfKKGcQZPJRbMw2+r39w4l0Gb4RieEodVhhIJWQ3hQyvZZRGk4FWQ972x6SMkGcnn11lg9/luQ1ROjeYfDJ2Cq2URd4AebFY9aM7zxqrb+w869mQ9W7HGlhDlsDPq0tZgmgbLcLkEk3s+lTZboOkr4VFLRTyoFAI+Y2CgrVngXIVlBg4ocQgo+NqUk2SE2uS+7hEMI3Qy7MPpC7dTl326CSMt1+j1z6ABawnIFYU4Unlak4pV6+G0YQVZy0p1m6oYwG5hv2dvRl+Rx2GOhTSnqEWnL9FcgbDoX4Ge4jVTKxIW3eLNd3Vh8cs61vxZDoEk2kOklOihCzj3bQn8S8kvR7Bq+BBp2yZxJWmVKPZ05t/cPNRRHonilwyLmUUyDSkC5KH2KgySLzBSe5CYpxyQF2kqBeh8FnR+K6chGxGypSJv0ioJZuRCOrEH6Gk4CKtw3QTisFH+7lxfkN9CKS83qONBLVUr3uQzNC7oV4wKTfyOqF6DKXbCHWXQ0fqMbKklXolDZhQJa1vJPOLWo5J2yqH+lSvgfsoD5bOVG73pfNJcEuEyj01cyhCT2kLT+taZeeUwuiqVppU2JQbzB9evHXaykORamayxFeID7FM/K2M5eoHQRUhWMA8o/otgQaqLWEMPGD1OrtT1ad62dYJ9WyHerVDvZuhxqEdqp2uxoYT2M7Yn/29/Xs5FZFLkpbp9r3VBe62BWS3VD1Zcqcu9EPNTKF0YvoCRR13VURFLa1GeU6JeBhnPxJMYLplaK5QbRJA88xrCpOHelV/cWRBfcDG9hnVZFuqVMkbjw41ZryUpSruS3V4PiszrQKaPx111BKab12kAkhl76aSNLW4o0AVpHPgIIGu/UobJVWat6Qy+009JxXgK45xnpJU7KNiun0+WjBfUcehLn+Bzy/pqqLvQIioa6EEQNKN6kpeUYluvWJXcSgJ32ITukZvauzT//wPEt3bCEJEAAA=", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [-9, 19], "name": "PE Extension"}, {"interval": [-11, 8], "name": "PE spacer sgRNA"}, {"interval": [44, 64], "name": "PE nicking sgRNA"}], "quantification_windows": [[5, 6], [15, 24], [46, 47]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the PE Extension (AACGAACACCTCATGTAATGACTAAGATG). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the PE Extension (AACGAACACCTCATGTAATGACTAAGATG). Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Scaffold-incorporated.Alleles_frequency_table_around_PE_Extension.txt">Allele frequency table</a></small></p>
@@ -2601,14 +2608,15 @@ <h5>Allele Plots for Scaffold-incorporated</h5>
       
         
   
-<div id="fig_allele_table_around_cut_Scaffold-incorporated_sg1" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Scaffold-incorporated_sg1" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Scaffold-incorporated.Alleles_frequency_table_around_PE_spacer_sgRNA.pdf">
-            <img src="9.Scaffold-incorporated.Alleles_frequency_table_around_PE_spacer_sgRNA.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Scaffold_incorporated_Alleles_frequency_table_around_PE_spacer_sgRNA"></div>
+        <script type="text/javascript">const allele_table_9_Scaffold_incorporated_Alleles_frequency_table_around_PE_spacer_sgRNA = {"plot_type": "allele_table", "reference": "GCAGTCATCTTAGTCATTACATGAGGTGTTCGTTGTAACT", "total_alleles": 127, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA8Wbu27cMBBF/8W1ZIgPvUqCBX+AneEiRVKly/8DIaUVtYkb3pudiR/CLkDs8XCGd4ZD+uPjLcWQcgw55ny+yKE8Ukgpp5xj+S0jQsxvQ8/QfA7d12F6d/swlW8z/Pj289f3z6GTFWPqZY3j+DY4V1imPAYnyTrssltlmcMui7Fied/FGo+vwlovllnKQ9YwU3z1Pm2HYQ5mjRirOmyamUksrKzISpDDjL1YhSoOmyrMV3fBS6zGIgSrUT/VFWZWNBLPDwA8tp4s6wSl47JrbXY5IupJlrXoHNa3pF2zmHJcrKWyqkmHx1RYVnKBXXHYWIRwpNxtVspPU+jhGQyg9s4XSn5xNZQz4unrwTrkCfZWJu3CxTCgNcDNWsSF158sryG8vtklLxqNZVc9loOFN6Kljb+XMpi76kvSXfBSro9+VnpiwTOYyYi3nlANlHXUoeaoEeHVRbK8J1i9O70rNB6sqVpm1ViOSJQsa8NVIyiyQIW6WbMey2qydj2Wg+MwZpYFh0ZKY6YkikkoobeuOYfe3oJFvvytfVaN59A74PFtV+6u1o6hd1zAqAxuGRrKi9eFls9cLOuo1OAsCdZP9g536SRpL2+t4nmrofA2Q9lLcpHB1E8sa6EaeRRLoxf6QM1cfzKSoTGJp0hLpy0eZYwiy4rvkf+Lu6wR71zfrEXRLsU4dF68mdxYfpbtrY1/qKF0z/UpJWuhFFlHg1zqwOs1asiyNkXWjitvitCJcmMtMCol1ixHdNbI/A/vkDPa0eAL3tzrrK8zOBEsNbPK81VmhVffNDCVBcRg4i+GXKjOPVfi09ZNst2k/DgQiqRNvi8ootLs5fJDbsRP0gbtjQN3G6TZ5NDmAjV7Gg34k7SqkQxzSo12Fi5H7eI9jKZHkx5qUUNZI4b6e03ZldilBq0JZFGOOceNnFXyhwn/EOw0Ss8qa/RQ8i2ZFoGLmlVu1UNtaii/y1+QfKBmp2bVrBcWs56vZj21WLQ0cJe8eHS1EZrcWvF76Xe5Lt1fampLuAq8CdQCECah92WbpwhUIgtOK355kFfAmAJdL6F30dHGSNMK/OoFOX9L775erQHzAhR+TSbmpLW3gvuNHUGRX/TPK1/aSp+/AZd671ZFNQAA", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [5, 33], "name": "PE Extension"}, {"interval": [3, 22], "name": "PE spacer sgRNA"}, {"interval": [58, 78], "name": "PE nicking sgRNA"}], "quantification_windows": [[19, 20], [29, 38], [60, 61]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the PE spacer sgRNA (GTCATCTTAGTCATTACCTG). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the PE spacer sgRNA (GTCATCTTAGTCATTACCTG). Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Scaffold-incorporated.Alleles_frequency_table_around_PE_spacer_sgRNA.txt">Allele frequency table</a></small></p>
@@ -2618,14 +2626,15 @@ <h5>Allele Plots for Scaffold-incorporated</h5>
       
         
   
-<div id="fig_allele_table_around_cut_Scaffold-incorporated_sg2" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Scaffold-incorporated_sg2" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Scaffold-incorporated.Alleles_frequency_table_around_PE_nicking_sgRNA.pdf">
-            <img src="9.Scaffold-incorporated.Alleles_frequency_table_around_PE_nicking_sgRNA.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Scaffold_incorporated_Alleles_frequency_table_around_PE_nicking_sgRNA"></div>
+        <script type="text/javascript">const allele_table_9_Scaffold_incorporated_Alleles_frequency_table_around_PE_nicking_sgRNA = {"plot_type": "allele_table", "reference": "ATATAAACTGAGTTCCCATGTTTTGCTTAATGGTTGAGTT", "total_alleles": 149, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA8Wby7KcIBBA/yXrMTU0OjpLigU/wO5WFlkkq+zy/1XhMSIoKCrdcarmvsQzDU2/6Pv19U1o8xJCaiWU1lJKoc1XrZXU5vdamR/cX749Ttz65o/ndz4+nubFHr9//vn768cDicUHw2K9Jb3MGy6MWdjz5QQDMhZHn0QGljXYSRzxJ5FZmFuxAR/2DDCODnvPrJ4OBYDOmizLzh6bYla3uRqwRs8CnpoO+/Tmco2zXMlm9qKY8dLcqsxwqY1kN1Evi4IHHKLsJYXwf7mDejrDEaEQFCNCYVuogLIbmozF6FiQmCevBe42M8Coh5BGCYXRkRZKaExhSQuD4t2Ua1hU42hvra6rKOe5zm4u86irYnFkzQgofI8cUBMdirOCviOwcvp+dJ1k9Z7VZ/zW9sk35fqwoN9RePNdkznsq/Zxh4dC0cKAAnxvsrDGVOMX0z4b9gIrzHY9y2g8P6vxXXcu8bIs9uj7osY3TPI8K6uFNuwUzVEMcmLlvEnipPdZXQJLxOJlFOIMCjV7w3jRcFAaIVsIqKuJZHcehZ+NBxR++BlQQIfidKg3HcoYDEbIAjLWm04uGAgVnlA3+JNuDvmQRhnS3mPcFYKLTN2W94ZoanghhD8Z0IBnDYUoYx3E35Lrw3Ih4X66oFwg0ICVjTLmq9FywW6c5ieuLcoV/QE5/JxZfYHVUuOjKdwqRtvNBRWhbjyfLVjsuCDUTK4L9aCLNuMggo+ThVhlWqM09jZei1RCrTnlvAIKeclnopB21rp2F4x6axRBBTmwXpQoRoVibzqxgJGygIxFqBow0bE4J2SNdKx+lQeZYbZEaN/tk3ZYjhCFdRVyJb4/cx4zRx73g12eGvmoeoztuiK3hY1afOOhVJ5T4+UgW3xSCqH+WUJ9nD4+KpRSK6p31YVxyOeRGqNSGIWf7Ljebx9pHzLv8j2x4l3Y2VtjsThyYuK6doqpHQ6J7xf7ZRsSA4JzhVmoIddCg0JKG57SRKFRGcOjpu30zcPlPFymw1Uz7UuGxxmJakxC6E1zpG0JCIs0rfp0gjGqNLQ1VZVI+SBBuRuiT1sUap04FlPHZaFioWbjirGjVnXcNEkVeLZvRdK4JLUUjVuSIN8lJjEWqn8XkiuB4KSKqXB00nmf9K5oYFWthILawyx5H3Umvxe3UBcyOHXR9V5JFsU1m3T56Ls6eK5Q9dObKn9aE5RiJEMN+DWEbOiHSmJAhuI9eidkQL3opJrotIJQAekmcCCcwGoPIm87q912Qd1SqlcJpcN40UrZCxq4OlHSrmJxN1rqo6pc2kTX7XWRWkhoD68SKi1rItR5/gNpVauV7sDSDDD3+vFi1nS3UKpRVpBWqKSW5ZM/v0xLHfq8ULNGHM6f1LW1p+xKhRIcvleM/9nBbd+mqGyd9tNnvulPFf5BRdK2w+UUCVUmrbv2C1UghanDI2mJFbwkJCsDlut9xeZ8U8qWO+b8Q/n0A5WbgfNWwh/n2FfFIYuTqbtY+NOoYfrqMKLBCUEpzUkPCNYnitJmukJsPqxB2ecnjWIWlfmHyOxS/fgHdaO+lGI+AAA=", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [-36, -8], "name": "PE Extension"}, {"interval": [-38, -19], "name": "PE spacer sgRNA"}, {"interval": [17, 37], "name": "PE nicking sgRNA"}], "quantification_windows": [[-22, -21], [-12, -3], [19, 20]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the PE nicking sgRNA (CTCAACCATTAAGCAAAACAT). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the PE nicking sgRNA (CTCAACCATTAAGCAAAACAT). Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Scaffold-incorporated.Alleles_frequency_table_around_PE_nicking_sgRNA.txt">Allele frequency table</a></small></p>
@@ -3249,7 +3258,791 @@ <h5>Prime Editing for Scaffold-incorporated</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
+
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
 
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_Reference_Alleles_frequency_table_around_PE_Extension") && typeof allele_table_9_Reference_Alleles_frequency_table_around_PE_Extension !== "undefined") {
+      await buildAlleleTable(allele_table_9_Reference_Alleles_frequency_table_around_PE_Extension, "allele_table_9_Reference_Alleles_frequency_table_around_PE_Extension")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Reference_Alleles_frequency_table_around_PE_Extension")
+    }
+    
+    if (document.getElementById("allele_table_9_Reference_Alleles_frequency_table_around_PE_spacer_sgRNA") && typeof allele_table_9_Reference_Alleles_frequency_table_around_PE_spacer_sgRNA !== "undefined") {
+      await buildAlleleTable(allele_table_9_Reference_Alleles_frequency_table_around_PE_spacer_sgRNA, "allele_table_9_Reference_Alleles_frequency_table_around_PE_spacer_sgRNA")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Reference_Alleles_frequency_table_around_PE_spacer_sgRNA")
+    }
+    
+    if (document.getElementById("allele_table_9_Reference_Alleles_frequency_table_around_PE_nicking_sgRNA") && typeof allele_table_9_Reference_Alleles_frequency_table_around_PE_nicking_sgRNA !== "undefined") {
+      await buildAlleleTable(allele_table_9_Reference_Alleles_frequency_table_around_PE_nicking_sgRNA, "allele_table_9_Reference_Alleles_frequency_table_around_PE_nicking_sgRNA")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Reference_Alleles_frequency_table_around_PE_nicking_sgRNA")
+    }
+    
+    if (document.getElementById("allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_Extension") && typeof allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_Extension !== "undefined") {
+      await buildAlleleTable(allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_Extension, "allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_Extension")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_Extension")
+    }
+    
+    if (document.getElementById("allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_spacer_sgRNA") && typeof allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_spacer_sgRNA !== "undefined") {
+      await buildAlleleTable(allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_spacer_sgRNA, "allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_spacer_sgRNA")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_spacer_sgRNA")
+    }
+    
+    if (document.getElementById("allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_nicking_sgRNA") && typeof allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_nicking_sgRNA !== "undefined") {
+      await buildAlleleTable(allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_nicking_sgRNA, "allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_nicking_sgRNA")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_nicking_sgRNA")
+    }
+    
+    if (document.getElementById("allele_table_9_Scaffold_incorporated_Alleles_frequency_table_around_PE_Extension") && typeof allele_table_9_Scaffold_incorporated_Alleles_frequency_table_around_PE_Extension !== "undefined") {
+      await buildAlleleTable(allele_table_9_Scaffold_incorporated_Alleles_frequency_table_around_PE_Extension, "allele_table_9_Scaffold_incorporated_Alleles_frequency_table_around_PE_Extension")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Scaffold_incorporated_Alleles_frequency_table_around_PE_Extension")
+    }
+    
+    if (document.getElementById("allele_table_9_Scaffold_incorporated_Alleles_frequency_table_around_PE_spacer_sgRNA") && typeof allele_table_9_Scaffold_incorporated_Alleles_frequency_table_around_PE_spacer_sgRNA !== "undefined") {
+      await buildAlleleTable(allele_table_9_Scaffold_incorporated_Alleles_frequency_table_around_PE_spacer_sgRNA, "allele_table_9_Scaffold_incorporated_Alleles_frequency_table_around_PE_spacer_sgRNA")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Scaffold_incorporated_Alleles_frequency_table_around_PE_spacer_sgRNA")
+    }
+    
+    if (document.getElementById("allele_table_9_Scaffold_incorporated_Alleles_frequency_table_around_PE_nicking_sgRNA") && typeof allele_table_9_Scaffold_incorporated_Alleles_frequency_table_around_PE_nicking_sgRNA !== "undefined") {
+      await buildAlleleTable(allele_table_9_Scaffold_incorporated_Alleles_frequency_table_around_PE_nicking_sgRNA, "allele_table_9_Scaffold_incorporated_Alleles_frequency_table_around_PE_nicking_sgRNA")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Scaffold_incorporated_Alleles_frequency_table_around_PE_nicking_sgRNA")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_pro-global-only-multi-amplicon/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_pro-global-only-multi-amplicon/CRISPResso2_report.html
index d7582c45..d88a26e8 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_pro-global-only-multi-amplicon/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_pro-global-only-multi-amplicon/CRISPResso2_report.html
@@ -767,10 +767,10 @@ <h5 class="text-center mb-3">pro-global-only-multi-amplicon</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-07-24 15:53:36</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:48:29</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG,GGAAACGCCCATGCAATTAGTCTATTTCTGCTGCAAGTAAGCATGCATTTGTAGGCTTGATGCTTTTTTTCTGCTTCTCCAGCCCTGGCCTGGGTCAATCCTTGGGGCCCAGACTGAGCACGTGATGGCAGAGGAAAGGAAGCCCTGCTTCCTCCAGAGGGCGTCGCAGGACAGCTTTTCCTAGACAGGGGCTAGTATGTGCAGCTCCTGCACCGGGATACTGGTTGACAAG</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/cole/code/edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/Both.Cas9.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG,GGAAACGCCCATGCAATTAGTCTATTTCTGCTGCAAGTAAGCATGCATTTGTAGGCTTGATGCTTTTTTTCTGCTTCTCCAGCCCTGGCCTGGGTCAATCCTTGGGGCCCAGACTGAGCACGTGATGGCAGAGGAAAGGAAGCCCTGCTTCCTCCAGAGGGCGTCGCAGGACAGCTTTTCCTAGACAGGGGCTAGTATGTGCAGCTCCTGCACCGGGATACTGGTTGACAAG -n pro-global-only-multi-amplicon --config_file inputs/smoke_single_plot_config.json --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/Both.Cas9.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG,GGAAACGCCCATGCAATTAGTCTATTTCTGCTGCAAGTAAGCATGCATTTGTAGGCTTGATGCTTTTTTTCTGCTTCTCCAGCCCTGGCCTGGGTCAATCCTTGGGGCCCAGACTGAGCACGTGATGGCAGAGGAAAGGAAGCCCTGCTTCCTCCAGAGGGCGTCGCAGGACAGCTTTTCCTAGACAGGGGCTAGTATGTGCAGCTCCTGCACCGGGATACTGGTTGACAAG -n pro-global-only-multi-amplicon --config_file inputs/smoke_single_plot_config.json --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -910,7 +910,6 @@ <h5 class="text-center mb-3">pro-global-only-multi-amplicon</h5>
 
 
 
-
       
       <div class="row">
       <div class="col-sm-1"></div>
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_pro-no-plots-key/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_pro-no-plots-key/CRISPResso2_report.html
index 869bda6f..5c1fa31f 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_pro-no-plots-key/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_pro-no-plots-key/CRISPResso2_report.html
@@ -801,12 +801,12 @@ <h5 class="text-center mb-3">pro-no-plots-key</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:44:16</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:49:30</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>GGAATCCCTTCTGCAGCACC</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/FANC.Cas9.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC -n pro-no-plots-key --config_file inputs/no_plots_key_config.json --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/FANC.Cas9.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC -n pro-no-plots-key --config_file inputs/no_plots_key_config.json --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1391,14 +1391,15 @@ <h5 class="text-center mb-3">pro-no-plots-key</h5>
     
       
   
-<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.pdf">
-            <img src="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC"></div>
+        <script type="text/javascript">const allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC = {"plot_type": "allele_table", "reference": "CATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAG", "total_alleles": 48, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72XvXKDMAzH36WzzWEDgY4+D3oBbbkMHdqpUz/ev7JJCE1w5CCDYfD5kH8nWf5LHI8v3iGAc+i9R/QI3tFLc1pED7RGqx4cvKgnPjV9rXpbNa2q4/Pz9ft+UkswrbUU9qqaamhUE0kfb5/fiyh9GRJUq0zVE/AhKZgv2SdIevHThkh2IIxJofRsiOJnVV0NnTKWD6A4Mc6slo/gzDuZWyaXJXfrkIMqE8Gbw9LMWHeLCdXSxcpmSRRjZLX1TQgXOVJ1Gln2LjOWUGVY5l4zklEU+9UtpWECJmUlVJfLx1V5mFKNDVhtk2YhRDtHG2hAh0gT8OMmPGsStIlVR5W/R/0/sjJpmCySKdUoeb3mG6RSfyXL8ixX6Co/FvmiqI5F+VIopk8rmBeGK/4FJb7jCnK5s7IcytHXAB6i8TgDwFRTOK+qZ+zsrKhXsw/7DKIJu0JGnGYoDJsEZ8bluJbh1lWeJxRdY5PdFYr03ZqnOlCROJnDs6wNL9eMJU2NIRslzsI+E7WHZFxQMFbozVFF1KnJQJVqdXmUk/4dX4WQRXm9R30M5uh3IpFVkN1gGMtKeNcJbtdy8cP9jmrqaTYvWdEi2I/qFEKajCCLsnmoSKFohkkBFO71Y3z6A/KDr0YkFAAA", "custom_colors": {"Deletion": "#d32f2f", "Insertion": "#1976d2", "Substitution": "#388e3c", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": ""}], "quantification_windows": [[19, 20]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.txt">Allele frequency table</a></small></p>
@@ -1852,7 +1853,743 @@ <h5 class="text-center mb-3">pro-no-plots-key</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
 
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC") && typeof allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC !== "undefined") {
+      await buildAlleleTable(allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC, "allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_pro-smoke-single-plot/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_pro-smoke-single-plot/CRISPResso2_report.html
index 572b6457..d51d7ad3 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_pro-smoke-single-plot/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_pro-smoke-single-plot/CRISPResso2_report.html
@@ -763,12 +763,12 @@ <h5 class="text-center mb-3">pro-smoke-single-plot</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:44:11</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:48:39</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>GGAATCCCTTCTGCAGCACC</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/FANC.Cas9.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC -n pro-smoke-single-plot --config_file inputs/smoke_single_plot_config.json --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/FANC.Cas9.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC -n pro-smoke-single-plot --config_file inputs/smoke_single_plot_config.json --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -914,7 +914,6 @@ <h5 class="text-center mb-3">pro-smoke-single-plot</h5>
 
 
 
-
       
       <div class="row">
       <div class="col-sm-1"></div>
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_pro-subset-plots/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_pro-subset-plots/CRISPResso2_report.html
index 21a80091..c9524fbe 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_pro-subset-plots/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_pro-subset-plots/CRISPResso2_report.html
@@ -782,7 +782,6 @@ <h5 class="text-center mb-3">pro-subset-plots</h5>
 
 
 
-
       
       <div class="row">
       <div class="col-sm-1"></div>
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-base-edit-abe/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-base-edit-abe/CRISPResso2_report.html
index 8ab19ff0..6326d2a4 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-base-edit-abe/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-base-edit-abe/CRISPResso2_report.html
@@ -801,12 +801,12 @@ <h5 class="text-center mb-3">vcf-base-edit-abe</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:44:13</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:52:26</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>GGAATCCCTTCTGCAGCACC</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/vcf_base_edit_abe.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC --vcf_output --amplicon_coordinates FANC:1 --quantification_window_coordinates 76-96 -n vcf-base-edit-abe --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/vcf_base_edit_abe.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC --vcf_output --amplicon_coordinates FANC:1 --quantification_window_coordinates 76-96 -n vcf-base-edit-abe --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1391,14 +1391,15 @@ <h5 class="text-center mb-3">vcf-base-edit-abe</h5>
     
       
   
-<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.pdf">
-            <img src="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC"></div>
+        <script type="text/javascript">const allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC = {"plot_type": "allele_table", "reference": "CATGGAATCCCTTCTGCAGCACCTGGGACCCCGCCACCGT", "total_alleles": 7, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA4uOVnJ2DHF3d3QMcXZ2DglxDnF3dgQiINsdKAoUc3Z3BnHdQ5R0SFBqaQREegY6EFhSVJoaqwOzyp26VhnrGEMtMtRJS8wpRrIJpt2ROjYZ6hgSsikEyKSXTZja3SmxCT2acOp2p9BLONODI5VjyQgadrEAxSUCUuYCAAA=", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": ""}], "quantification_windows": [[4, 24]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.txt">Allele frequency table</a></small></p>
@@ -1852,7 +1853,743 @@ <h5 class="text-center mb-3">vcf-base-edit-abe</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
 
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC") && typeof allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC !== "undefined") {
+      await buildAlleleTable(allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC, "allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-base-edit-cbe/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-base-edit-cbe/CRISPResso2_report.html
index 13567d00..84b52d8b 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-base-edit-cbe/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-base-edit-cbe/CRISPResso2_report.html
@@ -801,12 +801,12 @@ <h5 class="text-center mb-3">vcf-base-edit-cbe</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:44:15</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:50:15</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>GGAATCCCTTCTGCAGCACC</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/vcf_base_edit_cbe.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC --vcf_output --amplicon_coordinates FANC:1 --quantification_window_coordinates 76-96 -n vcf-base-edit-cbe --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/vcf_base_edit_cbe.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC --vcf_output --amplicon_coordinates FANC:1 --quantification_window_coordinates 76-96 -n vcf-base-edit-cbe --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1391,14 +1391,15 @@ <h5 class="text-center mb-3">vcf-base-edit-cbe</h5>
     
       
   
-<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.pdf">
-            <img src="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC"></div>
+        <script type="text/javascript">const allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC = {"plot_type": "allele_table", "reference": "CATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAG", "total_alleles": 9, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA4uOVnJ2DHF3d3QMcXZ2DglxDnF3dgQiIBsoGOLsDhQDijq7O7or6ZCg1NwUiPQMdCCwpKg0NVYHYRVIM9WsstCxgFpkpJOWmFOMYhNIN9VsMtExgdpkiMUmavoJr00hznSzKYSKoWekYwS1yRjZJkfq22SoY4jNJpR4cqayTdjSHm38BLMpFgD82mfmvAMAAA==", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": ""}], "quantification_windows": [[4, 24]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.txt">Allele frequency table</a></small></p>
@@ -1852,7 +1853,743 @@ <h5 class="text-center mb-3">vcf-base-edit-cbe</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
 
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC") && typeof allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC !== "undefined") {
+      await buildAlleleTable(allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC, "allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-basic/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-basic/CRISPResso2_report.html
index a92f1fee..e9fa1dbf 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-basic/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-basic/CRISPResso2_report.html
@@ -801,12 +801,12 @@ <h5 class="text-center mb-3">vcf-basic</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:44:02</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:46:20</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>GGAATCCCTTCTGCAGCACC</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/vcf_basic.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC --quantification_window_coordinates 89-95 --vcf_output --amplicon_coordinates FANC:1 -n vcf-basic --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/vcf_basic.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC --quantification_window_coordinates 89-95 --vcf_output --amplicon_coordinates FANC:1 -n vcf-basic --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1391,14 +1391,15 @@ <h5 class="text-center mb-3">vcf-basic</h5>
     
       
   
-<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.pdf">
-            <img src="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC"></div>
+        <script type="text/javascript">const allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC = {"plot_type": "allele_table", "reference": "CATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAG", "total_alleles": 29, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72WvQ7CIBCA36UzGIG2cSU33AuwNR0cdHLy5/09IdUYQGhBWoZyAT7up3c3TR1og6i1AQBjwCBoGvRNQgNIMpICauzYiqXjQGO3Z+69Xx+nmYVRnBeiFFMEkhZ0Pl5uUZLmvBUJqpBEisR5saMkk75O3m4TDQn/TrGlggkbEOJbJwxc1D8golPIAB+STFnPPQXWc6RD2k+8NPYcacghQQ1SnySVJwlHSkY51rJenyY10wkqxd6YRaqhk8ogNbPe++e1sbGdJNehSpTK1KqNp+w0L8fSpbbnWFsLreX+nfkWUoMsYUkV/JTVSbwqZDHJ1d0UyVhZOel3wxfaHivvwaWRRsLfTnPvgGgjwQNLF5JKk5rphNWbo/kJSMT63gUMAAA=", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": ""}], "quantification_windows": [[17, 23]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.txt">Allele frequency table</a></small></p>
@@ -1852,7 +1853,743 @@ <h5 class="text-center mb-3">vcf-basic</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
 
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC") && typeof allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC !== "undefined") {
+      await buildAlleleTable(allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC, "allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-deletions-only/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-deletions-only/CRISPResso2_report.html
index 0201a0c6..89ea22ea 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-deletions-only/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-deletions-only/CRISPResso2_report.html
@@ -801,12 +801,12 @@ <h5 class="text-center mb-3">vcf-deletions-only</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:44:07</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:49:29</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>GGAATCCCTTCTGCAGCACC</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/vcf_deletions.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC --vcf_output --amplicon_coordinates FANC:1 --quantification_window_coordinates 89-94 -n vcf-deletions-only --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/vcf_deletions.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC --vcf_output --amplicon_coordinates FANC:1 --quantification_window_coordinates 89-94 -n vcf-deletions-only --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1391,14 +1391,15 @@ <h5 class="text-center mb-3">vcf-deletions-only</h5>
     
       
   
-<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.pdf">
-            <img src="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC"></div>
+        <script type="text/javascript">const allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC = {"plot_type": "allele_table", "reference": "CATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAG", "total_alleles": 29, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72WOw7DIAxA79IZqgaSqCvy4AuwRRk6tFOnfu5f1yitKkCQQEkYArJ5+BPjadqBsYjGWACwFiyCoUHftGgBaY1WAQ3uxArRcaCxPwj3Pm7P8yzCKCkLUVpoAikGXU7Xe5RkpGxFgiqkLkWSsjhQSijfJk/bRlPCP1NMtBMdJ0T3axMGDupvELEp5IAvSaW8554C7znSMR0nWZp7jjTkkKAGqU+SyouEIyWzHGt5r0+TmtkElXJvzCLVsElnkJp57/Pzcm5sJ6l1qBKjMq1qEyme5tVYOtT2Gst3IXvu35VvITWoEkyqEKesTuJ9QxaT0m0Ya5sGoJB67HYPikb6CF+d5t4G0T5CBkQXkk6TmtmE1Xuj+QXMFVg+BAwAAA==", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": ""}], "quantification_windows": [[17, 22]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.txt">Allele frequency table</a></small></p>
@@ -1852,7 +1853,743 @@ <h5 class="text-center mb-3">vcf-deletions-only</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
 
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC") && typeof allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC !== "undefined") {
+      await buildAlleleTable(allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC, "allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-insertions-only/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-insertions-only/CRISPResso2_report.html
index c1167282..0d950afc 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-insertions-only/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-insertions-only/CRISPResso2_report.html
@@ -801,12 +801,12 @@ <h5 class="text-center mb-3">vcf-insertions-only</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:44:06</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:52:40</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>GGAATCCCTTCTGCAGCACC</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/vcf_insertions.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC --quantification_window_coordinates 89-95 --vcf_output --amplicon_coordinates FANC:1 -n vcf-insertions-only --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/vcf_insertions.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC --quantification_window_coordinates 89-95 --vcf_output --amplicon_coordinates FANC:1 -n vcf-insertions-only --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1391,14 +1391,15 @@ <h5 class="text-center mb-3">vcf-insertions-only</h5>
     
       
   
-<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.pdf">
-            <img src="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC"></div>
+        <script type="text/javascript">const allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC = {"plot_type": "allele_table", "reference": "CATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAG", "total_alleles": 29, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72WvQ7CIBCA36UzGIG2cSU33AuwNR0cdHLy5/09IdUYQGhBWoZyAT7up3c3TR1og6i1AQBjwCBoGvRNQgNIMpICauzYiqXjQGO3Z+69Xx+nmYVRnBeiFFMEkhZ0Pl5uUZLmvBUJqpBEisR5saMkk75O3m4TDQn/TrGlggkbEOJbJwxc1D8golPIAB+STFnPPQXWc6RD2k+8NPYcacghQQ1SnySVJwlHSkY51rJenyY10wkqxd6YRaqhk8ogNbPe++e1sbGdJNehSpTK1KqNp+w0L8fSpbbnWFsLreX+nfkWUoMsYUkV/JTVSbwqZDHJ1d0UyVhZOel3wxfaHivvwaWRRsLfTnPvgGgjwQNLF5JKk5rphNWbo/kJSMT63gUMAAA=", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": ""}], "quantification_windows": [[17, 23]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.txt">Allele frequency table</a></small></p>
@@ -1852,7 +1853,743 @@ <h5 class="text-center mb-3">vcf-insertions-only</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
 
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC") && typeof allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC !== "undefined") {
+      await buildAlleleTable(allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC, "allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-multi-amplicon/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-multi-amplicon/CRISPResso2_report.html
index 2d9d4303..4de1cea7 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-multi-amplicon/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-multi-amplicon/CRISPResso2_report.html
@@ -805,12 +805,12 @@ <h5 class="text-center mb-3">vcf-multi-amplicon</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:44:14</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:50:17</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG,TACGGGTATTACCCGCGTTTAGTGGCTAGCGACTCGTGGACTTGCTGTACTGTCTACGGGCGTCAACTTGATAATCCCAAAAAAGCTTGGCCCCGCACAACTCGTTGAGCAATTCTTAAAAAGATGGTGTACGTCCCTCATACTTCGTATTCAATAAACCCGGTTAGACCATTGGGTGCGTGATGCTGCATTGCCTTGCA</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>GGAATCCCTTCTGCAGCACC,CCCCGCACAACTCGTTGAGC</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/vcf_multi_amplicon.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG,TACGGGTATTACCCGCGTTTAGTGGCTAGCGACTCGTGGACTTGCTGTACTGTCTACGGGCGTCAACTTGATAATCCCAAAAAAGCTTGGCCCCGCACAACTCGTTGAGCAATTCTTAAAAAGATGGTGTACGTCCCTCATACTTCGTATTCAATAAACCCGGTTAGACCATTGGGTGCGTGATGCTGCATTGCCTTGCA -an AMP1,AMP2 -g GGAATCCCTTCTGCAGCACC,CCCCGCACAACTCGTTGAGC --vcf_output --quantification_window_coordinates 89-95,104-109 --amplicon_coordinates chr1:1000,chr2:5000 -n vcf-multi-amplicon --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/vcf_multi_amplicon.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG,TACGGGTATTACCCGCGTTTAGTGGCTAGCGACTCGTGGACTTGCTGTACTGTCTACGGGCGTCAACTTGATAATCCCAAAAAAGCTTGGCCCCGCACAACTCGTTGAGCAATTCTTAAAAAGATGGTGTACGTCCCTCATACTTCGTATTCAATAAACCCGGTTAGACCATTGGGTGCGTGATGCTGCATTGCCTTGCA -an AMP1,AMP2 -g GGAATCCCTTCTGCAGCACC,CCCCGCACAACTCGTTGAGC --vcf_output --quantification_window_coordinates 89-95,104-109 --amplicon_coordinates chr1:1000,chr2:5000 -n vcf-multi-amplicon --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1430,14 +1430,15 @@ <h5>Allele Plots for AMP1</h5>
     
       
   
-<div id="fig_allele_table_around_cut_AMP1_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_AMP1_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.AMP1.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.pdf">
-            <img src="9.AMP1.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_AMP1_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC"></div>
+        <script type="text/javascript">const allele_table_9_AMP1_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC = {"plot_type": "allele_table", "reference": "CATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAG", "total_alleles": 19, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72Vvw7CIBDG36UzGAE1ruSGe4Hbmg4OOjn55/09ijU2QEAhtAz0cuV3H/cFxnEAS4jWEgAQASFYHjznIAFyjKOAFgfxQ6pRPDZb4d/H7XmeRAol61BaaAapGXQ5Xe8zKfibkqKCVJlKVcJLUt8kLixSaLhAQpOUsdSFpNekoNL3U7F7nnRc716cVGkJT9plSfXm8ySVI6ET1UWTa3OTPh2KSC00mRJSkz7pPOlj9Llj/zuiDNVLlDdFLWlfSuphc0fqtXs8sdWk/P3E38ECybNcRlIXkMlJ4kDrW2N6ARKYfD7gBwAA", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": ""}], "quantification_windows": [[17, 23]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="AMP1.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.txt">Allele frequency table</a></small></p>
@@ -1808,14 +1809,15 @@ <h5>Allele Plots for AMP2</h5>
     
       
   
-<div id="fig_allele_table_around_cut_AMP2_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_AMP2_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.AMP2.Alleles_frequency_table_around_sgRNA_CCCCGCACAACTCGTTGAGC.pdf">
-            <img src="9.AMP2.Alleles_frequency_table_around_sgRNA_CCCCGCACAACTCGTTGAGC.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_AMP2_Alleles_frequency_table_around_sgRNA_CCCCGCACAACTCGTTGAGC"></div>
+        <script type="text/javascript">const allele_table_9_AMP2_Alleles_frequency_table_around_sgRNA_CCCCGCACAACTCGTTGAGC = {"plot_type": "allele_table", "reference": "TGGCCCCGCACAACTCGTTGAGCAATTCTTAAAAAGATGG", "total_alleles": 11, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA72RvQ7CMAyE36VzDjWA2C0PfgFvUQcGmJj4eX+SVJWoEtOgijrJEOniL3cOoVMRjiVMTMTKoioUb6TKqpRKKIo694P02Me96924nvfXZXChK56ziSqksKTe+Qzy8VzPt0edJP8ilZlgfXwjyefwvpAUm5EEm5GIy/cWCTVp45zSRwGs93Ro8FRpYJCAmnTytF8mSUqQPluYnpBrLp1IpyVSLRPLE7XNaXgDuu+apJAEAAA=", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": ""}], "quantification_windows": [[17, 22]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA CCCCGCACAACTCGTTGAGC. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA CCCCGCACAACTCGTTGAGC. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="AMP2.Alleles_frequency_table_around_sgRNA_CCCCGCACAACTCGTTGAGC.txt">Allele frequency table</a></small></p>
@@ -2285,7 +2287,749 @@ <h5>Allele Plots for AMP2</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
+
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
 
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_AMP1_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC") && typeof allele_table_9_AMP1_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC !== "undefined") {
+      await buildAlleleTable(allele_table_9_AMP1_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC, "allele_table_9_AMP1_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_AMP1_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    }
+    
+    if (document.getElementById("allele_table_9_AMP2_Alleles_frequency_table_around_sgRNA_CCCCGCACAACTCGTTGAGC") && typeof allele_table_9_AMP2_Alleles_frequency_table_around_sgRNA_CCCCGCACAACTCGTTGAGC !== "undefined") {
+      await buildAlleleTable(allele_table_9_AMP2_Alleles_frequency_table_around_sgRNA_CCCCGCACAACTCGTTGAGC, "allele_table_9_AMP2_Alleles_frequency_table_around_sgRNA_CCCCGCACAACTCGTTGAGC")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_AMP2_Alleles_frequency_table_around_sgRNA_CCCCGCACAACTCGTTGAGC")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-no-edits/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-no-edits/CRISPResso2_report.html
index cd74b51e..08ade81b 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-no-edits/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-no-edits/CRISPResso2_report.html
@@ -801,12 +801,12 @@ <h5 class="text-center mb-3">vcf-no-edits</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:44:07</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:50:59</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>GGAATCCCTTCTGCAGCACC</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/vcf_no_edits.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC --vcf_output --amplicon_coordinates FANC:1 -n vcf-no-edits --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/vcf_no_edits.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC --vcf_output --amplicon_coordinates FANC:1 -n vcf-no-edits --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1391,14 +1391,15 @@ <h5 class="text-center mb-3">vcf-no-edits</h5>
     
       
   
-<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.pdf">
-            <img src="9.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC"></div>
+        <script type="text/javascript">const allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC = {"plot_type": "allele_table", "reference": "CATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAG", "total_alleles": 7, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA4uOVnJ2DHF3d3QMcXZ2DglxDnF3dgQiIBsoGOLsDhQDijq7O7or6ZCg1NIEiPQMdCCwpKg0NVYHZJUjDv0h5FtlqGOIxSJn6vsJu0Uw3Y70sgifbmeaWBRCRR8Z6qQl5hRj2hRCq7CLBQDSxGi44wIAAA==", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": ""}], "quantification_windows": [[19, 20]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.txt">Allele frequency table</a></small></p>
@@ -1852,7 +1853,743 @@ <h5 class="text-center mb-3">vcf-no-edits</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
 
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
+
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC") && typeof allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC !== "undefined") {
+      await buildAlleleTable(allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC, "allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>
 
 
       
diff --git a/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-prime-edit-basic/CRISPResso2_report.html b/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-prime-edit-basic/CRISPResso2_report.html
index 61d7158d..76c94ce8 100644
--- a/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-prime-edit-basic/CRISPResso2_report.html
+++ b/cli_integration_tests/expected_results_pro/CRISPResso_on_vcf-prime-edit-basic/CRISPResso2_report.html
@@ -805,12 +805,12 @@ <h5 class="text-center mb-3">vcf-prime-edit-basic</h5>
   
 <div class="text-start screen-only" id="log_params">
   <p><strong>CRISPResso version:</strong> 2.3.4</p>
-  <p><strong>Run completed:</strong> 2026-06-09 16:44:47</p>
+  <p><strong>Run completed:</strong> 2026-08-07 17:50:16</p>
   <p><strong>Amplicon sequence:</strong> <pre class='pre-scrollable'>CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG</pre></p>
   
     <p><strong>Guide sequence:</strong> <pre class='pre-scrollable'>GGAATCCCTTCTGCAGCACC</pre></p>
   
-  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/Users/mckaybowcut/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/vcf_prime_edit_basic.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC --prime_editing_pegRNA_spacer_seq GGAATCCCTTCTGCAGCACC --prime_editing_pegRNA_extension_seq ATCTGGATCGGCTGCAGAAGGGA --vcf_output --amplicon_coordinates FANC:1,FANC_PE:1 -n vcf-prime-edit-basic --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
+  <p><strong>Command used:</strong> <pre class='pre-scrollable'>/mnt/c/Users/Snic9/Edilytics/CRISPResso2/.pixi/envs/test-pro/bin/CRISPResso -r1 inputs/vcf_prime_edit_basic.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC --prime_editing_pegRNA_spacer_seq GGAATCCCTTCTGCAGCACC --prime_editing_pegRNA_extension_seq ATCTGGATCGGCTGCAGAAGGGA --vcf_output --amplicon_coordinates FANC:1,FANC_PE:1 -n vcf-prime-edit-basic --place_report_in_output_folder --halt_on_plot_fail --debug</pre></p>
   <p><strong>Parameters:</strong> <pre class='pre-scrollable'>allele_plot_pcts_only_for_assigned_reference: False
 aln_seed_count: 5
 aln_seed_len: 10
@@ -1469,14 +1469,15 @@ <h5>Allele Plots for Reference</h5>
       
         
   
-<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Reference.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.pdf">
-            <img src="9.Reference.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Reference_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC"></div>
+        <script type="text/javascript">const allele_table_9_Reference_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC = {"plot_type": "allele_table", "reference": "CATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAG", "total_alleles": 11, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA7XUOwrDMAwG4LtktkrtQKGj+AddQFvI0KGdOvVx/yptAwHbcROn2IMRkj+QH13XgFWEWQGoQgVs09YWVIjFLAphadyC1MPR5m7vPuNxe557l6aIqI4KLhjUvqHL6XrPSkPZBtIw/Lw0KedVknd+sfQtx1pp/pgYUte8XyHL3goq9A4ab5CRiFKpoxRKN88WUX1WokTqKLUFSasfbrp7+MMXEV2I/gWA6vl5jQQAAA==", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": ""}, {"interval": [7, 29], "name": "PE Extension"}, {"interval": [3, 22], "name": "PE spacer sgRNA"}], "quantification_windows": [[19, 20], [25, 34]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the sgRNA GGAATCCCTTCTGCAGCACC. Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Reference.Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC.txt">Allele frequency table</a></small></p>
@@ -1486,14 +1487,15 @@ <h5>Allele Plots for Reference</h5>
       
         
   
-<div id="fig_allele_table_around_cut_Reference_sg1" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg1" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Reference.Alleles_frequency_table_around_PE_Extension.pdf">
-            <img src="9.Reference.Alleles_frequency_table_around_PE_Extension.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Reference_Alleles_frequency_table_around_PE_Extension"></div>
+        <script type="text/javascript">const allele_table_9_Reference_Alleles_frequency_table_around_PE_Extension = {"plot_type": "allele_table", "reference": "CTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGG", "total_alleles": 10, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA62TMQ6DMAxF78LsVCQMnS0PvoA3xMDQTp1Ke3+cICBCKQVh2UPkfOvpO3HbViRCwoSapAdGIdaaVomRp1sm5gpOSO+15q2GKT7v76ODHOWcs0IFCApqEujZv4YNKbaZkmL4nJR6VXZgfLP3f1IPPpGasqesHS96mkkbT7/b6Tqp9CGQ2OqZ9kGqtgeVZieG61QkLY52SRJJ69odJYXl53UjrM/yWyQEAAA=", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [-7, 12], "name": ""}, {"interval": [-3, 19], "name": "PE Extension"}, {"interval": [-7, 12], "name": "PE spacer sgRNA"}], "quantification_windows": [[9, 10], [15, 24]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the PE Extension (ATCTGGATCGGCTGCAGAAGGGA). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the PE Extension (ATCTGGATCGGCTGCAGAAGGGA). Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Reference.Alleles_frequency_table_around_PE_Extension.txt">Allele frequency table</a></small></p>
@@ -1503,14 +1505,15 @@ <h5>Allele Plots for Reference</h5>
       
         
   
-<div id="fig_allele_table_around_cut_Reference_sg2" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Reference_sg2" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Reference.Alleles_frequency_table_around_PE_spacer_sgRNA.pdf">
-            <img src="9.Reference.Alleles_frequency_table_around_PE_spacer_sgRNA.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Reference_Alleles_frequency_table_around_PE_spacer_sgRNA"></div>
+        <script type="text/javascript">const allele_table_9_Reference_Alleles_frequency_table_around_PE_spacer_sgRNA = {"plot_type": "allele_table", "reference": "CATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAG", "total_alleles": 11, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA7XUOwrDMAwG4LtktkrtQKGj+AddQFvI0KGdOvVx/yptAwHbcROn2IMRkj+QH13XgFWEWQGoQgVs09YWVIjFLAphadyC1MPR5m7vPuNxe557l6aIqI4KLhjUvqHL6XrPSkPZBtIw/Lw0KedVknd+sfQtx1pp/pgYUte8XyHL3goq9A4ab5CRiFKpoxRKN88WUX1WokTqKLUFSasfbrp7+MMXEV2I/gWA6vl5jQQAAA==", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [3, 22], "name": ""}, {"interval": [7, 29], "name": "PE Extension"}, {"interval": [3, 22], "name": "PE spacer sgRNA"}], "quantification_windows": [[19, 20], [25, 34]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the PE spacer sgRNA (GGAATCCCTTCTGCAGCACC). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the PE spacer sgRNA (GGAATCCCTTCTGCAGCACC). Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Reference.Alleles_frequency_table_around_PE_spacer_sgRNA.txt">Allele frequency table</a></small></p>
@@ -1996,14 +1999,15 @@ <h5>Allele Plots for Prime-edited</h5>
       
         
   
-<div id="fig_allele_table_around_cut_Prime-edited_sg0" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Prime-edited_sg0" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Prime-edited.Alleles_frequency_table_around_PE_Extension.pdf">
-            <img src="9.Prime-edited.Alleles_frequency_table_around_PE_Extension.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_Extension"></div>
+        <script type="text/javascript">const allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_Extension = {"plot_type": "allele_table", "reference": "CTTCTGCAGCCGATCCAGATCTTTTCCGAGCTTCTGGCGG", "total_alleles": 6, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA63SMQ6DMAwF0LswOxUJJ7D+8C/gDTF0aKdObbk/BpKqolQF0SSyEsXWi6W0bQUzGKEEqAbfeDQf45nzLUFWsiM1Nr5Otczzee8vnaxQBh6mkqQMNXI93x5ZwqI8hONNSXQpTdab9FH+Lyn+lIxjuU7VHlU94osUVkaRvKt9VH72FuqVWij/G4XqBnyIPOOAAgAA", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [-3, 19], "name": "PE Extension"}, {"interval": [-7, 12], "name": "PE spacer sgRNA"}], "quantification_windows": [[9, 10], [15, 24]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the PE Extension (ATCTGGATCGGCTGCAGAAGGGA). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the PE Extension (ATCTGGATCGGCTGCAGAAGGGA). Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Prime-edited.Alleles_frequency_table_around_PE_Extension.txt">Allele frequency table</a></small></p>
@@ -2013,14 +2017,15 @@ <h5>Allele Plots for Prime-edited</h5>
       
         
   
-<div id="fig_allele_table_around_cut_Prime-edited_sg1" class="d-flex flex-column align-items-center mb-3">
+
+<div id="fig_allele_table_around_cut_Prime-edited_sg1" class="d-flex flex-column align-items-center mb-3 w-100">
     
-        <a href="9.Prime-edited.Alleles_frequency_table_around_PE_spacer_sgRNA.pdf">
-            <img src="9.Prime-edited.Alleles_frequency_table_around_PE_spacer_sgRNA.png" width="100%">
-        </a>
+        
+        <div class="w-100" id="allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_spacer_sgRNA"></div>
+        <script type="text/javascript">const allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_spacer_sgRNA = {"plot_type": "allele_table", "reference": "CATGGAATCCCTTCTGCAGCCGATCCAGATCTTTTCCGAG", "total_alleles": 6, "schema": ["aligned_sequence", "reference_sequence", "reads", "pct", "n_deleted", "n_inserted", "n_mutated", "unedited"], "alleles_b64gz": "H4sIAAAAAAACA4uOVnJ2DHF3d3QMcXZ2DglxDnF3dnR3dnYH8R1BZAgQgPjuSjokKDU0BiI9Ax0ILCkqTY3VwWtViLM7mVYZ6RhBLTLWSUvMKcawyRlNu64uuZ7SMQTaZAS2C6tNGNops8mQBJtC3EHagQx3Z4I26cIBzCYDUITRyyojhK9iAeuLslqAAgAA", "custom_colors": {"Substitution": "#0000FF", "Insertion": "#008000", "Deletion": "#FF0000", "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99", "N": "#C8C8C8", "-": "#1E1E1E", "amino_acid_scheme": "unique"}, "sgRNAs": [{"interval": [7, 29], "name": "PE Extension"}, {"interval": [3, 22], "name": "PE spacer sgRNA"}], "quantification_windows": [[19, 20], [25, 34]]};</script>
     
     
-    <label class="labelpadding">Figure 9: Visualization of the distribution of identified alleles around the cleavage site for the PE spacer sgRNA (GGAATCCCTTCTGCAGCACC). Nucleotides are indicated by unique colors (A = green; C = red; G = yellow; T = purple). Substitutions are shown in bold font. Red rectangles highlight inserted sequences. Horizontal dashed lines indicate deleted sequences. The vertical dashed line indicates the predicted cleavage site.</label>
+    <label class="labelpadding">Figure 9: Interactive visualization of the distribution of identified alleles around the cleavage site for the PE spacer sgRNA (GGAATCCCTTCTGCAGCACC). Nucleotides are indicated by unique colors (A = green; C = orange; G = yellow; T = purple). Bases matching the reference are faded and unlabelled, so only differences are highlighted. Dark cells indicate deleted sequences, and a green rule beneath a position indicates an inserted sequence. The dashed rectangle indicates the quantification window. Alleles are sorted by frequency and only the most frequent matches are drawn, but the search box filters every allele in the table -- by sequence motif, which also matches across deletion gaps, or by edit class.</label>
     
     
         <p class="m-0"><small>Data: <a href="Prime-edited.Alleles_frequency_table_around_PE_spacer_sgRNA.txt">Allele frequency table</a></small></p>
@@ -2588,7 +2593,767 @@ <h5>Prime Editing for Prime-edited</h5>
     }, 100); // Delay of 100 ms to allow javascript to rerender loading message to dom before rendering D3 plot
 
 </script>
+<style>
+  /* Scoped to the widget so nothing here leaks into the rest of the report. */
+  .allele-viz {
+    /* chart roles -- resolved once here so the body is written against roles */
+    --allele-surface: #fcfcfb;
+    --allele-ink: #0b0b0b;
+    --allele-ink-2: #52514e;
+    --allele-muted: #898781;
+    --allele-hairline: #e1e0d9;
+    --allele-accent: #2a78d6;   /* single-hue magnitude bar */
+    position: relative;   /* the tooltip is positioned against this box */
+    text-align: left;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    padding: 8px 4px 4px 4px;
+  }
+  .allele-viz .allele-controls {
+    display: flex;
+    flex-wrap: wrap;
+    align-items: center;
+    gap: 12px;
+    margin-bottom: 6px;
+  }
+  .allele-viz .allele-search {
+    font-family: ui-monospace, SFMono-Regular, Menlo, Consolas, monospace;
+    font-size: 0.8rem;
+    padding: 4px 8px;
+    min-width: 260px;
+    color: var(--allele-ink);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+  }
+  .allele-viz .allele-search:focus { outline: 2px solid var(--allele-accent); outline-offset: 1px; }
+  .allele-viz .allele-classes { display: flex; flex-wrap: wrap; align-items: center; gap: 10px; }
+  .allele-viz .allele-classes label {
+    font-size: 0.75rem;
+    font-weight: 400;
+    color: var(--allele-ink-2);
+    margin: 0;
+    display: inline-flex;
+    align-items: center;
+    gap: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-clear {
+    font-size: 0.75rem;
+    padding: 4px 10px;
+    color: var(--allele-ink-2);
+    background: var(--allele-surface);
+    border: 1px solid var(--allele-hairline);
+    border-radius: 4px;
+    cursor: pointer;
+  }
+  .allele-viz .allele-status {
+    font-size: 0.75rem;
+    color: var(--allele-ink-2);
+    font-variant-numeric: tabular-nums;
+    margin-bottom: 4px;
+  }
+  /* plot column + legend column pinned to the right */
+  .allele-viz .allele-shell { display: flex; align-items: flex-start; gap: 12px; }
+  .allele-viz .allele-main { flex: 1 1 auto; min-width: 0; }
+  /* Legend mirrors figure 2b's (partials/batch_d3.html): the caption sits
+     inside its own color chip, stacked vertically and sticky beside the table. */
+  .allele-viz .allele-legend {
+    flex: 0 0 auto;
+    width: 12%;
+    min-width: 96px;
+    position: sticky;
+    top: 0;
+    display: flex;
+    flex-direction: column;
+    align-items: center;
+    gap: 3px;
+  }
+  .allele-viz .allele-legend-title { font-size: 0.9rem; margin: 0 0 4px; }
+  .allele-viz .allele-legend-chip {
+    width: 75%;
+    text-align: center;
+    font-size: 0.7rem;
+    line-height: 1.35;
+  }
+  /* 2b marks the quantification window with a dashed outline rather than a fill;
+     scoped here so it does not depend on batch_d3.html being on the page. */
+  .allele-viz .allele-legend-chip--qw {
+    background-image: url("data:image/svg+xml,%3csvg width='100%25' height='100%25' xmlns='http://www.w3.org/2000/svg'%3e%3crect width='100%25' height='100%25' fill='none' stroke='%23D9D9D9FF' stroke-width='4' stroke-dasharray='6%2c14' stroke-dashoffset='0' stroke-linecap='square'/%3e%3c/svg%3e");
+  }
+  /* center the table when the container is wider than it is */
+  .allele-viz .allele-head > svg,
+  .allele-viz .allele-plot { margin-left: auto; margin-right: auto; }
+  .allele-viz .allele-head { overflow: hidden; }
+  .allele-viz .allele-body { overflow: auto; max-height: 60vh; }
+  .allele-viz .allele-empty,
+  .allele-viz .allele-error {
+    font-size: 0.8rem;
+    color: var(--allele-ink-2);
+    padding: 12px 4px;
+  }
+  .allele-viz .allele-error { color: #d03b3b; }
+  /* the sequence grid is one <canvas>: 200 rows x N nucleotides is tens of
+     thousands of marks, and rebuilding that many SVG nodes per keystroke is
+     what made filtering feel slow. The numeric columns stay SVG so their
+     tabular figures keep aligning and stay vector for print. */
+  .allele-viz .allele-plot { position: relative; }
+  .allele-viz .allele-canvas { position: absolute; left: 0; top: 0; }
+  .allele-viz .allele-cols {
+    position: absolute;
+    left: 0;
+    top: 0;
+    pointer-events: none;  /* the plot div owns hit-testing, via x/y math */
+  }
+  .allele-viz .allele-row-hover {
+    position: absolute;
+    left: 0;
+    background: rgba(11, 11, 11, 0.06);
+    pointer-events: none;
+    display: none;
+  }
+  .allele-viz .allele-tooltip {
+    position: absolute;
+    z-index: 10;
+    visibility: hidden;
+    pointer-events: none;
+    background: #fcfcfb;
+    border: 1px solid rgba(11, 11, 11, 0.10);
+    border-radius: 5px;
+    padding: 6px 8px;
+    font-family: system-ui, -apple-system, "Segoe UI", sans-serif;
+    font-size: 0.72rem;
+    color: #52514e;
+    box-shadow: 0 1px 4px rgba(11, 11, 11, 0.12);
+  }
+  .allele-viz .allele-tooltip .allele-tip-value {
+    color: #0b0b0b;
+    font-weight: 600;
+    font-variant-numeric: tabular-nums;
+  }
+</style>
+
+<script type="text/javascript">
+/* Pure search/filter helpers for the D3 allele frequency table.
+ *
+ * No D3, no DOM: this file is inlined into the report by allele_d3.html and
+ * required directly by allele_search_filter.test.js under node.
+ */
+
+var ALLELE_EDIT_CLASSES = ['insertion', 'deletion', 'substitution', 'unedited'];
+
+function ungapSequence(seq) {
+  return (seq || '').replace(/-/g, '');
+}
+
+/* Case-insensitive substring search against BOTH the gapped aligned sequence
+ * and its ungapped form, so a plain motif still matches across a deletion. */
+function alleleMatchesQuery(allele, query) {
+  if (query == null) return true;
+  var q = String(query).trim().toUpperCase();
+  if (q === '') return true;
+
+  var gapped = (allele.aligned_sequence || '').toUpperCase();
+  if (gapped.indexOf(q) !== -1) return true;
+
+  // ungapped_sequence is precomputed by decodeAlleles; recompute only as a fallback
+  var ungapped = allele.ungapped_sequence != null
+    ? allele.ungapped_sequence
+    : ungapSequence(allele.aligned_sequence);
+  return ungapped.toUpperCase().indexOf(q) !== -1;
+}
+
+/* OR within the selected classes; an empty selection filters nothing. */
+function alleleMatchesEditClasses(allele, editClasses) {
+  if (!editClasses) return true;
+  var selected = editClasses instanceof Set ? editClasses : new Set(editClasses);
+  if (selected.size === 0) return true;
 
+  if (selected.has('insertion') && allele.n_inserted > 0) return true;
+  if (selected.has('deletion') && allele.n_deleted > 0) return true;
+  if (selected.has('substitution') && allele.n_mutated > 0) return true;
+  if (selected.has('unedited') && !!allele.unedited) return true;
+  return false;
+}
+
+function filterAlleles(alleles, query, editClasses) {
+  return (alleles || []).filter(function (allele) {
+    return alleleMatchesQuery(allele, query) && alleleMatchesEditClasses(allele, editClasses);
+  });
+}
+
+function _base64ToBytes(b64) {
+  var binary = atob(b64);
+  var bytes = new Uint8Array(binary.length);
+  for (var i = 0; i < binary.length; i++) {
+    bytes[i] = binary.charCodeAt(i);
+  }
+  return bytes;
+}
+
+/* base64 -> gzip -> row arrays -> objects keyed by payload.schema.
+ * Requires DecompressionStream (Chrome 80+, Firefox 113+, Safari 16.4+). */
+async function decodeAlleles(payload) {
+  var schema = payload.schema;
+  var stream = new DecompressionStream('gzip');
+  var writer = stream.writable.getWriter();
+  var swallow = function () { /* the read side below surfaces the real error */ };
+  writer.write(_base64ToBytes(payload.alleles_b64gz)).catch(swallow);
+  writer.close().catch(swallow);
+  var rows = JSON.parse(await new Response(stream.readable).text());
+
+  return rows.map(function (row) {
+    var allele = {};
+    for (var i = 0; i < schema.length; i++) {
+      allele[schema[i]] = row[i];
+    }
+    // precomputed once here -- doing this per keystroke is the one real hot spot
+    allele.ungapped_sequence = ungapSequence(allele.aligned_sequence);
+    return allele;
+  });
+}
+
+if (typeof module !== 'undefined' && module.exports) {
+  module.exports = {
+    ALLELE_EDIT_CLASSES: ALLELE_EDIT_CLASSES,
+    ungapSequence: ungapSequence,
+    alleleMatchesQuery: alleleMatchesQuery,
+    alleleMatchesEditClasses: alleleMatchesEditClasses,
+    filterAlleles: filterAlleles,
+    decodeAlleles: decodeAlleles,
+  };
+}
+
+  /* Searchable allele frequency table.
+   *
+   * Every piece of state lives in this closure, keyed to one slug, so multiple
+   * sgRNA windows on one report never share a search box or a filter set.
+   */
+  const buildAlleleTable = async (data, slug) => {
+    const K = 200;                 // rows rendered per filter pass
+    const DEBOUNCE_MS = 40;        // input -> re-render; enough to coalesce a fast typist's burst,
+                                   // low enough to feel live now the redraw is ~20ms, not ~190ms
+    const CELL_W = 10;
+    const CELL_H = 13;
+    const ROW_PITCH = 15;          // 2px surface gap between rows
+    const BAR_W = 64;
+    const BAR_H = 7;
+
+    const container = document.getElementById(slug);
+    if (!container) return;
+
+    const root = d3.select(container).classed("allele-viz", true);
+    root.html("");
+
+    // ---- palette ---------------------------------------------------------
+    // Nucleotide hues are domain-fixed (CRISPResso convention, overridable via
+    // --custom_colors) so the table matches every other figure in the report.
+    // They fail the categorical lightness/chroma checks, so identity never rests
+    // on hue alone: every edited cell carries its base letter and the legend and
+    // numeric columns are always on screen.
+    const fallbackColors = {
+      "A": "#7FC97F", "T": "#BEAED4", "C": "#FDC086", "G": "#FFFF99",
+      "N": "#C8C8C8", "-": "#1E1E1E", "Insertion": "#008000",
+    };
+    const custom = data.custom_colors || {};
+    const color = {};
+    Object.keys(fallbackColors).forEach((key) => {
+      color[key] = custom[key] || fallbackColors[key];
+    });
+    const baseColor = (base) => color[base] || color["N"];
+
+    const inkOn = (hex) => {
+      const rgb = [1, 3, 5].map((i) => parseInt(hex.substr(i, 2), 16) / 255)
+        .map((c) => (c <= 0.03928 ? c / 12.92 : Math.pow((c + 0.055) / 1.055, 2.4)));
+      const lum = (0.2126 * rgb[0]) + (0.7152 * rgb[1]) + (0.0722 * rgb[2]);
+      return lum < 0.4 ? "#ffffff" : "#0b0b0b";
+    };
+
+    // The "matches reference" wash was fill-opacity 0.15. On canvas, per-mark
+    // alpha means a globalAlpha flip per cell -- a state change on every one of
+    // tens of thousands of marks. Pre-blending against the opaque surface gives
+    // a pixel-identical result with one cached fillStyle per base instead.
+    const SURFACE = (getComputedStyle(root.node())
+      .getPropertyValue("--allele-surface") || "").trim() || "#fcfcfb";
+    const mix = (hex, onto, t) => {
+      const parse = (h) => [1, 3, 5].map((i) => parseInt(h.substr(i, 2), 16));
+      const fg = parse(hex);
+      const bg = parse(onto);
+      return "#" + fg.map((v, i) => Math.round((v * t) + (bg[i] * (1 - t)))
+        .toString(16).padStart(2, "0")).join("");
+    };
+    const fadedCache = {};
+    const fadedColor = (base) => {
+      const hex = baseColor(base);
+      if (!(hex in fadedCache)) fadedCache[hex] = mix(hex, SURFACE, 0.15);
+      return fadedCache[hex];
+    };
+    const inkCache = {};
+    const inkOnCached = (hex) => {
+      if (!(hex in inkCache)) inkCache[hex] = inkOn(hex);
+      return inkCache[hex];
+    };
+
+    // ---- geometry --------------------------------------------------------
+    const reference = data.reference || "";
+    const seqLength = reference.length;
+    const seqW = seqLength * CELL_W;
+    const barX = seqW + 16;
+    const pctX = barX + BAR_W + 8;
+    const readsX = pctX + 68;      // right edge of the #Reads column
+    const totalW = readsX + 8;
+
+    const sgRNAs = (data.sgRNAs || []).filter(
+      (d) => d.interval && d.interval[1] >= 0 && d.interval[0] < seqLength,
+    );
+    // keep windows with at least one end inside the plotted slice; the draw
+    // below clamps the far edge so a window running off-window still reads
+    const quantWindows = (data.quantification_windows || []).filter(
+      (d) => d && d.length === 2 && d[1] >= 0 && d[0] < seqLength,
+    );
+    const tickH = 12;
+    const guideH = sgRNAs.length > 0 ? 12 : 0;
+    const headH = tickH + guideH + ROW_PITCH + 2;
+
+    // ---- chrome ----------------------------------------------------------
+    const shell = root.append("div").attr("class", "allele-shell");
+    const main = shell.append("div").attr("class", "allele-main");
+    const controls = main.append("div").attr("class", "allele-controls");
+    const status = main.append("div").attr("class", "allele-status").text("Loading alleles…");
+    const head = main.append("div").attr("class", "allele-head");
+    const body = main.append("div").attr("class", "allele-body");
+    const legend = shell.append("div").attr("class", "allele-legend");
+    // tooltip stays on root: it is positioned against that box, not the shell
+    const tooltip = root.append("div").attr("class", "allele-tooltip");
+    const tipHead = tooltip.append("div").attr("class", "allele-tip-value");
+    const tipBody = tooltip.append("div");
+
+    let alleles;
+    try {
+      alleles = await decodeAlleles(data);
+    } catch (err) {
+      console.error("Allele table decode failed for " + slug, err);
+      status.remove();
+      legend.remove();
+      head.remove();
+      body.remove();
+      root.append("div")
+        .attr("class", "allele-error")
+        .text(
+          "This allele table could not be decoded. It needs a browser with gzip "
+          + "DecompressionStream support (Chrome 80+, Firefox 113+, Safari 16.4+). "
+          + "The allele frequency data is still available in the linked data file below.",
+        );
+      controls.remove();
+      return;
+    }
+
+    // stable magnitude scale: the bar does not rescale when the filter changes
+    const maxPct = d3.max(alleles, (d) => d.pct) || 1;
+    const pctScale = d3.scaleLinear().domain([0, maxPct]).range([0, BAR_W]);
+
+    // ---- controls --------------------------------------------------------
+    const searchId = slug + "_query";
+    controls.append("label")
+      .attr("for", searchId)
+      .style("font-size", "0.75rem")
+      .style("font-weight", "400")
+      .style("margin", "0")
+      .style("color", "var(--allele-ink-2)")
+      .text("Search sequence");
+    const search = controls.append("input")
+      .attr("class", "allele-search")
+      .attr("type", "search")
+      .attr("id", searchId)
+      .attr("placeholder", "e.g. CTGCAGCACC");
+
+    const classBox = controls.append("div").attr("class", "allele-classes");
+    const classLabels = {
+      insertion: "Insertions", deletion: "Deletions",
+      substitution: "Substitutions", unedited: "Unedited",
+    };
+    const selectedClasses = new Set();
+    ALLELE_EDIT_CLASSES.forEach((cls) => {
+      const boxId = slug + "_class_" + cls;
+      const label = classBox.append("label").attr("for", boxId);
+      label.append("input")
+        .attr("type", "checkbox")
+        .attr("id", boxId)
+        .attr("value", cls)
+        .on("change", function () {
+          if (this.checked) {
+            selectedClasses.add(cls);
+          } else {
+            selectedClasses.delete(cls);
+          }
+          render();
+        });
+      label.append("span").text(classLabels[cls]);
+    });
+
+    controls.append("button")
+      .attr("class", "allele-clear")
+      .attr("type", "button")
+      .text("Clear")
+      .on("click", () => {
+        search.property("value", "");
+        selectedClasses.clear();
+        classBox.selectAll("input").property("checked", false);
+        render();
+      });
+
+    let debounceTimer = null;
+    search.on("input", () => {
+      if (debounceTimer) clearTimeout(debounceTimer);
+      debounceTimer = setTimeout(render, DEBOUNCE_MS);
+    });
+
+    // ---- legend ----------------------------------------------------------
+    // Each caption rides inside its own color chip, as figure 2b does. For a
+    // base the caption is just the letter; the rest spell the class out.
+    const legendItems = ["A", "C", "G", "T", "N"].map((base) => ({
+      label: base, fill: baseColor(base),
+    }));
+    legendItems.push({ label: "Deletion", fill: color["-"] });
+    legendItems.push({ label: "Insertion", fill: color["Insertion"] });
+    // The grid washes matched bases out; a pre-blended tint keeps the caption
+    // readable where a low opacity would have faded the text with it.
+    legendItems.push({ label: "Matches reference", fill: "#f0f0ee", muted: true });
+    if (quantWindows.length > 0) {
+      legendItems.push({ label: "Quantification Window", qw: true });
+    }
+
+    legend.append("h5").attr("class", "allele-legend-title").text("Legend");
+    legendItems.forEach((item) => {
+      const chip = legend.append("div")
+        .attr("class", "allele-legend-chip")
+        .classed("allele-legend-chip--qw", !!item.qw)
+        .text(item.label);
+      if (item.qw) return;
+      chip.style("background-color", item.fill)
+        .style("color", item.muted ? "var(--allele-ink-2)" : inkOn(item.fill));
+    });
+
+    // ---- header: position ruler, sgRNA band, reference row ---------------
+    const headSvg = head.append("svg")
+      .attr("width", totalW)
+      .attr("height", headH)
+      .style("display", "block")
+      .style("user-select", "none");
+
+    // position ruler -- carries the values a tooltip would otherwise gate
+    const tickStep = seqLength > 120 ? 20 : 10;
+    for (let i = 0; i < seqLength; i += tickStep) {
+      headSvg.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", 9)
+        .attr("text-anchor", "middle")
+        .style("font-size", "7px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-muted)")
+        .text(i + 1);
+    }
+    headSvg.append("text")
+      .attr("x", barX)
+      .attr("y", 9)
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("%Reads");
+    headSvg.append("text")
+      .attr("x", readsX)
+      .attr("y", 9)
+      .attr("text-anchor", "end")
+      .style("font-size", "9px")
+      .style("fill", "var(--allele-muted)")
+      .text("#Reads");
+
+    if (sgRNAs.length > 0) {
+      const guides = headSvg.append("g").attr("transform", "translate(0," + tickH + ")");
+      sgRNAs.forEach((guide) => {
+        const start = Math.max(guide.interval[0], 0);
+        const end = Math.min(guide.interval[1], seqLength - 1);
+        const width = Math.max((end - start + 1) * CELL_W, CELL_W);
+        const guideGroup = guides.append("g");
+        guideGroup.append("rect")
+          .attr("x", start * CELL_W)
+          .attr("y", 0)
+          .attr("width", width)
+          .attr("height", 10)
+          .style("fill", "#D9D9D9");
+        guideGroup.append("text")
+          .attr("x", (start * CELL_W) + 3)
+          .attr("y", 8)
+          .style("font-size", "7px")
+          .style("fill", "var(--allele-ink-2)")
+          .text(guide.name ? guide.name : "sgRNA");
+      });
+    }
+
+    // reference row -- fully inked, and sticky above the scrolling rows, so a
+    // de-emphasized cell below is always readable against it
+    const refRow = headSvg.append("g")
+      .attr("transform", "translate(0," + (tickH + guideH) + ")");
+    for (let i = 0; i < seqLength; i++) {
+      const base = reference[i];
+      refRow.append("rect")
+        .attr("x", i * CELL_W)
+        .attr("y", 0)
+        .attr("width", CELL_W)
+        .attr("height", CELL_H)
+        .style("fill", baseColor(base));
+      refRow.append("text")
+        .attr("x", (i * CELL_W) + (CELL_W / 2))
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "middle")
+        .style("font-family", "ui-monospace, SFMono-Regular, Menlo, Consolas, monospace")
+        .style("font-size", "8px")
+        .style("fill", inkOn(baseColor(base)))
+        .text(base);
+    }
+    refRow.append("text")
+      .attr("x", barX)
+      .attr("y", CELL_H - 3)
+      .style("font-size", "8px")
+      .style("fill", "var(--allele-ink-2)")
+      .text("Reference");
+
+    /* Quantification window: bracket the columns it covers, drawn last so it
+       sits above the ruler, the guide band and the reference row. It lives in
+       the header because the header is built once and stays put while the rows
+       scroll -- the window applies to every row, so marking the columns is
+       enough, and it costs nothing on the filter path. */
+    headSvg.selectAll("rect.allele-qw")
+      .data(quantWindows)
+      .enter()
+      .append("rect")
+      .attr("class", "allele-qw")
+      .attr("x", (d) => Math.max(d[0], 0) * CELL_W)
+      .attr("y", 0.5)
+      .attr("width", (d) => (
+        (Math.min(d[1], seqLength - 1) - Math.max(d[0], 0) + 1) * CELL_W
+      ))
+      .attr("height", headH - 1)
+      .style("fill", "none")
+      .style("stroke", "#8a8880")
+      .style("stroke-dasharray", "4,3")
+      .style("stroke-width", 1);
+
+    // ---- body ------------------------------------------------------------
+    // canvas for the nucleotide grid, SVG for the numeric columns on top of it
+    const plot = body.append("div")
+      .attr("class", "allele-plot")
+      .style("width", totalW + "px");
+    const canvas = plot.append("canvas").attr("class", "allele-canvas").node();
+    const ctx = canvas.getContext("2d");
+    const colsSvg = plot.append("svg")
+      .attr("class", "allele-cols")
+      .attr("width", totalW)
+      .style("user-select", "none");
+    const rowHover = plot.append("div")
+      .attr("class", "allele-row-hover")
+      .style("width", totalW + "px")
+      .style("height", ROW_PITCH + "px");
+
+    // keep the sticky reference row aligned with the horizontally scrolled rows
+    body.node().addEventListener("scroll", () => {
+      head.node().scrollLeft = body.node().scrollLeft;
+    }, { passive: true });
+
+    const emptyState = main.append("div")
+      .attr("class", "allele-empty")
+      .style("display", "none")
+      .text("No alleles match your search.");
+
+    let shown = [];  // rows currently painted; hit-testing reads this
+
+    const showTip = function (allele, index, evt) {
+      const base = allele.aligned_sequence[index];
+      const refBase = (allele.reference_sequence || "")[index];
+      tipHead.text(allele.pct.toFixed(2) + "% · " + allele.reads.toLocaleString() + " reads");
+      tipBody.text(
+        "Position " + (index + 1) + " · allele " + base + " / reference "
+        + (refBase === undefined ? "?" : refBase)
+        + " · " + allele.n_inserted + "I " + allele.n_deleted + "D " + allele.n_mutated + "S",
+      );
+      const bounds = container.getBoundingClientRect();
+      tooltip
+        .style("left", (evt.clientX - bounds.left + 12) + "px")
+        .style("top", (evt.clientY - bounds.top + 12) + "px")
+        .style("visibility", "visible");
+    };
+    const hideTip = () => tooltip.style("visibility", "hidden");
+
+    /* The nucleotide grid: 200 rows x N bases. Painted, not appended -- the
+       whole point of the canvas. Marks are grouped into three passes so
+       fillStyle changes stay proportional to distinct colors, not to cells. */
+    const LETTER_FONT = '8px ui-monospace, SFMono-Regular, Menlo, Consolas, monospace';
+    const paintGrid = () => {
+      const dpr = window.devicePixelRatio || 1;
+      const cssH = Math.max(shown.length * ROW_PITCH, 1);
+      canvas.style.width = seqW + "px";
+      canvas.style.height = cssH + "px";
+      canvas.width = Math.round(seqW * dpr);
+      canvas.height = Math.round(cssH * dpr);
+      ctx.setTransform(dpr, 0, 0, dpr, 0, 0);
+      ctx.clearRect(0, 0, seqW, cssH);
+      ctx.textBaseline = "alphabetic";
+
+      for (let r = 0; r < shown.length; r++) {
+        const allele = shown[r];
+        const seq = allele.aligned_sequence || "";
+        const ref = allele.reference_sequence || "";
+        const y = r * ROW_PITCH;
+
+        // 1. every cell; agreement with this allele's own reference recedes to
+        //    a wash so edits are the only loud thing in the row
+        for (let i = 0; i < seq.length; i++) {
+          const base = seq[i];
+          ctx.fillStyle = base === ref[i] ? fadedColor(base) : baseColor(base);
+          ctx.fillRect(i * CELL_W, y, CELL_W, CELL_H);
+        }
+
+        // 2. letters only where the allele differs -- matching bases are read
+        //    off the sticky reference row
+        ctx.font = LETTER_FONT;
+        ctx.textAlign = "center";
+        for (let i = 0; i < seq.length; i++) {
+          if (seq[i] === ref[i]) continue;
+          ctx.fillStyle = inkOnCached(baseColor(seq[i]));
+          ctx.fillText(seq[i], (i * CELL_W) + (CELL_W / 2), y + CELL_H - 3);
+        }
+
+        // 3. insertions carry a second channel: a rule in the insertion color
+        ctx.fillStyle = color["Insertion"];
+        for (let i = 0; i < seq.length; i++) {
+          if (ref[i] === "-" && seq[i] !== "-") {
+            ctx.fillRect(i * CELL_W, y + CELL_H - 2, CELL_W, 2);
+          }
+        }
+      }
+    };
+
+    /* The %Reads bar and the two numeric columns stay SVG: only 3 marks per
+       row, and they keep tabular figures and vector text for print. A keyed
+       update join reuses these nodes across renders instead of rebuilding. */
+    const paintColumns = () => {
+      colsSvg.attr("height", Math.max(shown.length * ROW_PITCH, 1));
+
+      const rows = colsSvg.selectAll("g.allele-row").data(shown);
+      rows.exit().remove();
+      const entered = rows.enter().append("g").attr("class", "allele-row");
+      entered.append("rect").attr("class", "allele-bar")
+        .attr("y", (CELL_H - BAR_H) / 2)
+        .attr("height", BAR_H)
+        .style("fill", "var(--allele-accent)");
+      entered.append("text").attr("class", "allele-pct")
+        .attr("y", CELL_H - 3)
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink)");
+      entered.append("text").attr("class", "allele-reads")
+        .attr("y", CELL_H - 3)
+        .attr("text-anchor", "end")
+        .style("font-size", "9px")
+        .style("font-variant-numeric", "tabular-nums")
+        .style("fill", "var(--allele-ink-2)");
+
+      const merged = entered.merge(rows)
+        .attr("transform", (d, i) => "translate(0," + (i * ROW_PITCH) + ")");
+
+      // magnitude: one hue, grown from a single baseline, rounded data-end
+      merged.select("rect.allele-bar")
+        .attr("x", barX)
+        .attr("width", (d) => Math.max(pctScale(d.pct), 1))
+        .attr("rx", (d) => (Math.max(pctScale(d.pct), 1) > 8 ? 2 : 0));
+      merged.select("text.allele-pct")
+        .attr("x", pctX)
+        .text((d) => d.pct.toFixed(2) + "%");
+      merged.select("text.allele-reads")
+        .attr("x", readsX)
+        .text((d) => d.reads.toLocaleString());
+    };
+
+    const render = () => {
+      const query = search.property("value");
+      const matches = filterAlleles(alleles, query, selectedClasses)
+        .slice()
+        .sort((a, b) => b.pct - a.pct);
+      shown = matches.slice(0, K);
+
+      status.text(matches.length > K
+        ? "Showing top " + K.toLocaleString() + " of " + matches.length.toLocaleString() + " matches."
+        : "Showing " + matches.length.toLocaleString() + " allele" + (matches.length === 1 ? "" : "s") + ".");
+      emptyState.style("display", matches.length === 0 ? "block" : "none");
+
+      hideTip();
+      rowHover.style("display", "none");
+      plot.style("height", Math.max(shown.length * ROW_PITCH, 1) + "px");
+      paintGrid();
+      paintColumns();
+    };
+
+    // one listener for the whole plot: row comes from y, column from x
+    plot.node().addEventListener("mousemove", (evt) => {
+      const bounds = plot.node().getBoundingClientRect();
+      const rowIndex = Math.floor((evt.clientY - bounds.top) / ROW_PITCH);
+      if (rowIndex < 0 || rowIndex >= shown.length) {
+        hideTip();
+        rowHover.style("display", "none");
+        return;
+      }
+      rowHover.style("display", "block").style("top", ((rowIndex * ROW_PITCH) - 1) + "px");
+
+      const allele = shown[rowIndex];
+      const index = Math.floor((evt.clientX - bounds.left) / CELL_W);
+      if (index < 0 || index >= (allele.aligned_sequence || "").length) {
+        hideTip();
+        return;
+      }
+      showTip(allele, index, evt);
+    });
+    plot.node().addEventListener("mouseleave", () => {
+      hideTip();
+      rowHover.style("display", "none");
+    });
+
+    render();
+  };
+
+  setTimeout(async () => {
+    
+    if (document.getElementById("allele_table_9_Reference_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC") && typeof allele_table_9_Reference_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC !== "undefined") {
+      await buildAlleleTable(allele_table_9_Reference_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC, "allele_table_9_Reference_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Reference_Alleles_frequency_table_around_sgRNA_GGAATCCCTTCTGCAGCACC")
+    }
+    
+    if (document.getElementById("allele_table_9_Reference_Alleles_frequency_table_around_PE_Extension") && typeof allele_table_9_Reference_Alleles_frequency_table_around_PE_Extension !== "undefined") {
+      await buildAlleleTable(allele_table_9_Reference_Alleles_frequency_table_around_PE_Extension, "allele_table_9_Reference_Alleles_frequency_table_around_PE_Extension")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Reference_Alleles_frequency_table_around_PE_Extension")
+    }
+    
+    if (document.getElementById("allele_table_9_Reference_Alleles_frequency_table_around_PE_spacer_sgRNA") && typeof allele_table_9_Reference_Alleles_frequency_table_around_PE_spacer_sgRNA !== "undefined") {
+      await buildAlleleTable(allele_table_9_Reference_Alleles_frequency_table_around_PE_spacer_sgRNA, "allele_table_9_Reference_Alleles_frequency_table_around_PE_spacer_sgRNA")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Reference_Alleles_frequency_table_around_PE_spacer_sgRNA")
+    }
+    
+    if (document.getElementById("allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_Extension") && typeof allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_Extension !== "undefined") {
+      await buildAlleleTable(allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_Extension, "allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_Extension")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_Extension")
+    }
+    
+    if (document.getElementById("allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_spacer_sgRNA") && typeof allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_spacer_sgRNA !== "undefined") {
+      await buildAlleleTable(allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_spacer_sgRNA, "allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_spacer_sgRNA")
+    } else {
+      console.warn("Skipping missing allele table payload or container: allele_table_9_Prime_edited_Alleles_frequency_table_around_PE_spacer_sgRNA")
+    }
+    
+  }, 100); // let the browser paint the loading state before the first D3 render
+</script>