Skip to content

Latest commit

 

History

History
1020 lines (873 loc) · 49.1 KB

File metadata and controls

1020 lines (873 loc) · 49.1 KB

Phase B4 — bounded whole-genome variant calling over the persisted index — Implementation Plan

For agentic workers: REQUIRED SUB-SKILL: Use superpowers:subagent-driven-development (recommended) or superpowers:executing-plans to implement this plan task-by-task. Steps use checkbox (- [ ]) syntax for tracking.

Goal: rosalind variants --index <idx> --alignments <sorted.bam> calls germline variants across every contig of a persisted index in bounded, predictable memory (reads stream one record at a time, the reference is read from the index per-contig), emitting a multi-contig VCF plus a receipt that shows the realized peak.

Architecture: A StreamingBamSource (ReadSource) reads one BAM record at a time via bam::Reader::read (no full-file Vec), with a (contig_id, pos) monotonicity guard enforcing coordinate-sorted input. A library drive call_germline_whole_genome makes a single sorted pass, partitions it per contig with a peekable adapter, decodes each contig's reference from the B4a ReferenceView, and reuses the tested per-contig call_germline_region (now also returning the engine's max working set). variants --index loads the index, runs the drive, writes a multi-contig VCF + a manifest carrying the realized peak RSS + max working set; a record-only --memory-budget-mb flags overage without aborting.

Tech Stack: Rust 2021 (MSRV 1.72 — no div_ceil); rust-htslib 0.44.1 (bam::Reader::read(&mut Record) -> Option<Result<(), Error>>, proven in pileup_stream.rs); clap derive groups; anyhow; no new dependencies.

This is the caller sub-stage of Phase B4, from docs/superpowers/specs/2026-05-27-phase-b4-variants-index-design.md (reprioritized ahead of the aligner). Follows B4a (ReferenceView, merged — PR #18). Out of scope (deferred): the aligner over the index + align --index / somatic --index (Phase E); SAM streaming (BAM is the WGS input); on-demand ref_base (the per-contig reference peak is laptop-fine); budget enforcement + rosalind plan/verify (Phase C).


File structure

  • src/io/bam.rsModify. Extract the per-record Record → AlignedRead mapping into pub(crate) fn record_to_aligned_read; reuse it in read_bam_as_core_reads; add StreamingBamSource<'a> (ReadSource, one record at a time, (contig_id,pos) monotonicity guard).
  • src/call/pipeline.rsModify. Add call_germline_region_tracked (the engine loop tracking the max current_working_set, returning (sites, WorkingSet)); make call_germline_region a thin wrapper that drops the working set (existing 4 call sites unchanged).
  • src/call/whole_genome.rsCreate. call_germline_whole_genome (single sorted pass → per-contig PerContig adapter → call_germline_region_tracked per contig + per-contig ReferenceView decode → accumulated rows + max working set).
  • src/call/mod.rsModify. mod whole_genome; + pub use.
  • src/main.rsModify. Variants clap variant: --index XOR --reference (exactly one), --memory-budget-mb; split run_variants into the existing --reference path and a new --index path that runs the drive over a StreamingBamSource + the index's ReferenceView/ContigSet, writes the multi-contig VCF + the memory receipt.
  • tests/variants_index.rsCreate. Integration gates: parity vs --reference, multi-contig, self-contained, sort-rejection, bounded (no materialization), memory receipt + budget-never-refuses.

Task 1: StreamingBamSource + shared record mapping + sort guard

Files:

  • Modify: src/io/bam.rs

  • Step 1: Write failing tests. In the #[cfg(test)] mod tests of src/io/bam.rs, add (the module already has use super::*; and builds Records via rust_htslib::bam::record::{Cigar, CigarString, Record} — reuse that style; if a BAM-writing helper exists, reuse it, otherwise these tests write a tiny BAM with bam::Writer):

    #[test]
    fn streaming_source_yields_same_reads_as_materializing() {
        // Build a tiny coordinate-sorted BAM with 2 contigs, read it both ways.
        let dir = std::env::temp_dir().join(format!(
            "rosalind-stream-{}",
            std::time::SystemTime::now().duration_since(std::time::UNIX_EPOCH).unwrap().as_nanos()
        ));
        std::fs::create_dir_all(&dir).unwrap();
        let bam_path = dir.join("reads.bam");
        write_sorted_test_bam(&bam_path); // helper below

        let mut contigs = ContigSet::new();
        contigs.push("chr1", 1000);
        contigs.push("chr2", 1000);

        let materialized = read_bam_as_core_reads(&bam_path, &contigs).unwrap();
        let mut streamed = Vec::new();
        let mut src = StreamingBamSource::new(&bam_path, &contigs).unwrap();
        while let Some(r) = src.next_read().unwrap() {
            streamed.push(r);
        }
        assert_eq!(streamed.len(), materialized.len());
        for (a, b) in streamed.iter().zip(materialized.iter()) {
            assert_eq!((a.contig, a.pos), (b.contig, b.pos));
        }
        std::fs::remove_dir_all(&dir).ok();
    }

    #[test]
    fn streaming_source_rejects_out_of_order() {
        let dir = std::env::temp_dir().join(format!(
            "rosalind-stream-bad-{}",
            std::time::SystemTime::now().duration_since(std::time::UNIX_EPOCH).unwrap().as_nanos()
        ));
        std::fs::create_dir_all(&dir).unwrap();
        let bam_path = dir.join("unsorted.bam");
        write_unsorted_test_bam(&bam_path); // two reads, descending pos on one contig

        let mut contigs = ContigSet::new();
        contigs.push("chr1", 1000);

        let mut src = StreamingBamSource::new(&bam_path, &contigs).unwrap();
        // First read OK; the second (lower pos) must error.
        let _ = src.next_read().unwrap();
        assert!(src.next_read().is_err(), "out-of-order read must be rejected");
        std::fs::remove_dir_all(&dir).ok();
    }

Add these test helpers to the same test module (writing minimal BAMs with bam::Writer + a header with two @SQs):

    fn test_header(contigs: &[(&str, usize)]) -> bam::Header {
        let mut header = bam::Header::new();
        for (name, len) in contigs {
            let mut rec = bam::header::HeaderRecord::new(b"SQ");
            rec.push_tag(b"SN", name);
            rec.push_tag(b"LN", &(*len as i64));
            header.push_record(&rec);
        }
        header
    }

    fn push_record(writer: &mut bam::Writer, header: &bam::HeaderView, tid: i32, pos: i64, seq: &[u8]) {
        let mut rec = Record::new();
        let cigar = CigarString(vec![Cigar::Match(seq.len() as u32)]);
        let qual = vec![30u8; seq.len()];
        rec.set(b"r", Some(&cigar), seq, &qual);
        rec.set_tid(tid);
        rec.set_pos(pos);
        rec.set_mapq(60);
        let _ = header;
        writer.write(&rec).unwrap();
    }

    fn write_sorted_test_bam(path: &Path) {
        let header = test_header(&[("chr1", 1000), ("chr2", 1000)]);
        let mut writer = bam::Writer::from_path(path, &header, bam::Format::Bam).unwrap();
        let hv = writer.header().clone();
        push_record(&mut writer, &hv, 0, 10, b"ACGT");
        push_record(&mut writer, &hv, 0, 20, b"ACGT");
        push_record(&mut writer, &hv, 1, 5, b"ACGT");
    }

    fn write_unsorted_test_bam(path: &Path) {
        let header = test_header(&[("chr1", 1000)]);
        let mut writer = bam::Writer::from_path(path, &header, bam::Format::Bam).unwrap();
        let hv = writer.header().clone();
        push_record(&mut writer, &hv, 0, 50, b"ACGT");
        push_record(&mut writer, &hv, 0, 10, b"ACGT"); // out of order
    }

(If Record::set's exact signature differs in 0.44.1, adapt the record construction to the version already used elsewhere in this test module — the goal is a tiny sorted/unsorted BAM. bam::Writer/bam::Header/HeaderRecord are rust-htslib 0.44.1 APIs.)

  • Step 2: Run them to verify they fail.

Run: cargo test --lib io::bam::tests::streaming 2>&1 | tail -20 Expected: compile error — StreamingBamSource does not exist.

  • Step 3: Extract the shared record mapping. In src/io/bam.rs, add a pub(crate) helper containing the per-record logic currently inline in read_bam_as_core_reads (lines mapping a Record to an AlignedRead), and rewrite read_bam_as_core_reads's loop to call it:
/// Map one BAM `Record` to a canonical `AlignedRead`, or `None` if it is
/// unmapped, has no tid, a negative pos, or a reference name absent from
/// `contigs`. Shared by `read_bam_as_core_reads` and `StreamingBamSource`.
pub(crate) fn record_to_aligned_read(
    rec: &bam::Record,
    header: &bam::HeaderView,
    contigs: &ContigSet,
) -> Result<Option<AlignedRead>, CoreError> {
    if rec.is_unmapped() {
        return Ok(None);
    }
    let tid = rec.tid();
    if tid < 0 {
        return Ok(None);
    }
    let name = std::str::from_utf8(header.tid2name(tid as u32))
        .map_err(|_| CoreError::MalformedRecord("BAM reference name is not UTF-8".into()))?;
    let contig = match contigs.by_name(name) {
        Some(c) => c.id,
        None => return Ok(None),
    };
    let pos0 = rec.pos();
    if pos0 < 0 {
        return Ok(None);
    }

    let mut cigar = Vec::new();
    for c in rec.cigar().iter() {
        let (kind, len) = match *c {
            BamCigar::Match(l) | BamCigar::Equal(l) | BamCigar::Diff(l) => (CigarOpKind::Match, l),
            BamCigar::Ins(l) => (CigarOpKind::Insertion, l),
            BamCigar::Del(l) => (CigarOpKind::Deletion, l),
            BamCigar::RefSkip(l) => (CigarOpKind::RefSkip, l),
            BamCigar::SoftClip(l) => (CigarOpKind::SoftClip, l),
            BamCigar::HardClip(l) => (CigarOpKind::HardClip, l),
            BamCigar::Pad(l) => (CigarOpKind::Pad, l),
        };
        cigar.push(CigarOp::new(kind, len));
    }

    let seq: Vec<u8> = rec.seq().as_bytes().iter().map(|b| b.to_ascii_uppercase()).collect();
    let qual: Vec<u8> = rec.qual().to_vec();

    Ok(Some(AlignedRead {
        contig,
        pos: Position(pos0 as u32),
        mapq: rec.mapq(),
        flags: SamFlags(rec.flags()),
        cigar,
        seq: Arc::from(seq.into_boxed_slice()),
        qual: Arc::from(qual.into_boxed_slice()),
    }))
}

Rewrite read_bam_as_core_reads's body to reuse it (keep its signature):

pub fn read_bam_as_core_reads(
    path: &Path,
    contigs: &ContigSet,
) -> Result<Vec<AlignedRead>, CoreError> {
    let mut reader = bam::Reader::from_path(path)
        .map_err(|e| CoreError::MalformedRecord(format!("open BAM {}: {e}", path.display())))?;
    let header = reader.header().to_owned();
    let mut out = Vec::new();
    for rec in reader.records() {
        let rec = rec.map_err(|e| CoreError::MalformedRecord(e.to_string()))?;
        if let Some(read) = record_to_aligned_read(&rec, &header, contigs)? {
            out.push(read);
        }
    }
    Ok(out)
}
  • Step 4: Add StreamingBamSource. In src/io/bam.rs (after BamSource), add (mirrors pileup_stream.rs's reader.read idiom; use rust_htslib::bam::Read as BamRead; is already imported in this file — if not, add it):
/// A bounded `ReadSource` over a **coordinate-sorted** BAM: pulls one record at a
/// time (never materialises the file). Enforces sort order via a `(contig_id, pos)`
/// monotonicity guard — `next_read` errors if a read arrives out of order (an
/// unsorted BAM, or one whose `@SQ` order disagrees with `contigs`).
pub struct StreamingBamSource<'a> {
    reader: bam::Reader,
    header: bam::HeaderView,
    contigs: &'a ContigSet,
    last: Option<(u32, u32)>,
}

impl<'a> StreamingBamSource<'a> {
    /// Open `path` for streaming, mapping reference names via `contigs`.
    pub fn new(path: &Path, contigs: &'a ContigSet) -> Result<Self, CoreError> {
        let reader = bam::Reader::from_path(path)
            .map_err(|e| CoreError::MalformedRecord(format!("open BAM {}: {e}", path.display())))?;
        let header = reader.header().to_owned();
        Ok(Self { reader, header, contigs, last: None })
    }
}

impl ReadSource for StreamingBamSource<'_> {
    fn next_read(&mut self) -> Result<Option<AlignedRead>, CoreError> {
        loop {
            let mut record = bam::Record::new();
            match self.reader.read(&mut record) {
                None => return Ok(None),
                Some(Err(e)) => return Err(CoreError::MalformedRecord(e.to_string())),
                Some(Ok(())) => {}
            }
            let Some(read) = record_to_aligned_read(&record, &self.header, self.contigs)? else {
                continue; // unmapped / absent contig / etc. — skip
            };
            let key = (read.contig, read.pos.0);
            if let Some(prev) = self.last {
                if key < prev {
                    return Err(CoreError::MalformedRecord(format!(
                        "alignments are not coordinate-sorted (or @SQ order disagrees with the \
                         index): read at contig {} pos {} follows contig {} pos {}",
                        key.0, key.1, prev.0, prev.1
                    )));
                }
            }
            self.last = Some(key);
            return Ok(Some(read));
        }
    }
}

NOTE: the let ... else { continue; } syntax is Rust 1.65+ (MSRV 1.72 — fine). If bam::HeaderView is not the type returned by reader.header().to_owned() in 0.44.1, use the same owned-header type pileup_stream.rs stores (reader.header().to_owned() there is assigned to a field; mirror it). CoreError::MalformedRecord(String) is the existing variant used throughout this file.

  • Step 5: Build + run the streaming tests + the existing BAM tests.

Run: cargo build --lib 2>&1 | grep -iE 'error|warning' (none), then cargo test --lib io::bam 2>&1 | tail -25 (the 2 new streaming tests + the existing bam tests pass — read_bam_as_core_reads is unchanged behaviorally), then cargo fmt --all.

  • Step 6: Commit.
git add src/io/bam.rs
git commit -m "feat(io/bam): StreamingBamSource — bounded, sort-guarded BAM read source" \
  -m "Streams one record at a time via bam::Reader::read (no full-file Vec), sharing the Record->AlignedRead mapping (extracted as record_to_aligned_read) with read_bam_as_core_reads. A (contig_id,pos) monotonicity guard rejects unsorted / index-order-mismatched BAMs. The bounded-reads foundation for whole-genome variants --index." \
  -m "Co-Authored-By: Claude Opus 4.7 (1M context) <noreply@anthropic.com>"

Task 2: working-set-tracking caller + the whole-genome drive (library)

Files:

  • Modify: src/call/pipeline.rs, src/call/mod.rs

  • Create: src/call/whole_genome.rs

  • Step 1: Add call_germline_region_tracked + delegate. In src/call/pipeline.rs, replace the body of call_germline_region so it delegates to a new tracked variant that also returns the max engine working set. (WorkingSet is crate::core::WorkingSet; PileupEngine::current_working_set(&self) -> WorkingSet exists. The engine is an Iterator; call .next() manually so it stays queryable.) Add the import use crate::core::WorkingSet; if not present.

/// Like [`call_germline_region`], but also returns the maximum pileup-engine
/// working set observed during the pass (the bounded-memory signal — the
/// foundation for the `variants` memory receipt and `rosalind plan`).
pub fn call_germline_region_tracked<S: ReadSource>(
    source: S,
    reference: Arc<[u8]>,
    contig: u32,
    region: Range<u32>,
    pileup_params: PileupParams,
    germline_params: &GermlineParams,
) -> Result<(Vec<(Locus, u8, GermlineCall)>, WorkingSet), CoreError> {
    let mut engine = PileupEngine::new(source, reference, contig, region, pileup_params);
    let mut out = Vec::new();
    let mut max_ws = WorkingSet { bytes: 0 };
    while let Some(column) = engine.next() {
        let column = column?;
        let ws = engine.current_working_set();
        if ws.bytes > max_ws.bytes {
            max_ws = ws;
        }
        if let Some(call) = call_germline(&column, germline_params) {
            out.push((column.locus, column.ref_base, call));
        }
    }
    Ok((out, max_ws))
}

and make the existing call_germline_region a thin wrapper (keeping its exact signature, so the 4 existing call sites are unchanged):

pub fn call_germline_region<S: ReadSource>(
    source: S,
    reference: Arc<[u8]>,
    contig: u32,
    region: Range<u32>,
    pileup_params: PileupParams,
    germline_params: &GermlineParams,
) -> Result<Vec<(Locus, u8, GermlineCall)>, CoreError> {
    let (sites, _ws) =
        call_germline_region_tracked(source, reference, contig, region, pileup_params, germline_params)?;
    Ok(sites)
}

(engine.next() requires the Iterator trait in scope — it is, via the prelude. If PileupEngine::new/current_working_set are not pub/pub(crate) reachable from pipeline.rs, they already are — pipeline.rs constructs the engine today.)

  • Step 2: Export the tracked fn. In src/call/mod.rs, add call_germline_region_tracked to the pub use pipeline::{…} line.

  • Step 3: Write the failing drive test. Create src/call/whole_genome.rs with the test first (and unimplemented!() stubs so it compiles-then-fails):

//! Bounded whole-genome germline calling over a coordinate-sorted read stream and
//! a persisted reference (`ReferenceView`). One sorted pass, partitioned per
//! contig by `PerContig`, reusing the per-contig caller — peak memory ≈ the
//! largest contig's reference + the pileup working set, independent of input size.

use std::ops::Range;
use std::sync::Arc;

use crate::call::{call_germline_region_tracked, GermlineParams};
use crate::call::pipeline::GermlineCall;
use crate::core::{AlignedRead, ContigSet, CoreError, Locus, WorkingSet};
use crate::genomics::ReferenceView;
use crate::pileup::{PileupParams, ReadSource};

/// Per-contig view over a shared sorted stream: yields contig `contig`'s reads,
/// then stops at (and buffers) the first read of a later contig.
struct PerContig<'s, S: ReadSource> {
    source: &'s mut S,
    contig: u32,
    peeked: &'s mut Option<AlignedRead>,
}

impl<S: ReadSource> ReadSource for PerContig<'_, S> {
    fn next_read(&mut self) -> Result<Option<AlignedRead>, CoreError> {
        if let Some(r) = self.peeked.take() {
            if r.contig == self.contig {
                return Ok(Some(r));
            }
            *self.peeked = Some(r); // belongs to a later contig — keep it, stop here
            return Ok(None);
        }
        match self.source.next_read()? {
            Some(r) if r.contig == self.contig => Ok(Some(r)),
            Some(r) => {
                *self.peeked = Some(r);
                Ok(None)
            }
            None => Ok(None),
        }
    }
}

/// Call germline variants across every contig of `contigs`, in id order, reading
/// each contig's reference from `ref_view`. Returns the accumulated
/// `(Locus, ref_base, call)` rows and the max pileup working set observed.
/// `source` MUST yield reads in `(contig, pos)` order (a `StreamingBamSource`
/// guards this); the per-contig partition relies on it.
pub fn call_germline_whole_genome<S: ReadSource>(
    mut source: S,
    ref_view: &ReferenceView,
    contigs: &ContigSet,
    pileup_params: PileupParams,
    germline_params: &GermlineParams,
) -> Result<(Vec<(Locus, u8, GermlineCall)>, WorkingSet), CoreError> {
    let _ = (&mut source, ref_view, contigs, pileup_params, germline_params);
    unimplemented!()
}

#[cfg(test)]
mod tests {
    use super::*;
    use crate::genomics::{GenomeIndex, IndexReader, IndexWriter};
    use crate::pileup::SliceSource;

    fn tmp(suffix: &str) -> std::path::PathBuf {
        let nanos = std::time::SystemTime::now()
            .duration_since(std::time::UNIX_EPOCH)
            .unwrap()
            .as_nanos();
        let d = std::env::temp_dir().join(format!("rosalind-wg-{suffix}-{nanos}"));
        std::fs::create_dir_all(&d).unwrap();
        d.join("ref.idx")
    }

    // A read fully matching `len` bases at (contig, pos).
    fn read_at(contig: u32, pos: u32, seq: &[u8]) -> AlignedRead {
        use crate::core::{CigarOp, CigarOpKind, Position, SamFlags};
        AlignedRead {
            contig,
            pos: Position(pos),
            mapq: 60,
            flags: SamFlags(0),
            cigar: vec![CigarOp::new(CigarOpKind::Match, seq.len() as u32)],
            seq: Arc::from(seq.to_vec().into_boxed_slice()),
            qual: Arc::from(vec![40u8; seq.len()].into_boxed_slice()),
        }
    }

    #[test]
    fn whole_genome_equals_per_contig_calls() {
        // Two contigs; reads with a clear SNV on each. Build an index for the
        // reference, then compare the whole-genome drive to per-contig calls.
        let idx_path = tmp("equal");
        let index = GenomeIndex::from_named_sequences(&[
            ("chr1".to_string(), b"ACGTACGTACGTACGTACGT".to_vec()),
            ("chr2".to_string(), b"TTTTGGGGCCCCAAAATTTT".to_vec()),
        ])
        .unwrap();
        IndexWriter::create(&idx_path).unwrap().write_genome_index(&index).unwrap();
        let loaded = IndexReader::open(&idx_path).unwrap();
        let rv = loaded.reference_view().unwrap();
        let contigs = loaded.contigs();

        // Reads (already (contig,pos)-sorted): depth on a few positions of each contig.
        let reads = vec![
            read_at(0, 0, b"ACGTACGT"),
            read_at(0, 0, b"ACGTACGT"),
            read_at(1, 0, b"TTTTGGGG"),
            read_at(1, 0, b"TTTTGGGG"),
        ];
        let pp = PileupParams::default();
        let gp = GermlineParams::default();

        let (rows, ws) =
            call_germline_whole_genome(SliceSource::new(reads.clone()), &rv, contigs, pp.clone(), &gp)
                .unwrap();
        // Every row's contig is a real contig id; rows are grouped by contig.
        assert!(rows.iter().all(|(l, _, _)| (l.contig as usize) < contigs.len()));
        assert!(ws.bytes >= 0); // working set tracked (>= 0 always; presence check)

        // Equivalence: union of per-contig call_germline_region over the same reads.
        let mut expected = Vec::new();
        for c in contigs.iter() {
            let mut buf = Vec::new();
            rv.decode_window(
                c.global_offset as usize,
                c.global_offset as usize + c.length as usize,
                &mut buf,
            );
            let cref: Arc<[u8]> = Arc::from(buf.as_slice());
            let creads: Vec<AlignedRead> =
                reads.iter().filter(|r| r.contig == c.id).cloned().collect();
            let sites = call_germline_region(
                SliceSource::new(creads),
                cref,
                c.id,
                0..c.length,
                pp.clone(),
                &gp,
            )
            .unwrap();
            expected.extend(sites);
        }
        assert_eq!(rows, expected, "whole-genome == per-contig union");

        let _ = std::fs::remove_dir_all(idx_path.parent().unwrap());
    }
}

(The test imports call_germline_region — add it to the use crate::call::{…} line in the test module. PileupParams/GermlineParams derive Clone — if not, construct fresh defaults per call instead of .clone(). GermlineCall/PileupParams/SliceSource paths: adjust the use to wherever they are actually exported — GermlineCall is in call::pipeline, SliceSource/PileupParams/ReadSource in pileup. If PileupParams is not Clone, replace pp.clone() with PileupParams::default().)

  • Step 4: Run it to verify it fails.

Run: cargo test --lib call::whole_genome 2>&1 | tail -20 Expected: FAIL — unimplemented!() panics in call_germline_whole_genome.

  • Step 5: Implement the drive. Replace the unimplemented!() body of call_germline_whole_genome:
pub fn call_germline_whole_genome<S: ReadSource>(
    mut source: S,
    ref_view: &ReferenceView,
    contigs: &ContigSet,
    pileup_params: PileupParams,
    germline_params: &GermlineParams,
) -> Result<(Vec<(Locus, u8, GermlineCall)>, WorkingSet), CoreError> {
    let mut rows = Vec::new();
    let mut max_ws = WorkingSet { bytes: 0 };
    let mut peeked: Option<AlignedRead> = None;
    let mut buf = Vec::new();

    for c in contigs.iter() {
        // Decode this contig's reference (peak = largest contig; bounded).
        let start = c.global_offset as usize;
        let end = c.global_offset as usize + c.length as usize;
        ref_view.decode_window(start, end, &mut buf);
        let reference: Arc<[u8]> = Arc::from(buf.as_slice());

        let per = PerContig { source: &mut source, contig: c.id, peeked: &mut peeked };
        let region: Range<u32> = 0..c.length;
        let (sites, ws) = call_germline_region_tracked(
            per,
            reference,
            c.id,
            region,
            pileup_params.clone(),
            germline_params,
        )?;
        if ws.bytes > max_ws.bytes {
            max_ws = ws;
        }
        rows.extend(sites);
    }

    Ok((rows, max_ws))
}

(pileup_params.clone() requires PileupParams: Clone — it does in this codebase (a small config struct). Contig fields id: u32, length: u32, global_offset: u64 are pub.)

  • Step 6: Register the module. In src/call/mod.rs, add mod whole_genome; and pub use whole_genome::call_germline_whole_genome;.

  • Step 7: Build + run the drive test + the full call/pileup suites.

Run: cargo build --lib 2>&1 | grep -iE 'error|warning' (none), then cargo test --lib call 2>&1 | tail -20 (the drive test + the existing call/pipeline tests pass — call_germline_region behavior unchanged via the wrapper), then cargo test --lib 2>&1 | grep -E "test result:" (no failures), then cargo fmt --all.

  • Step 8: Commit.
git add src/call/pipeline.rs src/call/whole_genome.rs src/call/mod.rs
git commit -m "feat(call): bounded whole-genome germline drive over a sorted stream + ReferenceView" \
  -m "call_germline_region_tracked surfaces the max pileup working set (call_germline_region delegates, signature unchanged). call_germline_whole_genome makes a single sorted pass, partitions per contig (PerContig adapter), decodes each contig's reference from ReferenceView, and reuses the per-contig caller — peak ≈ largest contig + working set, independent of input size. Verified == the per-contig union." \
  -m "Co-Authored-By: Claude Opus 4.7 (1M context) <noreply@anthropic.com>"

Task 3: variants --index CLI + multi-contig VCF

Files:

  • Modify: src/main.rs

  • Create: tests/variants_index.rs

  • Step 1: Write the failing integration tests. Create tests/variants_index.rs:

//! Phase B4 gates: `rosalind variants --index` — bounded, self-contained,
//! germline calling, parity with `--reference` on the same sorted BAM. Exercised
//! through the real `index -> align -> sort -> variants` CLI pipeline (no
//! rust-htslib dev-dependency; `--index` is BAM-only). Multi-contig calling is
//! gated by the `call::whole_genome` library test.

use std::env;
use std::path::{Path, PathBuf};
use std::process::Command;
use std::sync::atomic::{AtomicU64, Ordering};
use std::time::{SystemTime, UNIX_EPOCH};

fn bin() -> &'static str {
    env!("CARGO_BIN_EXE_rosalind")
}

fn tmpdir() -> PathBuf {
    static COUNTER: AtomicU64 = AtomicU64::new(0);
    let n = COUNTER.fetch_add(1, Ordering::Relaxed);
    let nanos = SystemTime::now().duration_since(UNIX_EPOCH).unwrap().as_nanos();
    let d = env::temp_dir().join(format!("rosalind-b4v-{nanos}-{n}"));
    std::fs::create_dir_all(&d).unwrap();
    d
}

fn run(args: &[&str]) -> std::process::Output {
    Command::new(bin()).args(args).output().expect("spawn rosalind")
}

fn write_fasta(dir: &Path, name: &str, seq: &str) -> PathBuf {
    let p = dir.join("ref.fa");
    std::fs::write(&p, format!(">{name}\n{seq}\n")).unwrap();
    p
}

// A FASTQ of reads that are substrings of `seq` (so they align), giving depth.
fn write_fastq(dir: &Path, seq: &str, starts: &[usize], len: usize) -> PathBuf {
    let p = dir.join("reads.fq");
    let mut s = String::new();
    for (i, &start) in starts.iter().enumerate() {
        let read = &seq[start..start + len];
        let qual: String = std::iter::repeat('I').take(len).collect();
        s.push_str(&format!("@r{i}\n{read}\n+\n{qual}\n"));
    }
    std::fs::write(&p, s).unwrap();
    p
}

/// `index` -> `align --format bam` -> `sort` -> returns `(idx, sorted.bam)`.
/// Single-contig (the aligner is single-contig); produces a real sorted BAM via
/// the repo's own pipeline so the streaming `--index` path has valid input.
fn build_index_and_sorted_bam(dir: &Path, fa: &Path, fq: &Path) -> (PathBuf, PathBuf) {
    let idx = dir.join("ref.idx");
    let raw = dir.join("raw.bam");
    let sorted = dir.join("sorted.bam");
    assert!(run(&["index", "--reference", fa.to_str().unwrap(), "--output", idx.to_str().unwrap()])
        .status
        .success());
    let a = run(&["align", "--reference", fa.to_str().unwrap(), "--reads", fq.to_str().unwrap(),
        "--format", "bam", "--output", raw.to_str().unwrap()]);
    assert!(a.status.success(), "align: {}", String::from_utf8_lossy(&a.stderr));
    let s = run(&["sort", "--input", raw.to_str().unwrap(), "--output", sorted.to_str().unwrap()]);
    assert!(s.status.success(), "sort: {}", String::from_utf8_lossy(&s.stderr));
    (idx, sorted)
}

fn vcf_records(out: &[u8]) -> Vec<String> {
    String::from_utf8_lossy(out)
        .lines()
        .filter(|l| !l.starts_with('#'))
        .map(|l| l.to_string())
        .collect()
}

#[test]
fn variants_index_matches_reference_on_the_same_sorted_bam() {
    let dir = tmpdir();
    let seq = "ACGTACGTACGTACGTACGTACGTACGTACGT"; // 32 bp
    let fa = write_fasta(&dir, "chr1", seq);
    let fq = write_fastq(&dir, seq, &[0, 0, 4, 4, 8], 16);
    let (idx, bam) = build_index_and_sorted_bam(&dir, &fa, &fq);

    // Same sorted BAM through both paths → identical reads → calls must match.
    let by_ref = run(&["variants", "--reference", fa.to_str().unwrap(), "--alignments", bam.to_str().unwrap()]);
    assert!(by_ref.status.success(), "--reference: {}", String::from_utf8_lossy(&by_ref.stderr));
    let by_idx = run(&["variants", "--index", idx.to_str().unwrap(), "--alignments", bam.to_str().unwrap()]);
    assert!(by_idx.status.success(), "--index: {}", String::from_utf8_lossy(&by_idx.stderr));

    // Record lines only (headers legitimately differ: sample name / ##contig set).
    assert_eq!(
        vcf_records(&by_ref.stdout),
        vcf_records(&by_idx.stdout),
        "variants --index records must match --reference on the same BAM"
    );
    std::fs::remove_dir_all(&dir).ok();
}

#[test]
fn variants_index_is_self_contained() {
    let dir = tmpdir();
    let seq = "ACGTACGTACGTACGTACGTACGTACGTACGT";
    let fa = write_fasta(&dir, "chr1", seq);
    let fq = write_fastq(&dir, seq, &[0, 0, 8], 16);
    let (idx, bam) = build_index_and_sorted_bam(&dir, &fa, &fq);
    std::fs::remove_file(&fa).unwrap(); // reference FASTA gone

    let out = run(&["variants", "--index", idx.to_str().unwrap(), "--alignments", bam.to_str().unwrap()]);
    assert!(out.status.success(), "must call from the index alone: {}", String::from_utf8_lossy(&out.stderr));
    std::fs::remove_dir_all(&dir).ok();
}

#[test]
fn variants_requires_exactly_one_reference_source() {
    let dir = tmpdir();
    let seq = "ACGTACGTACGTACGT";
    let fa = write_fasta(&dir, "chr1", seq);
    let fq = write_fastq(&dir, seq, &[0], 8);
    let (_idx, bam) = build_index_and_sorted_bam(&dir, &fa, &fq);
    // Neither --index nor --reference → error.
    let neither = run(&["variants", "--alignments", bam.to_str().unwrap()]);
    assert!(!neither.status.success(), "must require one of --index/--reference");
    std::fs::remove_dir_all(&dir).ok();
}

#[test]
fn variants_index_rejects_sam() {
    // --index requires a BAM; a .sam alignments file errors with guidance.
    let dir = tmpdir();
    let fa = write_fasta(&dir, "chr1", "ACGTACGTACGTACGT");
    let idx = dir.join("ref.idx");
    assert!(run(&["index", "--reference", fa.to_str().unwrap(), "--output", idx.to_str().unwrap()]).status.success());
    let sam = dir.join("reads.sam");
    std::fs::write(&sam, "@HD\tVN:1.6\tSO:coordinate\n@SQ\tSN:chr1\tLN:16\n").unwrap();
    let out = run(&["variants", "--index", idx.to_str().unwrap(), "--alignments", sam.to_str().unwrap()]);
    assert!(!out.status.success(), "--index with SAM must error");
    std::fs::remove_dir_all(&dir).ok();
}

NOTE: the test builds a real sorted BAM via the repo's own index → align → sort CLI (no rust-htslib dev-dependency, and it exercises the genuine pipeline). Parity runs --reference and --index over the same sorted BAM, so the reads are identical and only the reference source differs; record lines must match (headers legitimately differ — sample name / ##contig set). variants --reference defaults --chrom to the FASTA's record name, so omitting it is fine.

  • Step 2: Run them to verify they fail.

Run: cargo test --test variants_index 2>&1 | tail -20 Expected: failures — variants does not yet accept --index (the arg is unknown → non-zero exit), so the --index assertions fail.

  • Step 3: Update the Variants clap variant. In src/main.rs, change the Variants variant's reference field and add index + memory_budget_mb:
    /// Call germline variants from aligned reads (streaming pileup engine +
    /// calibrated, abstention-aware genotype-likelihood caller).
    Variants {
        /// Persisted index (`rosalind index`); calls all contigs, reference from
        /// the index. Mutually exclusive with `--reference`.
        #[arg(long, conflicts_with = "reference", required_unless_present = "reference")]
        index: Option<PathBuf>,
        /// Reference genome (FASTA) — single-contig path. Mutually exclusive with `--index`.
        #[arg(long, required_unless_present = "index")]
        reference: Option<PathBuf>,
        /// Alignments in SAM or BAM format (coordinate-sorted for `--index`).
        #[arg(long)]
        alignments: PathBuf,
        /// Chromosome name (single-contig `--reference` path only; defaults to the
        /// first FASTA record). Not allowed with `--index`.
        #[arg(long)]
        chrom: Option<String>,
        /// Starting offset (0-based) for the reference region (`--reference` only).
        #[arg(long, default_value_t = 0)]
        region_start: u32,
        /// Minimum MAPQ required for a read to be considered.
        #[arg(long, default_value_t = 0)]
        mapq_threshold: u8,
        /// Optional VCF output path (stdout if omitted).
        #[arg(short, long)]
        output: Option<PathBuf>,
        /// Deprecated and ignored.
        #[arg(long, default_value_t = 1024, hide = true)]
        block_size: usize,
        /// Minimum quality threshold for reporting variants.
        #[arg(long, default_value_t = 10.0)]
        quality_threshold: f32,
        /// Declared memory budget (MiB) for the run — records a plan/peak line; does
        /// not enforce (enforcement is a later phase). (`--index` path.)
        #[arg(long)]
        memory_budget_mb: Option<u64>,
    },

Update the match cli.command arm for Commands::Variants { … } to destructure the new fields (index, reference, memory_budget_mb) and dispatch:

        Commands::Variants {
            index,
            reference,
            alignments,
            chrom,
            region_start,
            mapq_threshold,
            output,
            block_size: _,
            quality_threshold,
            memory_budget_mb,
        } => {
            if let Some(index) = index {
                if chrom.is_some() || region_start != 0 {
                    bail!("--chrom/--region-start are not valid with --index (the whole index is called)");
                }
                run_variants_index(
                    index, alignments, mapq_threshold, output, quality_threshold, memory_budget_mb,
                )?
            } else {
                let reference = reference.expect("clap guarantees one of --index/--reference");
                run_variants(
                    reference, alignments, chrom, region_start, mapq_threshold, output, 1024,
                    quality_threshold,
                )?
            }
        }

Keep run_variants (the --reference path) as-is, but change its first param to take the resolved PathBuf (it already does). (If run_variants's signature took reference: PathBuf, it still does — we pass the unwrapped one.)

  • Step 4: Implement run_variants_index. Add this handler near run_variants in src/main.rs:
/// Call germline variants across all contigs of a persisted index (B4), reading
/// the reference from the index and streaming the (coordinate-sorted) BAM.
fn run_variants_index(
    index_path: PathBuf,
    alignments_path: PathBuf,
    mapq_threshold: u8,
    output: Option<PathBuf>,
    quality_threshold: f32,
    memory_budget_mb: Option<u64>,
) -> Result<()> {
    use rosalind::call::{call_germline_whole_genome, GermlineParams};
    use rosalind::genomics::IndexReader;
    use rosalind::io::bam::StreamingBamSource;
    use rosalind::io::vcf::{write_germline_vcf, GermlineRow};
    use rosalind::pileup::PileupParams;
    use rosalind::provenance::{blake3_file, write_manifest, FileHash, RunManifest};

    let loaded = IndexReader::open(&index_path)
        .with_context(|| format!("failed to open index {}", index_path.display()))?;
    let ref_view = loaded
        .reference_view()
        .with_context(|| format!("failed to read reference from index {}", index_path.display()))?;
    let contigs = loaded.contigs();

    let pileup_params = PileupParams { min_mapq: mapq_threshold, ..PileupParams::default() };
    let germline_params = GermlineParams { min_qual: quality_threshold as f64, ..GermlineParams::default() };

    // `--index` streams a coordinate-sorted BAM (the bounded, multi-contig WGS
    // path). SAM under `--index` is unsupported — the legacy SAM reader is
    // single-contig; use a sorted BAM (`rosalind sort`), or `--reference` for
    // single-contig SAM.
    let is_bam = alignments_path
        .extension()
        .and_then(|e| e.to_str())
        .map(|e| e.eq_ignore_ascii_case("bam"))
        .unwrap_or(false);
    if !is_bam {
        bail!(
            "--index requires a coordinate-sorted BAM (use `rosalind sort`); \
             for single-contig SAM use --reference"
        );
    }
    let source = StreamingBamSource::new(&alignments_path, contigs)
        .map_err(|e| anyhow!("failed to open BAM {}: {e}", alignments_path.display()))?;
    let (sites, _max_ws) =
        call_germline_whole_genome(source, &ref_view, contigs, pileup_params, &germline_params)
            .map_err(|e| anyhow!("variant calling failed: {e}"))?;

    let rows: Vec<GermlineRow> = sites
        .into_iter()
        .map(|(locus, ref_base, call)| GermlineRow { locus, ref_base, call })
        .collect();

    match output {
        Some(path) => {
            let file = File::create(&path)
                .with_context(|| format!("failed to create VCF file {}", path.display()))?;
            let mut writer = io::BufWriter::new(file);
            write_germline_vcf(&mut writer, contigs, "SAMPLE", &rows)?;
            writer.flush()?;
            drop(writer);
            let mut manifest = RunManifest::new("variants");
            manifest.inputs.push(FileHash { path: index_path.display().to_string(), blake3: blake3_file(&index_path)? });
            manifest.inputs.push(FileHash { path: alignments_path.display().to_string(), blake3: blake3_file(&alignments_path)? });
            manifest.outputs.push(FileHash { path: path.display().to_string(), blake3: blake3_file(&path)? });
            manifest.params.insert("mapq_threshold".to_string(), mapq_threshold.to_string());
            manifest.params.insert("min_qual".to_string(), (quality_threshold as f64).to_string());
            let manifest_path = write_manifest(&path, &manifest)?;
            eprintln!("wrote reproducibility receipt: {}", manifest_path.display());
        }
        None => {
            let stdout = io::stdout();
            let mut handle = stdout.lock();
            write_germline_vcf(&mut handle, contigs, "SAMPLE", &rows)?;
        }
    }
    let _ = memory_budget_mb; // wired in Task 4
    Ok(())
}

(No SAM helper is needed — --index is BAM-only. legacy_read_to_core/read_alignment_file remain used only by the single-contig --reference run_variants, unchanged.)

  • Step 5: Build + run the integration tests + suite.

Run: cargo build 2>&1 | grep -iE 'error|warning' (none), then cargo test --test variants_index 2>&1 | tail -25 (the 3 tests pass), then cargo test 2>&1 | grep -E "test result:" | grep -v "0 passed" (no failures), then cargo fmt --all.

  • Step 6: Commit.
git add src/main.rs tests/variants_index.rs
git commit -m "feat(cli): variants --index — bounded multi-contig calling over the persisted index" \
  -m "variants takes --index XOR --reference (exactly one). --index loads the index (ContigSet + ReferenceView), streams a sorted BAM (StreamingBamSource) or materialises a SAM, runs call_germline_whole_genome, and writes a multi-contig VCF + manifest (inputs = .idx + BAM). --chrom/--region-start error under --index. Parity with --reference on a single contig; self-contained (no FASTA)." \
  -m "Co-Authored-By: Claude Opus 4.7 (1M context) <noreply@anthropic.com>"

Task 4: memory receipt + record-only --memory-budget-mb

Files:

  • Modify: src/main.rs, tests/variants_index.rs

  • Step 1: Write the failing test. Append to tests/variants_index.rs:

#[test]
fn variants_index_memory_budget_reports_and_never_refuses() {
    let dir = tmpdir();
    let seq = "ACGTACGTACGTACGTACGTACGTACGTACGT";
    let fa = write_fasta(&dir, "chr1", seq);
    let fq = write_fastq(&dir, seq, &[0, 0, 8], 16);
    let (idx, bam) = build_index_and_sorted_bam(&dir, &fa, &fq);

    // Budget 0 → reported EXCEEDED, but the call still completes (record-only).
    let out = run(&[
        "variants", "--index", idx.to_str().unwrap(), "--alignments", bam.to_str().unwrap(),
        "--memory-budget-mb", "0",
    ]);
    assert!(out.status.success(), "must complete even when over budget: {}", String::from_utf8_lossy(&out.stderr));
    let stderr = String::from_utf8_lossy(&out.stderr);
    assert!(stderr.contains("peak RSS"), "receipt must report realized peak: {stderr}");
    assert!(stderr.contains("EXCEEDED") || stderr.contains("budget"), "budget verdict: {stderr}");
    std::fs::remove_dir_all(&dir).ok();
}
  • Step 2: Run it to verify it fails.

Run: cargo test --test variants_index variants_index_memory_budget 2>&1 | tail -15 Expected: FAIL — no "peak RSS"/budget line on stderr yet.

  • Step 3: Surface the memory receipt + budget. In run_variants_index (src/main.rs), capture the max working set and the realized peak RSS, record them in the manifest params, and print a stderr summary + the record-only budget verdict. Replace let (sites, _max_ws) = … to bind max_ws, and replace the trailing let _ = memory_budget_mb; block with the receipt logic.

Bind the working set (remove the _ so max_ws is used):

    let (sites, max_ws) = if is_bam { /* …unchanged… */ } else { /* …unchanged… */ };

Add the top-level import use rosalind::core::MemoryBudget; and use rosalind::util::rss::peak_rss_bytes; (the latter is already imported at the top of main.rs).

After writing the VCF (in BOTH the Some(path) and None branches, or once after the match), add the memory receipt. Simplest: compute + report after the match output { … } block, and also fold the two memory params into the manifest in the Some(path) branch. Concretely, replace the final let _ = memory_budget_mb; Ok(()) with:

    // Memory receipt: the bounded contract, made visible + verifiable.
    let peak_rss = peak_rss_bytes();
    eprintln!(
        "memory: peak RSS {} MiB; max pileup working set {} KiB",
        peak_rss / (1 << 20),
        max_ws.bytes / 1024
    );
    if let Some(mb) = memory_budget_mb {
        let budget = MemoryBudget::from_mb(mb);
        if budget.admits(peak_rss) {
            eprintln!("memory: within budget ({} MiB)", mb);
        } else {
            eprintln!(
                "memory: EXCEEDED budget {} MiB (realized peak {} MiB) — record-only, run completed",
                mb,
                peak_rss / (1 << 20)
            );
        }
    }
    Ok(())

And in the Some(path) branch's manifest, add the memory params before write_manifest (so the receipt file records them too):

            manifest.params.insert("peak_rss_bytes".to_string(), peak_rss_bytes().to_string());
            manifest.params.insert("max_working_set_bytes".to_string(), max_ws.bytes.to_string());

(Note: peak_rss_bytes() is monotonic peak — calling it in the manifest and again for the stderr line is fine; or compute let peak_rss = peak_rss_bytes(); once before the match and reuse. Prefer computing once before the match output and using it in both places.)

To keep it clean, compute let peak_rss = peak_rss_bytes(); immediately after binding (sites, max_ws), use peak_rss in the manifest params and the stderr block, and drop the duplicate call.

  • Step 4: Build + run the memory test + full suite.

Run: cargo build 2>&1 | grep -iE 'error|warning' (none), then cargo test --test variants_index 2>&1 | tail -20 (all 4 tests pass, incl. the budget test), then cargo test 2>&1 | grep -E "test result:" | grep -v "0 passed" (no failures), then cargo fmt --all.

  • Step 5: Commit.
git add src/main.rs tests/variants_index.rs
git commit -m "feat(cli): variants --index memory receipt + record-only --memory-budget-mb" \
  -m "Surfaces the bounded-memory contract: the run reports realized peak RSS + the engine's max pileup working set (to stderr and the manifest params). --memory-budget-mb flags overage against the realized peak but never aborts (enforcement is Phase C). Operationalizes Rosalind's differentiator — predictable, verifiable memory — on the flagship whole-genome workload." \
  -m "Co-Authored-By: Claude Opus 4.7 (1M context) <noreply@anthropic.com>"

Final verification (before the B4 PR)

  • cargo test — full suite green. Witnesses: io::bam streaming tests; call::whole_genome drive == per-contig union; tests/variants_index (parity vs --reference, self-contained, sort-rejection [via the streaming source test], budget-never-refuses).
  • cargo build 2>&1 | grep -iE 'error|warning' — clean.
  • cargo fmt --all -- --check — clean.
  • No-rebuild (structural): grep -n "run_variants_index" -A40 src/main.rs | grep -c "sais_u32\|BlockedFMIndex::build"0.
  • Streaming (structural): run_variants_index's BAM path uses StreamingBamSource (not read_bam_as_core_reads/BamSource), so reads are not materialised.

Self-Review

  • Spec coverage (2026-05-27-phase-b4-variants-index-design.md):
    • §2/§3 streaming reads ✔ Task 1 (StreamingBamSource, one record at a time); sort guard ✔ Task 1 ((contig_id,pos) monotonicity).
    • §2 working set surfaced ✔ Task 2 (call_germline_region_tracked) + Task 4 (receipt); §2 per-contig reference ✔ Task 2 (decode_window per contig).
    • §4 bounded multi-contig drive ✔ Task 2 (call_germline_whole_genome + PerContig, reusing call_germline_region).
    • §3/§6 variants --index + multi-contig VCF + manifest ✔ Task 3 (reuses write_germline_vcf's per-contig ##contig).
    • §5 memory receipt + record-only --memory-budget-mb ✔ Task 4.
    • §6 CLI --index XOR --reference, --chrom/--region-start error under --index ✔ Task 3.
    • §8 gates — bounded (streaming source, structural), self-contained ✔ Task 3, parity ✔ Task 3, sort-safety ✔ Task 1, reproducible/no-rebuild ✔ (final verification).
  • Type/name consistency: record_to_aligned_read(&Record,&HeaderView,&ContigSet)->Result<Option<AlignedRead>>; StreamingBamSource::new(&Path,&ContigSet); call_germline_region_tracked(...)->(Vec<(Locus,u8,GermlineCall)>,WorkingSet); call_germline_whole_genome(S,&ReferenceView,&ContigSet,PileupParams,&GermlineParams)->(rows,WorkingSet); GermlineRow{locus,ref_base,call}; write_germline_vcf(out,&ContigSet,&str,&[GermlineRow]). All consistent across tasks and matching the merged APIs (ReferenceView::decode_window, IndexReader::open/reference_view/contigs, MemoryBudget::{from_mb,admits}, peak_rss_bytes).
  • No placeholders: every step ships complete code or an exact command + expected output; the one transient unimplemented!() (Task 2 drive stub) is replaced in the same task. The clearly-flagged "adapt to the actual 0.44.1/legacy-SAM API" notes point at named in-tree references (pileup_stream.rs's reader.read idiom; legacy_read_to_core) to copy, not vague instructions.
  • MSRV 1.72: let…else (1.65), conflicts_with/required_unless_present (clap 4.5), no div_ceil.
  • DRY/reuse: shares record_to_aligned_read; call_germline_region delegates to _tracked (no duplicate loop); reuses call_germline_region, write_germline_vcf, the manifest, MemoryBudget, peak_rss_bytes unchanged.
  • Scope: germline variants only; aligner/somatic --index/SAM-streaming/on-demand-ref_base/enforcement deferred.
  • Shared-tree hazard: each implementer/reviewer dispatch must forbid cargo fix/mutating git, stage only named files, self-verify git show --stat HEAD; coordinator verifies stat + clean tree at every task boundary.