Skip to content

Latest commit

 

History

History
996 lines (652 loc) · 31.8 KB

File metadata and controls

996 lines (652 loc) · 31.8 KB
layout page
title The Shell
comments true
date 2014-08-13 09:44:36 -0700

The Shell

Author: Tracy Teal
Original contributors: Paul Wilson, Milad Fatenejad, Sasha Wood and Radhika Khetani for Software Carpentry (http://software-carpentry.org/)

Objectives

  • What is the shell?
  • How do you access it?
  • How do you use it?
    • Getting around the Unix file system
    • looking at files
    • manipulating files
    • automating tasks
  • What is it good for?
  • Where are resources where I can learn more? (because the shell is awesome)

What is the shell?

The shell is a program that presents a command line interface which allows you to control your computer using commands entered with a keyboard instead of controlling graphical user interfaces (GUIs) with a mouse/keyboard combination.

There are many reasons to learn about the shell.

  • For most bioinformatics tools, you have to use the shell. There is no graphical interface. If you want to work in metagenomics or genomics you're going to need to use the shell.
  • The shell gives you power. The command line gives you the power to do your work more efficiently and more quickly. When you need to do things tens to hundreds of times, knowing how to use the shell is transformative.
  • To use remote computers or cloud computing, you need to use the shell.

Automation

Unix is user-friendly. It's just very selective about who its friends are.

Today we're going to go through how to access Unix/Linux and some of the basic shell commands.

Information on the shell

shell cheat sheets:

Explain shell - a web site where you can see what the different components of a shell command are doing.

How to access the shell

The shell is already available on Mac and Linux. For Windows, you'll have to download a separate program.

Mac

On Mac the shell is available through Terminal
Applications -> Utilities -> Terminal
Go ahead and drag the Terminal application to your Dock for easy access.

Windows

For Windows, we're going to be using gitbash.
Download and install gitbash; Open up the program.

Linux

You should be set.

Starting with the shell

We will spend most of our time learning about the basics of the shell by manipulating some experimental data.

Now we're going to download the data for the tutorial. For this you'll need internet access, because you're going to get it off the web.

We're going to be working with data from

Now let's go in to that directory

cd shell-genomics

This stands for 'change directory'

In this directory, there should be some things we just downloaded.

Let's check. Type: ls

ls stands for 'list' and it lists the contents of a directory.

There's a few directories there, but not too many. Let's go look in the data directory.

cd data
ls

In there, all mixed up together are files and directories/folders. If we want to know which is which, we can type:

ls -F

Anything with a "/" after it is a directory.
Things with a "*" after them are programs.
It there's nothing there it's a file.

You can also use the command

ls -l

to see whether items in a directory are files or directories. ls -l gives a lot more information too, such as the size of the file

So, we can see that we have several files, directories and a program. Great!

Arguments

Most programs take additional arguments that control their exact behavior. For example, -F and -l are arguments to ls. The ls program, like many programs, take a lot of arguments. But how do we know what the options are to particular commands?

Most commonly used shell programs have a manual. You can access the manual using the man program. Try entering:

man ls

This will open the manual page for ls. Use the space key to go forward and b to go backwards. When you are done reading, just hit q to quit.

Programs that are run from the shell can get extremely complicated. To see an example, open up the manual page for the find program. No one can possibly learn all of these arguments, of course. So you will probably find yourself referring back to the manual page frequently.

The Unix directory file structure (a.k.a. where am I?)

As you've already just seen, you can move around in different directories or folders at the command line. Why would you want to do this, rather than just navigating around the normal way.

When you're working with bioinformatics programs, you're working with your data and it's key to be able to have that data in the right place and make sure the program has access to the data. Many of the problems people run in to with command line bioinformatics programs is not having the data in the place the program expects it to be.

Moving around the file system

Let's practice moving around a bit.

We're going to work in that shell-genomics directory we just downloaded.

First let's navigate there using the regular way by clicking on the different folders.

First we did something like go to the folder of our username. Then we opened 'shell-genomics' then 'data'

Let's draw out how that went.

Now let's draw some of the other files and folders we could have clicked on.

This is called a hierarchical file system structure, like an upside down tree with root (/) at the base that looks like this.

Unix

That (/) at the base is often also called the 'top' level.

When you are working at your computer or log in to a remote computer, you are on one of the branches of that tree, your home directory (/home/username)

Now let's go do that same navigation at the command line.

Type

cd

This puts you in your home directory. This folder here.

Now using cd and ls, go in to the 'shell-genomics' directory and list its contents.

Let's also check to see where we are. Sometimes when we're wandering around in the file system, it's easy to lose track of where we are and get lost.

If you want to know what directory you're currently in, type

pwd

This stands for 'print working directory'. The directory you're currently working in.

What if we want to move back up and out of the 'data' directory? Can we just type cd shell-genomics? Try it and see what happens.

To go 'back up a level' we need to use ..

Type

cd ..

Now do ls and pwd. See now that we went back up in to the 'shell-genomics' directory. .. means go back up a level.


Exercise

Now we're going to try a hunt.
Move around in the 'hidden' directory and try to find the file 'youfoundit.txt'


Examining the contents of other directories

By default, the ls commands lists the contents of the working directory (i.e. the directory you are in). You can always find the directory you are in using the pwd command. However, you can also give ls the names of other directories to view. Navigate to the home directory if you are not already there.

Type:

cd

Then enter the command:

ls shell-genomics

This will list the contents of the shell-genomics directory without you having to navigate there.

The cd command works in a similar way. Try entering:

cd
cd shell-genomics/data/hidden

and you will jump directly to hidden without having to go through the intermediate directory.


Exercise

Try finding the 'anotherfile.txt' file without changing directories.


Shortcut: Tab Completion

Navigate to the home directory. Typing out directory names can waste a lot of time. When you start typing out the name of a directory, then hit the tab key, the shell will try to fill in the rest of the directory name. For example, type cd to get back to your home directy, then enter:

cd sh<tab>

The shell will fill in the rest of the directory name for shell-genomics. Now go to shell-genomics/data/MiSeq

ls F3D<tab><tab>

When you hit the first tab, nothing happens. The reason is that there are multiple directories in the home directory which start with F3D. Thus, the shell does not know which one to fill in. When you hit tab again, the shell will list the possible choices.

Tab completion can also fill in the names of programs. For example, enter e<tab><tab>. You will see the name of every program that starts with an e. One of those is echo. If you enter ec<tab> you will see that tab completion works.

Full vs. Relative Paths

The cd command takes an argument which is the directory name. Directories can be specified using either a relative path or a full path. The directories on the computer are arranged into a hierarchy. The full path tells you where a directory is in that hierarchy. Navigate to the home directory. Now, enter the pwd command and you should see:

/home/username

which is the full name of your home directory. This tells you that you are in a directory called username, which sits inside a directory called home which sits inside the very top directory in the hierarchy. The very top of the hierarchy is a directory called / which is usually referred to as the root directory. So, to summarize: username is a directory in home which is a directory in /.

Now enter the following command:

cd /home/username/shell-genomics/data/hidden

This jumps to hidden. Now go back to the home directory (cd). We saw earlier that the command:

cd shell-genomics/data/hidden

had the same effect - it took us to the hidden directory. But, instead of specifying the full path (/home/username/shell-genomics/data), we specified a relative path. In other words, we specified the path relative to our current directory. A full path always starts with a /. A relative path does not.

A relative path is like getting directions from someone on the street. They tell you to "go right at the Stop sign, and then turn left on Main Street". That works great if you're standing there together, but not so well if you're trying to tell someone how to get there from another country. A full path is like GPS coordinates. It tells you exactly where something is no matter where you are right now.

You can usually use either a full path or a relative path depending on what is most convenient. If we are in the home directory, it is more convenient to just enter the relative path since it involves less typing.

Over time, it will become easier for you to keep a mental note of the structure of the directories that you are using and how to quickly navigate amongst them.


Exercise

Now, list the contents of the /bin directory. Do you see anything familiar in there?


Saving time with shortcuts, wild cards, and tab completion

Shortcuts

There are some shortcuts which you should know about. Dealing with the home directory is very common. So, in the shell the tilde character, ""~"", is a shortcut for your home directory. Navigate to the edamame directory:

cd
cd shell-genomics
cd data

Then enter the command:

ls ~

This prints the contents of your home directory, without you having to type the full path. The shortcut .. always refers to the directory above your current directory. Thus:

ls ..

prints the contents of the /home/username/shell-genomics. You can chain these together, so:

ls ../../

prints the contents of /home/username which is your home directory. Finally, the special directory . always refers to your current directory. So, ls, ls ., and ls ././././. all do the same thing, they print the contents of the current directory. This may seem like a useless shortcut right now, but we'll see when it is needed in a little while.

To summarize, while you are in the shell directory, the commands ls ~, ls ~/., ls ../../, and ls /home/username all do exactly the same thing. These shortcuts are not necessary, they are provided for your convenience.

Our data set: FASTQ files

We did an experiment and want to look at the bacterial communities of mice in two treatments using 16S sequencing. We have 10 mice in one treatment and 9 in another.each treatment. We also sequenced a Mock community, so we can check the quality of our data. So, we have 20 samples all together and we've done paired-end MiSeq sequencing.

We get our data back from the sequencing center as FASTQ files, and we stick them all in a folder called MiSeq. This data is actually data generated by Pat Schloss and used in mothur tutorials.

We want to be able to look at these files and do some things with them.

Wild cards

Navigate to the ~/shell-genomics/data/MiSeq directory. This directory contains our FASTQ files and some other ones we'll need for analyses. If we type ls, we will see that there are a bunch of files with long file names. Some of the end with .fastq

The * character is a shortcut for "everything". Thus, if you enter ls *, you will see all of the contents of a given directory. Now try this command:

ls *fastq

This lists every file that ends with a fastq. This command:

ls /usr/bin/*.sh

Lists every file in /usr/bin that ends in the characters .sh.

We have paired end sequencing, so for every sample we have two files. If we want to just see the list of the files for the forward direction sequencing we can use:

ls *R1*fastq

lists every file in the current directory whose name contains the number R1, and ends with fastq. There are twenty such files which we would expect because we have 20 samples.

So how does this actually work? Well...when the shell (bash) sees a word that contains the * character, it automatically looks for filenames that match the given pattern. In this case, it identified four such files. Then, it replaced the *R1*fastq with the list of files, separated by spaces.

What happens if you do R1*fastq?


Exercise

Do each of the following using a single ls command without navigating to a different directory.

  1. List all of the files in /bin that start with the letter 'c
  2. List all of the files in /bin that contain the letter 'a'
  3. List all of the files in /bin that end with the letter 'o'

BONUS: List all of the files in '/bin' that contain the letter 'a' or 'c'


Command History

You can easily access previous commands. Hit the up arrow. Hit it again. You can step backwards through your command history. The down arrow takes your forwards in the command history.

^-C will cancel the command you are writing, and give you a fresh prompt.

^-R will do a reverse-search through your command history. This is very useful.

You can also review your recent commands with the history command. Just enter:

history

to see a numbered list of recent commands, including this just issues history command. You can reuse one of these commands directly by referring to the number of that command.

If your history looked like this:

259  ls *
260  ls /usr/bin/*.sh
261  ls *R1*fastq

then you could repeat command #260 by simply entering:

!260

(that's an exclamation mark).


Exercise

  1. Find the line number in your history for the last exercise (listing files in /bin) and reissue that command.

Examining Files

We now know how to switch directories, run programs, and look at the contents of directories, but how do we look at the contents of files?

The easiest way to examine a file is to just print out all of the contents using the program cat. Enter the following command:

cat F3D0_S188_L001_R1_001.fastq

This prints out the contents of the F3D0_S188_L001_R1_001.fastq file.


Exercises

  1. Print out the contents of the ~/shell-genomics/data/MiSeq/stability.files file. What does this file contain?

  2. Without changing directories, (you should still be in shell-genomics), use one short command to print the contents of all of the files in the /home/username/shell-genomics/data/MiSeq directory.


Make sure we're in the right place for the next set of the lessons. We want to be in the shell directory. Check if you're there with pwd and if not navigate there. One way to do that would be

cd ~/shell-genomics/data/MiSeq

cat is a terrific program, but when the file is really big, it can be annoying to use. The program, less, is useful for this case. Enter the following command:

less F3D0_S188_L001_R1_001.fastq

less opens the file, and lets you navigate through it. The commands are identical to the man program.

Some commands in less

key action
"space" to go forward
"b" to go backwarsd
"g" to go to the beginning
"G" to go to the end
"q" to quit

less also gives you a way of searching through files. Just hit the "/" key to begin a search. Enter the name of the word you would like to search for and hit enter. It will jump to the next location where that word is found. Try searching the dictionary.txt file for the word "cat". If you hit "/" then "enter", less will just repeat the previous search. less searches from the current location and works its way forward. If you are at the end of the file and search for the word "cat", less will not find it. You need to go to the beginning of the file and search.

For instance, let's search for the sequence 1101:14341 in our file. You can see that we go right to that sequence and can see what it looks like.

Remember, the man program actually uses less internally and therefore uses the same commands, so you can search documentation using "/" as well!

There's another way that we can look at files, and in this case, just look at part of them. This can be particularly useful if we just want to see the beginning or end of the file, or see how it's formatted.

The commands are head and tail and they just let you look at the beginning and end of a file respectively.

head F3D0_S188_L001_R1_001.fastq tail F3D0_S188_L001_R1_001.fastq

The -n option to either of these commands can be used to print the first or last n lines of a file. To print the first/last line of the file use:

head -n 1 F3D0_S188_L001_R1_001.fastq tail -n 1 F3D0_S188_L001_R1_001.fastq

Searching files

We showed a little how to search within a file using less. We can also search within files without even opening them, using grep. Grep is a command-line utility for searching plain-text data sets for lines matching a string or regular expression. Let's give it a try!

Let's search for that sequence 1101:14341 in the F3D0_S188_L001_R1_001.fastq file.

grep 1101:14341 F3D0_S188_L001_R1_001.fastq

We get back the whole line that had '1101:14341' in it. What if we wanted all four lines, the whole part of that FASTQ sequence, back instead.

grep -A 3 1101:14341 F3D0_S188_L001_R1_001.fastq

The -A flag stands for "after match" so it's returning the line that matches plus the three after it. The -B flag returns that number of lines before the match.

** Exercise **

Search for the sequence 'TTATCCGGATTTATTGGGTTTAAAGGGT' in the F3D0_S188_L001_R1_001.fastq file and in the output have the sequence name and the sequence. e.g.
@M00967:43:000000000-A3JHG:1:2114:11799:28499 1:N:0:188
TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGATGCAG

Search for that sequence in all the FASTQ files.

Redirection

We're excited we have all these sequences that we care about that we just got from the FASTQ files. That is a really important motif that is going to help us answer our important question. But all those sequences just went whizzing by with grep. How can we capture them?

We can do that with something called "redirection". The idea is that we're redirecting the output to the terminal (all the stuff that went whizzing by) to something else. In this case, we want to print it to a file, so that we can look at it later.

The redirection command for putting something in a file is >

Let's try it out and put all the sequences that contain 'TTATCCGGATTTATTGGGTTTAAAGGGT' from all the files in to another file called 'good-data.txt'

grep -B 2 TTATCCGGATTTATTGGGTTTAAAGGGT * > good-data.txt

The prompt should sit there a little bit, and then it should look like nothing happened. But type ls. You should have a new file called good-data.txt. Take a look at it and see if it has what you think it should.

There's one more useful redirection command that we're going to show, and that's called the pipe command, and it is |. It's probably not a key on your keyboard you use very much. What | does is take the output that scrolling by on the terminal and then can run it through another command. When it was all whizzing by before, we wished we could just slow it down and look at it, like we can with less. Well it turns out that we can! We pipe the grep command through less

grep TTATCCGGATTTATTGGGTTTAAAGGGT * | less

Now we can use the arrows to scroll up and down and use q to get out.

We can also do something tricky and use the command wc. wc stands for word count. It counts the number of lines or characters. So, we can use it to count the number of lines we're getting back from our grep command. And that will magically tell us how many sequences we're finding. We're

grep TTATCCGGATTTATTGGGTTTAAAGGGT * | wc

That tells us the number of lines, words and characters in the file. If we just want the number of lines, we can use the -l flag for lines.

grep TTATCCGGATTTATTGGGTTTAAAGGGT * | wc -l

Redirecting is not super intuitive, but it's really powerful for stringing together these different commands, so you can do whatever you need to do.

The philosophy behind these command line programs is that none of them really do anything all that impressive. BUT when you start chaining them together, you can do some really powerful things really efficiently. If you want to be proficient at using the shell, you must learn to become proficient with the pipe and redirection operators: |, >, >>.

Creating, moving, copying, and removing

Now we can move around in the file structure, look at files, search files, redirect. But what if we want to do normal things like copy files or move them around or get rid of them. Sure we could do most of these things without the command line, but what fun would that be?! Besides it's often faster to do it at the command line, or you'll be on a remote server like Amazon where you won't have another option.

The stability.files file is one that tells us what sample name goes with what sequences. This is a really important file, so we want to make a copy so we don't lose it.

Lets copy the file using the cp command. The cp command backs up the file. Navigate to the data directory and enter:

cp stability.files stability.files_backup

Now stability.files_backup has been created as a copy of stability.files.

Let's make a backup directory where we can put this file.

The mkdir command is used to make a directory. Just enter mkdir followed by a space, then the directory name.

mkdir backup

We can now move our backed up file in to this directory. We can move files around using the command mv. Enter this command:

mv stability.files_backup backup/

This moves stability.files_backup into the directory backup/ or the full path would be ~/edamame-data/shell/MiSeq/backup

The mv command is also how you rename files. Since this file is so important, let's rename it:

mv stability.files stability.files_IMPORTANT

Now the file name has been changed to stability.files_IMPORTANT. Let's delete the backup file now:

rm backup/stability.files_backup

The rm file removes the file. Be careful with this command. It doesn't just nicely put the files in the Trash. They're really gone.


Exercise

Do the following:

  1. Rename the stability.files_IMPORTANT file to stability.files.
  2. Create a directory in the MiSeq directory called new
  3. Then, copy the stability.files file into new

By default, rm, will NOT delete directories. You can tell rm to delete a directory using the -r option. Let's delete that new directory we just made. Enter the following command:

rm -r new

Writing files

We've been able to do a lot of work with files that already exist, but what if we want to write our own files. Obviously, we're not going to type in a FASTA file, but you'll see as we go through other tutorials, there are a lot of reasons we'll want to write a file, or edit an existing file.

To write in files, we're going to use the program nano. We're going to create a file that contains the favorite grep command so you can remember it for later. We'll name this file 'awesome.sh'.

nano awesome.sh

Now you have something that looks like

nano1.png

Type in your command, so it looks like

nano2.png

Now we want to save the file and exit. At the bottom of nano, you see the "^X Exit". That means that we use Ctrl-X to exit. Type Ctrl-X. It will ask if you want to save it. Type y for yes. Then it asks if you want that file name. Hit 'Enter'.

Now you've written a file. You can take a look at it with less or cat, or open it up again and edit it.


Exercise

Open 'awesome.sh' and add "echo AWESOME!" after the grep command and save the file.

We're going to come back and use this file in just a bit.


Running programs

Commands like ls, rm, echo, and cd are just ordinary programs on the computer. A program is just a file that you can execute. The program which tells you the location of a particular program. For example:

which ls

Will return "/bin/ls". Thus, we can see that ls is a program that sits inside of the /bin directory. Now enter:

which find

You will see that find is a program that sits inside of the /usr/bin directory.

So ... when we enter a program name, like ls, and hit enter, how does the shell know where to look for that program? How does it know to run /bin/ls when we enter ls. The answer is that when we enter a program name and hit enter, there are a few standard places that the shell automatically looks. If it can't find the program in any of those places, it will print an error saying "command not found". Enter the command:

echo $PATH

This will print out the value of the PATH environment variable. More on environment variables later. Notice that a list of directories, separated by colon characters, is listed. These are the places the shell looks for programs to run. If your program is not in this list, then an error is printed. The shell ONLY checks in the places listed in the PATH environment variable.

Navigate to the shell directory and list the contents. You will notice that there is a program (executable file) called hello.sh in this directory. Now, try to run the program by entering:

hello.sh

You should get an error saying that hello.sh cannot be found. That is because the directory /home/username/shell-genomics/data is not in the PATH. You can run the hello.sh program by entering:

./hello.sh

Remember that . is a shortcut for the current working directory. This tells the shell to run the hello.sh program which is located right here. So, you can run any program by entering the path to that program. You can run hello.sh equally well by specifying:

/home/username/shell-genomics/data/hello.sh

Or by entering:

~/shell-genomics/data/hello.sh

When there are no / characters, the shell assumes you want to look in one of the default places for the program.

Writing scripts

We know how to write files and run scripts, so I bet you can guess where this is headed. We're going to run our own script!

Go in to the 'MiSeq' directory where we created 'awesome.sh' before. Remember we wrote our favorite grep command in there. Since we like it so much, we might want to run it again, or even all the time. Instead of writing it out every time, we can just run it as a script.

It's a command, so we should just be able to run it. Give it try.

./awesome.sh

Alas, we get -bash: ./awesome.sh: Permission denied. This is because we haven't told the computer that it's a program. To do that we have to make it 'executable'. We do this by changing its mode. The command for that is chmod - change mode. We're going to change the mode of this file, so that it's executable and the computer knows it's OK to run it as a program.

chmod +x awesome.sh

Now let's try running it again

./awesome.sh

Now you should have seen some output, and of course, it's AWESOME! Congratulations, you just created your first shell script! You're set to rule the world.

Bonus materials: Automation

Looping at the command line

Example: Something you might want to do fairly often is to change the name of a lot of files. You can do that with a 'for' loop.

The syntax for that is in the shell is

for variable in set-of-things; do something on $variable; done

A standard variable people use is i, but you can use any letter or word you want

So, for instance, let's list all the FASTQ files

  for i in *.fastq;
    do echo $i;
    done

Or if we just wanted to look at the first 20 lines of each of the .fastq files, we could do

 for i in *.fastq;
    head -n 40 $i;
    done

If we wanted to output these first 40 lines to a new file, we could do

 for i in #.fastq;
     head -n 40 $i > new_$i;
     done

Bonus exercise Rename the stability files to have a .txt extension


Example of renaming files with a different extension. Changing fastq to fq

for i in *.fastq;
     do mv "$i" "${i/%.fastq/.fq}";
     done

For Future Reference

Finding files

The find program can be used to find files based on arbitrary criteria. Navigate to the data directory and enter the following command:

find . -print

This prints the name of every file or directory, recursively, starting from the current directory. Let's exclude all of the directories:

find . -type f -print

This tells find to locate only files. Now try these commands:

find . -type f -name "*1*"
find . -type f -name "*1*" -or -name "*2*" -print
find . -type f -name "*1*" -and -name "*2*" -print

The find command can acquire a list of files and perform some operation on each file. Try this command out:

find . -type f -exec grep Volume {} \;

This command finds every file starting from .. Then it searches each file for a line which contains the word "Volume". The {} refers to the name of each file. The trailing \; is used to terminate the command. This command is slow, because it is calling a new instance of grep for each item the find returns.

A faster way to do this is to use the xargs command:

find . -type f -print | xargs grep Volume

find generates a list of all the files we are interested in, then we pipe them to xargs. xargs takes the items given to it and passes them as arguments to grep. xargs generally only creates a single instance of grep (or whatever program it is running).

Where can I learn more about the shell?

  • Software Carpentry tutorial - The Unix shell
  • The shell handout - Command Reference
  • explainshell.com
  • http://tldp.org/HOWTO/Bash-Prog-Intro-HOWTO.html
  • man bash
  • Google - if you don't know how to do something, try Googling it. Other people have probably had the same question.
  • Learn by doing. There's no real other way to learn this than by trying it out. Write your next paper in nano (really emacs or vi), open pdfs from the command line, automate something you don't really need to automate.

Bonus:

backtick, xargs: Example find all files with certain text

alias -> rm -i

variables -> use a path example

.bashrc

du

ln

ssh and scp

Regular Expressions

Permissions

Chaining commands together