Github Action: Updated dictionary term files and term pages

Author: github-actions[bot]

_data/DataModel.csv

@@ -11,7 +11,7 @@ acquisitionSoftware,"The name of the acquisition software used. Provide a value
 acquisitionSoftwareVersion,"The version number of software used. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified",NUMBER,,ManifestColumn
 adapters,"Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters. Example - 'AATGATACGGCGACCACCGAGATCTACACGCT; CAAGCAGAAGACGGCATACGAGAT'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified",STRING,,ManifestColumn
 adjustedCovariates,Any covariates the GWAS is adjusted for. Multiple values can be listed separately by a semicolon (;). Example - age;sex,STRING,,ManifestColumn
-analysisType,Type of analysis,STRING_LIST,Sage Bionetworks,ManifestColumn
+analysisType,Type of analysis,STRING,Sage Bionetworks,ManifestColumn
 arrayInformation,"Additional information about the genotyping array. For example, for targeted arrays, please provide the specific type of array. Example - Immunochip",STRING,,ManifestColumn
 arrayManufacturer,"Manufacturer of the genotyping array used for the discovery stage. Separate multiple manufacturers by a semicolon (;). Example - Illumina, Affymetrix, Perlegen",STRING,,ManifestColumn
 assemblyName,"Name/version of the assembly provided by the submitter used in the genome browsers and the community. Example - 'HuRef, JCVI_ISG_3_1.0'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified",STRING,,ManifestColumn
@@ -25,15 +25,15 @@ captivityDuration,"The duration of captivity in months for the individuals in ca
 captivityStatus,"The status of the individual with regard to captivity.note- Wild, captive, and stranded values are applicable, especially for marine mammals. Depending on life stage terminology for individual species, other values are possible. Please let the data curation team know.",STRING,,ManifestColumn
 commonName,"The biological species common name the individual belongs to (ex. ""Horned Lark""). note- As a default, the valid scientific name for the species should be indicated.",STRING,,ManifestColumn
 consentGroupID,"Indicate the consent group for the individual, provided by the data contributor's data dictionary",STRING,,ManifestColumn
-consortium,The name of the consortium,STRING_LIST,Sage Bionetworks,ManifestColumn
+consortium,The name of the consortium,STRING,Sage Bionetworks,ManifestColumn
 conversionRatio,The ratio or % detailing how well the bisulfite conversion worked. Provide a value or Unknown Not collected Not applicable Not specified,STRING,,ManifestColumn
 conversionRatioUnits,The units of measurement. Provide a value or Unknown Not collected Not applicable Not specified ,STRING,,ManifestColumn
 countryCode,"Indicate the geographic region for the individual (shown as ex. ""840"")",INTEGER,,ManifestColumn
 dataFile,"Name of additional file(s) accompanying the data. The file(s) provide, for example, the name of any raw files generated by the instrument, generated reports from a vendor, an Rscript, or an instructions document. The files can be instrument raw files, converted peak lists such as mzML, MGF, or result files like mzIdentML. The files can be additional documentation submitted alongside the data needed for reuse and sharing purposes. Provide the file names of any additional files submitted alongside the data (ex., an ADAT file). Multiple file names can be separated by (;)Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified",STRING,,ManifestColumn
-dataModelVersion,Version of the data model,,,ManifestColumn
-dataSubtype,"Further qualification of dataType, which may be used to indicate the state of processing of the data, aggregation of the data, or presence of metadata",STRING_LIST,Sage Bionetworks,ManifestColumn
+dataModelVersion,Version of the data model,STRING,,ManifestColumn
+dataSubtype,"Further qualification of dataType, which may be used to indicate the state of processing of the data, aggregation of the data, or presence of metadata",STRING,Sage Bionetworks,ManifestColumn
 dataType,,STRING,Sage Bionetworks,ManifestColumn
-dataTypeAll,,STRING_LIST,Sage Bionetworks,ManifestColumn
+dataTypeAll,,STRING,Sage Bionetworks,ManifestColumn
 databaseLibrary,"The name(s) of the associated database library. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified",STRING,,ManifestColumn
 databaseName,"The name of the search database (nr, SwissProt or est_human, and/or mass spectral library). Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified",STRING,,ManifestColumn
 databaseSource,"The name of the organization, project, or laboratory from where the database is obtained (UniProt, NCBI, EBI, other).",STRING,,ManifestColumn
@@ -54,7 +54,7 @@ experimentalBatchSizeUnit,The unit of measurement for number of samples in a exp
 experimentalFactor,"Variable aspects of an experiment design that can be used to describe an experiment or set of experiments in an increasingly detailed manner.This field accepts ontology terms from Experimental Factor Ontology (EFO) and/or Ontology for Biomedical Investigations (OBI). Example - 'time series design [EFO-0001779]'Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified",STRING,,ManifestColumn
 extractionMethod,"The name of the process used to separate a desired component of an input material from the remainder. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified",STRING,,ManifestColumn
 fieldCenterCode,Name of the field center,STRING,,ManifestColumn
-fileFormat,"Defined format of the data file, typically corresponding to extension, but sometimes indicating more general group of files produced by the same tool or software",STRING_LIST,Sage Bionetworks,ManifestColumn
+fileFormat,"Defined format of the data file, typically corresponding to extension, but sometimes indicating more general group of files produced by the same tool or software",STRING,Sage Bionetworks,ManifestColumn
 fractionIdentifier,"Number of fractions in the experimental runProvide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified",STRING,,ManifestColumn
 gasFlowTemperature,"e.g., nebulization gas, cone gas, etc.Unit of measure-C, F, K, Not specified",NUMBER,,ManifestColumn
 gasFlowTemperatureUnit,Unit of gas flow temperature,STRING,,ManifestColumn
@@ -102,7 +102,7 @@ reagentWeblink,An internet address that may provide details of an assay reagent.
 referenceTranscriptID,"The ID for the transcript/gene. Either the NCBI ID or the Ensembl ID must be provided. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified",STRING,,ManifestColumn
 reportedTrait,"The trait under investigation. Please describe the trait concisely but with enough detail to be clear to a non-specialist. Avoid the use of abbreviations; if these are necessary, please define them or their source in the readme file. Example - Reticulocyte count",STRING,,ManifestColumn
 repositoryName,"The public repository name for the transcript (for example, Ensembl or NCBI Gene)",STRING,,ManifestColumn
-resourceType,The type of resource being stored and annotated,STRING_LIST,Sage Bionetworks,ManifestColumn
+resourceType,The type of resource being stored and annotated,STRING,Sage Bionetworks,ManifestColumn
 resultUnit,The unit for the result value,STRING,,ManifestColumn
 rnaBatchID,"Isolation batch identifier, provided by the data contributor to Sage Bionetworks. The batch identifier(s) must be stored in a data dictionary .csv file uploaded to Synapse. Provide a value OR provide one of these values - Unknown Not collected, Not applicable, Not specified",STRING,,ManifestColumn
 rnaBatchSize,The number of samples,NUMBER,,ManifestColumn
@@ -152,33 +152,33 @@ vacuumPressureUnit,Unit of vacuum pressure value,STRING,,ManifestColumn
 valueReported,The count or gene count for the transcript,STRING,,ManifestColumn
 variantCount,The number of variants analysed in the discovery stage (after QC). Example - 52500,STRING,,ManifestColumn
 visitCode,"Indicate which longitudinal visit for the individual the data comes from, provided by the data contributor's data dictionary",NUMBER,,ManifestColumn
-Component,,,,Unknown
+Component,,STRING,,Unknown
 Filename,,STRING,,Unknown
-accessReqs,,,,Unknown
-ackContext,,,,Unknown
-acknowledgment,,,,Unknown
-acquistionSoftwareVersion,,,,Unknown
-batchSizeUnit,,,,Unknown
-experimentalBatchSize,,,,Unknown
-grantNumber,Grant number including activity code institute code and serial number (e.g. U01MH103392),STRING_LIST,Sage Bionetworks,Unknown
-isFeatured,,,,Unknown
-isReleased,,,,Unknown
-metadataType,"For files of dataSubtype: metadata, a description of the type of metadata in the file",STRING_LIST,Sage Bionetworks,Unknown
-methods,,,,Unknown
-newsRelease,,,,Unknown
-processingBatchSize,,,,Unknown
-processingBatchSizeUnit,,,,Unknown
-projectFullName,,,,Unknown
-relatedStudies,,,,Unknown
-sampleBatchSize,,,,Unknown
-sampleBatchSizeUnit,,,,Unknown
-studyAbstract,,,,Unknown
-studyDescription,,,,Unknown
-studyFocus,,,,Unknown
-studyMetadata,,,,Unknown
-studyName,,,,Unknown
-studyType,,,,Unknown
-studyWiki,,,,Unknown
+accessReqs,,STRING,,Unknown
+ackContext,,STRING,,Unknown
+acknowledgment,,STRING,,Unknown
+acquistionSoftwareVersion,,STRING,,Unknown
+batchSizeUnit,,STRING,,Unknown
+experimentalBatchSize,,INTEGER,,Unknown
+grantNumber,Grant number including activity code institute code and serial number (e.g. U01MH103392),STRING,Sage Bionetworks,Unknown
+isFeatured,,BOOLEAN,,Unknown
+isReleased,,BOOLEAN,,Unknown
+metadataType,"For files of dataSubtype: metadata, a description of the type of metadata in the file",STRING,Sage Bionetworks,Unknown
+methods,,STRING,,Unknown
+newsRelease,,STRING,,Unknown
+processingBatchSize,,INTEGER,,Unknown
+processingBatchSizeUnit,,STRING,,Unknown
+projectFullName,,STRING,,Unknown
+relatedStudies,,STRING,,Unknown
+sampleBatchSize,,INTEGER,,Unknown
+sampleBatchSizeUnit,,STRING,,Unknown
+studyAbstract,,STRING,,Unknown
+studyDescription,,STRING,,Unknown
+studyFocus,,STRING,,Unknown
+studyMetadata,,STRING,,Unknown
+studyName,,STRING,,Unknown
+studyType,,STRING,,Unknown
+studyWiki,,STRING,,Unknown
 batchSize,The number of samples,NUMBER,sage.annotations-experimentalData.batchSize-0.0.2,batch
 cellType,Indicate the cell type.,STRING,sage.annotations-experimentalData.cellType-0.0.9,biospecimen
 fastingState,Was individual fasting when the sample was taken (true/false)?,STRING,sage.annotations-experimentalData.fastingState-0.0.2,biospecimen
@@ -205,8 +205,8 @@ hasCDR,The datafile and/or individualID includes cognitive variables and/or scor
 hasMMSE,The datafile and/or individualID includes cognitive variables and/or scores from the Mini-Mental State Examination (MMSE),STRING,,individual
 hasMoCA,The datafile and/or individualID includes cognitive variables and/or scores from the Montreal Cognitive Assessment (MoCA),STRING,,individual
 individualID,"Identifying string linked to the individual or animal being studied, provided by the data contributor",STRING,sage.annotations-experimentalData.individualID-0.0.2,individual
-isMultiSpecimen,Boolean flag indicating whether or not a file has data for multiple specimens,STRING_LIST,Sage Bionetworks,individual
-species,The name of a species (typically a taxonomic group) of organism.,STRING_LIST,Sage Bionetworks,individual
+isMultiSpecimen,Boolean flag indicating whether or not a file has data for multiple specimens,STRING,Sage Bionetworks,individual
+species,The name of a species (typically a taxonomic group) of organism.,STRING,Sage Bionetworks,individual
 spectrometerFrequency,The frequency at which a spectrometer causes hydrogen atoms to resonate (in MHz),NUMBER,sage.annotations-experimentalData.spectrometerFrequency-0.0.2,mass spectrometry
 directionalBSseqLibrary,Indicates whether or not the bisulfiteSeq library is directional,STRING,sage.annotations-ngs.directionalBSseqLibrary-0.0.2,sequencing
 gDNAconc,gDNA Concentration in ng. Provide a value or Unknown Not collected Not applicable Not specified,STRING,sage.annotations-experimentalData.gDNAconc-0.0.3,sequencing