What is underline within amino acid for CDR3?

[Theragen-Bio]

I found the "" underline within amino acid for CDR3.
For example, the nucleotide sequence for CDR3 was TGCAGTCCCTACGGGCAGATACTACGAGCAGTACTTC,
the putative amino acid from mixcr was CSPYGQ_YYEQYF, however, in silico translation was quite different "CSPYGQILRAVL".
Are there any special meaning for ""?

[mizraelson]

Hi,
Could you please send the version of MiXCR, exact commands you used for the analysis, and MiXCR reports?