diff --git a/.devcontainer/devcontainer.json b/.devcontainer/devcontainer.json index ea27a58..b290e09 100644 --- a/.devcontainer/devcontainer.json +++ b/.devcontainer/devcontainer.json @@ -2,6 +2,7 @@ "name": "nfcore", "image": "nfcore/gitpod:latest", "remoteUser": "gitpod", + "runArgs": ["--privileged"], // Configure tool-specific properties. "customizations": { @@ -9,15 +10,7 @@ "vscode": { // Set *default* container specific settings.json values on container create. "settings": { - "python.defaultInterpreterPath": "/opt/conda/bin/python", - "python.linting.enabled": true, - "python.linting.pylintEnabled": true, - "python.formatting.autopep8Path": "/opt/conda/bin/autopep8", - "python.formatting.yapfPath": "/opt/conda/bin/yapf", - "python.linting.flake8Path": "/opt/conda/bin/flake8", - "python.linting.pycodestylePath": "/opt/conda/bin/pycodestyle", - "python.linting.pydocstylePath": "/opt/conda/bin/pydocstyle", - "python.linting.pylintPath": "/opt/conda/bin/pylint" + "python.defaultInterpreterPath": "/opt/conda/bin/python" }, // Add the IDs of extensions you want installed when the container is created. diff --git a/.editorconfig b/.editorconfig index 66de8d3..e88c64b 100644 --- a/.editorconfig +++ b/.editorconfig @@ -18,7 +18,16 @@ end_of_line = unset insert_final_newline = unset trim_trailing_whitespace = unset indent_style = unset -indent_size = unset +[/subworkflows/nf-core/**] +charset = unset +end_of_line = unset +insert_final_newline = unset +trim_trailing_whitespace = unset +indent_style = unset [/assets/email*] indent_size = unset + +# ignore python and markdown +[*.{py,md}] +indent_style = unset diff --git a/.github/CONTRIBUTING.md b/.github/CONTRIBUTING.md index 26c2813..3939591 100644 --- a/.github/CONTRIBUTING.md +++ b/.github/CONTRIBUTING.md @@ -9,6 +9,7 @@ Please use the pre-filled template to save time. However, don't be put off by this template - other more general issues and suggestions are welcome! Contributions to the code are even more welcome ;) +> [!NOTE] > If you need help using or modifying nf-core/marsseq then the best place to ask is on the nf-core Slack [#marsseq](https://nfcore.slack.com/channels/marsseq) channel ([join our Slack here](https://nf-co.re/join/slack)). ## Contribution workflow @@ -18,13 +19,19 @@ If you'd like to write some code for nf-core/marsseq, the standard workflow is a 1. Check that there isn't already an issue about your idea in the [nf-core/marsseq issues](https://github.com/nf-core/marsseq/issues) to avoid duplicating work. If there isn't one already, please create one so that others know you're working on this 2. [Fork](https://help.github.com/en/github/getting-started-with-github/fork-a-repo) the [nf-core/marsseq repository](https://github.com/nf-core/marsseq) to your GitHub account 3. Make the necessary changes / additions within your forked repository following [Pipeline conventions](#pipeline-contribution-conventions) -4. Use `nf-core schema build` and add any new parameters to the pipeline JSON schema (requires [nf-core tools](https://github.com/nf-core/tools) >= 1.10). +4. Use `nf-core pipelines schema build` and add any new parameters to the pipeline JSON schema (requires [nf-core tools](https://github.com/nf-core/tools) >= 1.10). 5. Submit a Pull Request against the `dev` branch and wait for the code to be reviewed and merged If you're not used to this workflow with git, you can start with some [docs from GitHub](https://help.github.com/en/github/collaborating-with-issues-and-pull-requests) or even their [excellent `git` resources](https://try.github.io/). ## Tests +You have the option to test your changes locally by running the pipeline. For receiving warnings about process selectors and other `debug` information, it is recommended to use the debug profile. Execute all the tests with the following command: + +```bash +nf-test test --profile debug,test,docker --verbose +``` + When you create a pull request with changes, [GitHub Actions](https://github.com/features/actions) will run automatic tests. Typically, pull-requests are only fully reviewed when these tests are passing, though of course we can help out before then. @@ -33,7 +40,7 @@ There are typically two types of tests that run: ### Lint tests `nf-core` has a [set of guidelines](https://nf-co.re/developers/guidelines) which all pipelines must adhere to. -To enforce these and ensure that all pipelines stay in sync, we have developed a helper tool which runs checks on the pipeline code. This is in the [nf-core/tools repository](https://github.com/nf-core/tools) and once installed can be run locally with the `nf-core lint ` command. +To enforce these and ensure that all pipelines stay in sync, we have developed a helper tool which runs checks on the pipeline code. This is in the [nf-core/tools repository](https://github.com/nf-core/tools) and once installed can be run locally with the `nf-core pipelines lint ` command. If any failures or warnings are encountered, please follow the listed URL for more documentation. @@ -68,7 +75,7 @@ If you wish to contribute a new step, please use the following coding standards: 2. Write the process block (see below). 3. Define the output channel if needed (see below). 4. Add any new parameters to `nextflow.config` with a default (see below). -5. Add any new parameters to `nextflow_schema.json` with help text (via the `nf-core schema build` tool). +5. Add any new parameters to `nextflow_schema.json` with help text (via the `nf-core pipelines schema build` tool). 6. Add sanity checks and validation for all relevant parameters. 7. Perform local tests to validate that the new code works as expected. 8. If applicable, add a new test command in `.github/workflow/ci.yml`. @@ -79,13 +86,13 @@ If you wish to contribute a new step, please use the following coding standards: Parameters should be initialised / defined with default values in `nextflow.config` under the `params` scope. -Once there, use `nf-core schema build` to add to `nextflow_schema.json`. +Once there, use `nf-core pipelines schema build` to add to `nextflow_schema.json`. ### Default processes resource requirements -Sensible defaults for process resource requirements (CPUs / memory / time) for a process should be defined in `conf/base.config`. These should generally be specified generic with `withLabel:` selectors so they can be shared across multiple processes/steps of the pipeline. A nf-core standard set of labels that should be followed where possible can be seen in the [nf-core pipeline template](https://github.com/nf-core/tools/blob/master/nf_core/pipeline-template/conf/base.config), which has the default process as a single core-process, and then different levels of multi-core configurations for increasingly large memory requirements defined with standardised labels. +Sensible defaults for process resource requirements (CPUs / memory / time) for a process should be defined in `conf/base.config`. These should generally be specified generic with `withLabel:` selectors so they can be shared across multiple processes/steps of the pipeline. A nf-core standard set of labels that should be followed where possible can be seen in the [nf-core pipeline template](https://github.com/nf-core/tools/blob/main/nf_core/pipeline-template/conf/base.config), which has the default process as a single core-process, and then different levels of multi-core configurations for increasingly large memory requirements defined with standardised labels. -The process resources can be passed on to the tool dynamically within the process with the `${task.cpu}` and `${task.memory}` variables in the `script:` block. +The process resources can be passed on to the tool dynamically within the process with the `${task.cpus}` and `${task.memory}` variables in the `script:` block. ### Naming schemes @@ -96,7 +103,7 @@ Please use the following naming schemes, to make it easy to understand what is g ### Nextflow version bumping -If you are using a new feature from core Nextflow, you may bump the minimum required version of nextflow in the pipeline with: `nf-core bump-version --nextflow . [min-nf-version]` +If you are using a new feature from core Nextflow, you may bump the minimum required version of nextflow in the pipeline with: `nf-core pipelines bump-version --nextflow . [min-nf-version]` ### Images and figures diff --git a/.github/PULL_REQUEST_TEMPLATE.md b/.github/PULL_REQUEST_TEMPLATE.md index 8b2910e..aa59bd5 100644 --- a/.github/PULL_REQUEST_TEMPLATE.md +++ b/.github/PULL_REQUEST_TEMPLATE.md @@ -17,8 +17,9 @@ Learn more about contributing: [CONTRIBUTING.md](https://github.com/nf-core/mars - [ ] If you've fixed a bug or added code that should be tested, add tests! - [ ] If you've added a new tool - have you followed the pipeline conventions in the [contribution docs](https://github.com/nf-core/marsseq/tree/master/.github/CONTRIBUTING.md) - [ ] If necessary, also make a PR on the nf-core/marsseq _branch_ on the [nf-core/test-datasets](https://github.com/nf-core/test-datasets) repository. -- [ ] Make sure your code lints (`nf-core lint`). +- [ ] Make sure your code lints (`nf-core pipelines lint`). - [ ] Ensure the test suite passes (`nextflow run . -profile test,docker --outdir `). +- [ ] Check for unexpected warnings in debug mode (`nextflow run . -profile debug,test,docker --outdir `). - [ ] Usage Documentation in `docs/usage.md` is updated. - [ ] Output Documentation in `docs/output.md` is updated. - [ ] `CHANGELOG.md` is updated. diff --git a/.github/workflows/awsfulltest.yml b/.github/workflows/awsfulltest.yml index 763a173..ef78836 100644 --- a/.github/workflows/awsfulltest.yml +++ b/.github/workflows/awsfulltest.yml @@ -1,40 +1,36 @@ name: nf-core AWS full size tests -# This workflow is triggered on published releases. +# This workflow is triggered on PRs opened against the master branch. # It can be additionally triggered manually with GitHub actions workflow dispatch button. # It runs the -profile 'test_full' on AWS batch on: - release: - types: [published] + pull_request: + branches: + - master workflow_dispatch: + pull_request_review: + types: [submitted] + jobs: - run-tower: + run-platform: name: Run AWS full tests - if: github.repository == 'nf-core/marsseq' + # run only if the PR is approved by at least 2 reviewers and against the master branch or manually triggered + if: github.repository == 'nf-core/marsseq' && github.event.review.state == 'approved' && github.event.pull_request.base.ref == 'master' || github.event_name == 'workflow_dispatch' runs-on: ubuntu-latest steps: - - name: Launch build-reference workflow via tower - uses: seqeralabs/action-tower-launch@v2 - with: - workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} - access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} - compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} - revision: ${{ github.sha }} - workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/marsseq/work-${{ github.sha }} - parameters: | - { - "hook_url": "${{ secrets.MEGATESTS_ALERTS_SLACK_HOOK_URL }}", - "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/marsseq/results-${{ github.sha }}", - "build_references": true, - "velocity": true - } - profiles: test_full,aws_tower - - uses: actions/upload-artifact@v3 + - uses: octokit/request-action@v2.x + id: check_approvals with: - name: Tower debug log file - path: tower_action_*.log - - - name: Launch execution workflow via tower + route: GET /repos/${{ github.repository }}/pulls/${{ github.event.pull_request.number }}/reviews + env: + GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} + - id: test_variables + if: github.event_name != 'workflow_dispatch' + run: | + JSON_RESPONSE='${{ steps.check_approvals.outputs.data }}' + CURRENT_APPROVALS_COUNT=$(echo $JSON_RESPONSE | jq -c '[.[] | select(.state | contains("APPROVED")) ] | length') + test $CURRENT_APPROVALS_COUNT -ge 2 || exit 1 # At least 2 approvals are required + - name: Launch workflow via Seqera Platform uses: seqeralabs/action-tower-launch@v2 with: workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} @@ -45,15 +41,13 @@ jobs: parameters: | { "hook_url": "${{ secrets.MEGATESTS_ALERTS_SLACK_HOOK_URL }}", - "genomes_base": "s3://${{ secrets.AWS_S3_BUCKET }}/marsseq/results-${{ github.sha }}/references", "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/marsseq/results-${{ github.sha }}", - "velocity": true } - profiles: test_full + profiles: test_full,aws_tower - - uses: actions/upload-artifact@v3 + - uses: actions/upload-artifact@v4 with: - name: Tower debug log file + name: Seqera Platform debug log file path: | - tower_action_*.log - tower_action_*.json + seqera_platform_action_*.log + seqera_platform_action_*.json diff --git a/.github/workflows/awstest.yml b/.github/workflows/awstest.yml index 448b609..dd8ef79 100644 --- a/.github/workflows/awstest.yml +++ b/.github/workflows/awstest.yml @@ -5,13 +5,13 @@ name: nf-core AWS test on: workflow_dispatch: jobs: - run-tower: + run-platform: name: Run AWS tests if: github.repository == 'nf-core/marsseq' runs-on: ubuntu-latest steps: - # Launch workflow using Tower CLI tool action - - name: Launch build-reference workflow via tower + # Launch workflow using Seqera Platform CLI tool action + - name: Launch workflow via Seqera Platform uses: seqeralabs/action-tower-launch@v2 with: workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} @@ -22,33 +22,12 @@ jobs: parameters: | { "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/marsseq/results-test-${{ github.sha }}", - "build_references": true, - "velocity": true - } - profiles: test,aws_tower - - uses: actions/upload-artifact@v3 - with: - name: Tower debug log file - path: tower_action_*.log - - - name: Launch execution workflow via tower - uses: seqeralabs/action-tower-launch@v2 - with: - workspace_id: ${{ secrets.TOWER_WORKSPACE_ID }} - access_token: ${{ secrets.TOWER_ACCESS_TOKEN }} - compute_env: ${{ secrets.TOWER_COMPUTE_ENV }} - workdir: s3://${{ secrets.AWS_S3_BUCKET }}/work/marsseq/work-${{ github.sha }} - parameters: | - { - "genomes_base": "s3://${{ secrets.AWS_S3_BUCKET }}/marsseq/results-test-${{ github.sha }}/references", - "outdir": "s3://${{ secrets.AWS_S3_BUCKET }}/marsseq/results-test-${{ github.sha }}", - "velocity": true } profiles: test - - uses: actions/upload-artifact@v3 + - uses: actions/upload-artifact@v4 with: - name: Tower debug log file + name: Seqera Platform debug log file path: | - tower_action_*.log - tower_action_*.json + seqera_platform_action_*.log + seqera_platform_action_*.json diff --git a/.github/workflows/branch.yml b/.github/workflows/branch.yml index 2bfb1da..a2c69db 100644 --- a/.github/workflows/branch.yml +++ b/.github/workflows/branch.yml @@ -19,7 +19,7 @@ jobs: # NOTE - this doesn't currently work if the PR is coming from a fork, due to limitations in GitHub actions secrets - name: Post PR comment if: failure() - uses: mshick/add-pr-comment@v1 + uses: mshick/add-pr-comment@b8f338c590a895d50bcbfa6c5859251edc8952fc # v2 with: message: | ## This PR is against the `master` branch :x: diff --git a/.github/workflows/ci.yml b/.github/workflows/ci.yml index 540d7f4..32a09b6 100644 --- a/.github/workflows/ci.yml +++ b/.github/workflows/ci.yml @@ -7,9 +7,12 @@ on: pull_request: release: types: [published] + workflow_dispatch: env: NXF_ANSI_LOG: false + NXF_SINGULARITY_CACHEDIR: ${{ github.workspace }}/.singularity + NXF_SINGULARITY_LIBRARYDIR: ${{ github.workspace }}/.singularity concurrency: group: "${{ github.workflow }}-${{ github.event.pull_request.number || github.ref }}" @@ -17,30 +20,66 @@ concurrency: jobs: test: - name: Run pipeline with test data + name: "Run pipeline with test data (${{ matrix.NXF_VER }} | ${{ matrix.test_name }} | ${{ matrix.profile }})" # Only run on push if this is the nf-core dev branch (merged PRs) if: "${{ github.event_name != 'push' || (github.event_name == 'push' && github.repository == 'nf-core/marsseq') }}" runs-on: ubuntu-latest strategy: matrix: NXF_VER: - - "23.04.0" + - "24.04.2" - "latest-everything" + profile: + - "conda" + - "docker" + - "singularity" + test_name: + - "test" + isMaster: + - ${{ github.base_ref == 'master' }} + # Exclude conda and singularity on dev + exclude: + - isMaster: false + profile: "conda" + - isMaster: false + profile: "singularity" steps: - name: Check out pipeline code - uses: actions/checkout@v3 + uses: actions/checkout@0ad4b8fadaa221de15dcec353f45205ec38ea70b # v4 - - name: Install Nextflow - uses: nf-core/setup-nextflow@v1 + - name: Set up Nextflow + uses: nf-core/setup-nextflow@v2 with: version: "${{ matrix.NXF_VER }}" - - name: Dry test reference build + - name: Set up Apptainer + if: matrix.profile == 'singularity' + uses: eWaterCycle/setup-apptainer@main + + - name: Set up Singularity + if: matrix.profile == 'singularity' + run: | + mkdir -p $NXF_SINGULARITY_CACHEDIR + mkdir -p $NXF_SINGULARITY_LIBRARYDIR + + - name: Set up Miniconda + if: matrix.profile == 'conda' + uses: conda-incubator/setup-miniconda@a4260408e20b96e80095f42ff7f1a15b27dd94ca # v3 + with: + miniconda-version: "latest" + auto-update-conda: true + conda-solver: libmamba + channels: conda-forge,bioconda + + - name: Set up Conda + if: matrix.profile == 'conda' run: | - nextflow run ${GITHUB_WORKSPACE} -profile test,docker -stub \ - --build_references --velocity --outdir ./results + echo $(realpath $CONDA)/condabin >> $GITHUB_PATH + echo $(realpath python) >> $GITHUB_PATH + + - name: Clean up Disk space + uses: jlumbroso/free-disk-space@54081f138730dfa15788a46383842cd2f914a1be # v1.3.1 - - name: Dry test pipeline + - name: "Run pipeline with test data ${{ matrix.NXF_VER }} | ${{ matrix.test_name }} | ${{ matrix.profile }}" run: | - nextflow run ${GITHUB_WORKSPACE} -profile test,docker -stub \ - --genomes_base ./results/references --velocity --outdir ./results + nextflow run ${GITHUB_WORKSPACE} -profile ${{ matrix.test_name }},${{ matrix.profile }} -stub --outdir ./results diff --git a/.github/workflows/clean-up.yml b/.github/workflows/clean-up.yml index 694e90e..0b6b1f2 100644 --- a/.github/workflows/clean-up.yml +++ b/.github/workflows/clean-up.yml @@ -10,7 +10,7 @@ jobs: issues: write pull-requests: write steps: - - uses: actions/stale@v7 + - uses: actions/stale@28ca1036281a5e5922ead5184a1bbf96e5fc984e # v9 with: stale-issue-message: "This issue has been tagged as awaiting-changes or awaiting-feedback by an nf-core contributor. Remove stale label or add a comment otherwise this issue will be closed in 20 days." stale-pr-message: "This PR has been tagged as awaiting-changes or awaiting-feedback by an nf-core contributor. Remove stale label or add a comment if it is still useful." diff --git a/.github/workflows/download_pipeline.yml b/.github/workflows/download_pipeline.yml new file mode 100644 index 0000000..713dc3e --- /dev/null +++ b/.github/workflows/download_pipeline.yml @@ -0,0 +1,119 @@ +name: Test successful pipeline download with 'nf-core pipelines download' + +# Run the workflow when: +# - dispatched manually +# - when a PR is opened or reopened to master branch +# - the head branch of the pull request is updated, i.e. if fixes for a release are pushed last minute to dev. +on: + workflow_dispatch: + inputs: + testbranch: + description: "The specific branch you wish to utilize for the test execution of nf-core pipelines download." + required: true + default: "dev" + pull_request: + types: + - opened + - edited + - synchronize + branches: + - master + pull_request_target: + branches: + - master + +env: + NXF_ANSI_LOG: false + +jobs: + download: + runs-on: ubuntu-latest + steps: + - name: Install Nextflow + uses: nf-core/setup-nextflow@v2 + + - name: Disk space cleanup + uses: jlumbroso/free-disk-space@54081f138730dfa15788a46383842cd2f914a1be # v1.3.1 + + - uses: actions/setup-python@82c7e631bb3cdc910f68e0081d67478d79c6982d # v5 + with: + python-version: "3.12" + architecture: "x64" + + - name: Setup Apptainer + uses: eWaterCycle/setup-apptainer@4bb22c52d4f63406c49e94c804632975787312b3 # v2.0.0 + with: + apptainer-version: 1.3.4 + + - name: Install dependencies + run: | + python -m pip install --upgrade pip + pip install git+https://github.com/nf-core/tools.git@dev + + - name: Get the repository name and current branch set as environment variable + run: | + echo "REPO_LOWERCASE=${GITHUB_REPOSITORY,,}" >> ${GITHUB_ENV} + echo "REPOTITLE_LOWERCASE=$(basename ${GITHUB_REPOSITORY,,})" >> ${GITHUB_ENV} + echo "REPO_BRANCH=${{ github.event.inputs.testbranch || 'dev' }}" >> ${GITHUB_ENV} + + - name: Make a cache directory for the container images + run: | + mkdir -p ./singularity_container_images + + - name: Download the pipeline + env: + NXF_SINGULARITY_CACHEDIR: ./singularity_container_images + run: | + nf-core pipelines download ${{ env.REPO_LOWERCASE }} \ + --revision ${{ env.REPO_BRANCH }} \ + --outdir ./${{ env.REPOTITLE_LOWERCASE }} \ + --compress "none" \ + --container-system 'singularity' \ + --container-library "quay.io" -l "docker.io" -l "community.wave.seqera.io" \ + --container-cache-utilisation 'amend' \ + --download-configuration 'yes' + + - name: Inspect download + run: tree ./${{ env.REPOTITLE_LOWERCASE }} + + - name: Count the downloaded number of container images + id: count_initial + run: | + image_count=$(ls -1 ./singularity_container_images | wc -l | xargs) + echo "Initial container image count: $image_count" + echo "IMAGE_COUNT_INITIAL=$image_count" >> ${GITHUB_ENV} + + - name: Run the downloaded pipeline (stub) + id: stub_run_pipeline + continue-on-error: true + env: + NXF_SINGULARITY_CACHEDIR: ./singularity_container_images + NXF_SINGULARITY_HOME_MOUNT: true + run: nextflow run ./${{ env.REPOTITLE_LOWERCASE }}/$( sed 's/\W/_/g' <<< ${{ env.REPO_BRANCH }}) -stub -profile test,singularity --outdir ./results + - name: Run the downloaded pipeline (stub run not supported) + id: run_pipeline + if: ${{ job.steps.stub_run_pipeline.status == failure() }} + env: + NXF_SINGULARITY_CACHEDIR: ./singularity_container_images + NXF_SINGULARITY_HOME_MOUNT: true + run: nextflow run ./${{ env.REPOTITLE_LOWERCASE }}/$( sed 's/\W/_/g' <<< ${{ env.REPO_BRANCH }}) -profile test,singularity --outdir ./results + + - name: Count the downloaded number of container images + id: count_afterwards + run: | + image_count=$(ls -1 ./singularity_container_images | wc -l | xargs) + echo "Post-pipeline run container image count: $image_count" + echo "IMAGE_COUNT_AFTER=$image_count" >> ${GITHUB_ENV} + + - name: Compare container image counts + run: | + if [ "${{ env.IMAGE_COUNT_INITIAL }}" -ne "${{ env.IMAGE_COUNT_AFTER }}" ]; then + initial_count=${{ env.IMAGE_COUNT_INITIAL }} + final_count=${{ env.IMAGE_COUNT_AFTER }} + difference=$((final_count - initial_count)) + echo "$difference additional container images were \n downloaded at runtime . The pipeline has no support for offline runs!" + tree ./singularity_container_images + exit 1 + else + echo "The pipeline can be downloaded successfully!" + fi diff --git a/.github/workflows/fix-linting.yml b/.github/workflows/fix-linting.yml index 50b1f2f..ff2da06 100644 --- a/.github/workflows/fix-linting.yml +++ b/.github/workflows/fix-linting.yml @@ -4,7 +4,7 @@ on: types: [created] jobs: - deploy: + fix-linting: # Only run if comment is on a PR with the main repo, and if it contains the magic keywords if: > contains(github.event.comment.html_url, '/pull/') && @@ -13,10 +13,17 @@ jobs: runs-on: ubuntu-latest steps: # Use the @nf-core-bot token to check out so we can push later - - uses: actions/checkout@v3 + - uses: actions/checkout@0ad4b8fadaa221de15dcec353f45205ec38ea70b # v4 with: token: ${{ secrets.nf_core_bot_auth_token }} + # indication that the linting is being fixed + - name: React on comment + uses: peter-evans/create-or-update-comment@71345be0265236311c031f5c7866368bd1eff043 # v4 + with: + comment-id: ${{ github.event.comment.id }} + reactions: eyes + # Action runs on the issue comment, so we don't get the PR by default # Use the gh cli to check out the PR - name: Checkout Pull Request @@ -24,32 +31,59 @@ jobs: env: GITHUB_TOKEN: ${{ secrets.nf_core_bot_auth_token }} - - uses: actions/setup-node@v3 + # Install and run pre-commit + - uses: actions/setup-python@82c7e631bb3cdc910f68e0081d67478d79c6982d # v5 + with: + python-version: "3.12" - - name: Install Prettier - run: npm install -g prettier @prettier/plugin-php + - name: Install pre-commit + run: pip install pre-commit - # Check that we actually need to fix something - - name: Run 'prettier --check' - id: prettier_status - run: | - if prettier --check ${GITHUB_WORKSPACE}; then - echo "result=pass" >> $GITHUB_OUTPUT - else - echo "result=fail" >> $GITHUB_OUTPUT - fi + - name: Run pre-commit + id: pre-commit + run: pre-commit run --all-files + continue-on-error: true - - name: Run 'prettier --write' - if: steps.prettier_status.outputs.result == 'fail' - run: prettier --write ${GITHUB_WORKSPACE} + # indication that the linting has finished + - name: react if linting finished succesfully + if: steps.pre-commit.outcome == 'success' + uses: peter-evans/create-or-update-comment@71345be0265236311c031f5c7866368bd1eff043 # v4 + with: + comment-id: ${{ github.event.comment.id }} + reactions: "+1" - name: Commit & push changes - if: steps.prettier_status.outputs.result == 'fail' + id: commit-and-push + if: steps.pre-commit.outcome == 'failure' run: | git config user.email "core@nf-co.re" git config user.name "nf-core-bot" git config push.default upstream git add . git status - git commit -m "[automated] Fix linting with Prettier" + git commit -m "[automated] Fix code linting" git push + + - name: react if linting errors were fixed + id: react-if-fixed + if: steps.commit-and-push.outcome == 'success' + uses: peter-evans/create-or-update-comment@71345be0265236311c031f5c7866368bd1eff043 # v4 + with: + comment-id: ${{ github.event.comment.id }} + reactions: hooray + + - name: react if linting errors were not fixed + if: steps.commit-and-push.outcome == 'failure' + uses: peter-evans/create-or-update-comment@71345be0265236311c031f5c7866368bd1eff043 # v4 + with: + comment-id: ${{ github.event.comment.id }} + reactions: confused + + - name: react if linting errors were not fixed + if: steps.commit-and-push.outcome == 'failure' + uses: peter-evans/create-or-update-comment@71345be0265236311c031f5c7866368bd1eff043 # v4 + with: + issue-number: ${{ github.event.issue.number }} + body: | + @${{ github.actor }} I tried to fix the linting errors, but it didn't work. Please fix them manually. + See [CI log](https://github.com/nf-core/marsseq/actions/runs/${{ github.run_id }}) for more details. diff --git a/.github/workflows/linting.yml b/.github/workflows/linting.yml index 888cb4b..a502573 100644 --- a/.github/workflows/linting.yml +++ b/.github/workflows/linting.yml @@ -1,6 +1,6 @@ name: nf-core linting # This workflow is triggered on pushes and PRs to the repository. -# It runs the `nf-core lint` and markdown lint tests to ensure +# It runs the `nf-core pipelines lint` and markdown lint tests to ensure # that the code meets the nf-core guidelines. on: push: @@ -11,87 +11,62 @@ on: types: [published] jobs: - EditorConfig: + pre-commit: runs-on: ubuntu-latest steps: - - uses: actions/checkout@v3 + - uses: actions/checkout@0ad4b8fadaa221de15dcec353f45205ec38ea70b # v4 - - uses: actions/setup-node@v3 - - - name: Install editorconfig-checker - run: npm install -g editorconfig-checker - - - name: Run ECLint check - run: editorconfig-checker -exclude README.md $(find .* -type f | grep -v '.git\|.py\|.md\|json\|yml\|yaml\|html\|css\|work\|.nextflow\|build\|nf_core.egg-info\|log.txt\|Makefile') - - Prettier: - runs-on: ubuntu-latest - steps: - - uses: actions/checkout@v3 - - - uses: actions/setup-node@v3 - - - name: Install Prettier - run: npm install -g prettier - - - name: Run Prettier --check - run: prettier --check ${GITHUB_WORKSPACE} - - PythonBlack: - runs-on: ubuntu-latest - steps: - - uses: actions/checkout@v3 - - - name: Check code lints with Black - uses: psf/black@stable - - # If the above check failed, post a comment on the PR explaining the failure - - name: Post PR comment - if: failure() - uses: mshick/add-pr-comment@v1 + - name: Set up Python 3.12 + uses: actions/setup-python@82c7e631bb3cdc910f68e0081d67478d79c6982d # v5 with: - message: | - ## Python linting (`black`) is failing - - To keep the code consistent with lots of contributors, we run automated code consistency checks. - To fix this CI test, please run: - - * Install [`black`](https://black.readthedocs.io/en/stable/): `pip install black` - * Fix formatting errors in your pipeline: `black .` + python-version: "3.12" - Once you push these changes the test should pass, and you can hide this comment :+1: + - name: Install pre-commit + run: pip install pre-commit - We highly recommend setting up Black in your code editor so that this formatting is done automatically on save. Ask about it on Slack for help! - - Thanks again for your contribution! - repo-token: ${{ secrets.GITHUB_TOKEN }} - allow-repeats: false + - name: Run pre-commit + run: pre-commit run --all-files nf-core: runs-on: ubuntu-latest steps: - name: Check out pipeline code - uses: actions/checkout@v3 + uses: actions/checkout@0ad4b8fadaa221de15dcec353f45205ec38ea70b # v4 - name: Install Nextflow - uses: nf-core/setup-nextflow@v1 + uses: nf-core/setup-nextflow@v2 - - uses: actions/setup-python@v4 + - uses: actions/setup-python@82c7e631bb3cdc910f68e0081d67478d79c6982d # v5 with: - python-version: "3.8" + python-version: "3.12" architecture: "x64" + - name: read .nf-core.yml + uses: pietrobolcato/action-read-yaml@1.1.0 + id: read_yml + with: + config: ${{ github.workspace }}/.nf-core.yml + - name: Install dependencies run: | python -m pip install --upgrade pip - pip install nf-core + pip install nf-core==${{ steps.read_yml.outputs['nf_core_version'] }} + + - name: Run nf-core pipelines lint + if: ${{ github.base_ref != 'master' }} + env: + GITHUB_COMMENTS_URL: ${{ github.event.pull_request.comments_url }} + GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} + GITHUB_PR_COMMIT: ${{ github.event.pull_request.head.sha }} + run: nf-core -l lint_log.txt pipelines lint --dir ${GITHUB_WORKSPACE} --markdown lint_results.md - - name: Run nf-core lint + - name: Run nf-core pipelines lint --release + if: ${{ github.base_ref == 'master' }} env: GITHUB_COMMENTS_URL: ${{ github.event.pull_request.comments_url }} GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} GITHUB_PR_COMMIT: ${{ github.event.pull_request.head.sha }} - run: nf-core -l lint_log.txt lint --dir ${GITHUB_WORKSPACE} --markdown lint_results.md + run: nf-core -l lint_log.txt pipelines lint --release --dir ${GITHUB_WORKSPACE} --markdown lint_results.md - name: Save PR number if: ${{ always() }} @@ -99,7 +74,7 @@ jobs: - name: Upload linting log file artifact if: ${{ always() }} - uses: actions/upload-artifact@v3 + uses: actions/upload-artifact@65462800fd760344b1a7b4382951275a0abb4808 # v4 with: name: linting-logs path: | diff --git a/.github/workflows/linting_comment.yml b/.github/workflows/linting_comment.yml index 0bbcd30..42e519b 100644 --- a/.github/workflows/linting_comment.yml +++ b/.github/workflows/linting_comment.yml @@ -11,7 +11,7 @@ jobs: runs-on: ubuntu-latest steps: - name: Download lint results - uses: dawidd6/action-download-artifact@v2 + uses: dawidd6/action-download-artifact@bf251b5aa9c2f7eeb574a96ee720e24f801b7c11 # v6 with: workflow: linting.yml workflow_conclusion: completed @@ -21,7 +21,7 @@ jobs: run: echo "pr_number=$(cat linting-logs/PR_number.txt)" >> $GITHUB_OUTPUT - name: Post PR comment - uses: marocchino/sticky-pull-request-comment@v2 + uses: marocchino/sticky-pull-request-comment@331f8f5b4215f0445d3c07b4967662a32a2d3e31 # v2 with: GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} number: ${{ steps.pr_number.outputs.pr_number }} diff --git a/.github/workflows/release-announcements.yml b/.github/workflows/release-announcements.yml new file mode 100644 index 0000000..c6ba35d --- /dev/null +++ b/.github/workflows/release-announcements.yml @@ -0,0 +1,75 @@ +name: release-announcements +# Automatic release toot and tweet anouncements +on: + release: + types: [published] + workflow_dispatch: + +jobs: + toot: + runs-on: ubuntu-latest + steps: + - name: get topics and convert to hashtags + id: get_topics + run: | + echo "topics=$(curl -s https://nf-co.re/pipelines.json | jq -r '.remote_workflows[] | select(.full_name == "${{ github.repository }}") | .topics[]' | awk '{print "#"$0}' | tr '\n' ' ')" | sed 's/-//g' >> $GITHUB_OUTPUT + + - uses: rzr/fediverse-action@master + with: + access-token: ${{ secrets.MASTODON_ACCESS_TOKEN }} + host: "mstdn.science" # custom host if not "mastodon.social" (default) + # GitHub event payload + # https://docs.github.com/en/developers/webhooks-and-events/webhooks/webhook-events-and-payloads#release + message: | + Pipeline release! ${{ github.repository }} v${{ github.event.release.tag_name }} - ${{ github.event.release.name }}! + + Please see the changelog: ${{ github.event.release.html_url }} + + ${{ steps.get_topics.outputs.topics }} #nfcore #openscience #nextflow #bioinformatics + + send-tweet: + runs-on: ubuntu-latest + + steps: + - uses: actions/setup-python@82c7e631bb3cdc910f68e0081d67478d79c6982d # v5 + with: + python-version: "3.10" + - name: Install dependencies + run: pip install tweepy==4.14.0 + - name: Send tweet + shell: python + run: | + import os + import tweepy + + client = tweepy.Client( + access_token=os.getenv("TWITTER_ACCESS_TOKEN"), + access_token_secret=os.getenv("TWITTER_ACCESS_TOKEN_SECRET"), + consumer_key=os.getenv("TWITTER_CONSUMER_KEY"), + consumer_secret=os.getenv("TWITTER_CONSUMER_SECRET"), + ) + tweet = os.getenv("TWEET") + client.create_tweet(text=tweet) + env: + TWEET: | + Pipeline release! ${{ github.repository }} v${{ github.event.release.tag_name }} - ${{ github.event.release.name }}! + + Please see the changelog: ${{ github.event.release.html_url }} + TWITTER_CONSUMER_KEY: ${{ secrets.TWITTER_CONSUMER_KEY }} + TWITTER_CONSUMER_SECRET: ${{ secrets.TWITTER_CONSUMER_SECRET }} + TWITTER_ACCESS_TOKEN: ${{ secrets.TWITTER_ACCESS_TOKEN }} + TWITTER_ACCESS_TOKEN_SECRET: ${{ secrets.TWITTER_ACCESS_TOKEN_SECRET }} + + bsky-post: + runs-on: ubuntu-latest + steps: + - uses: zentered/bluesky-post-action@80dbe0a7697de18c15ad22f4619919ceb5ccf597 # v0.1.0 + with: + post: | + Pipeline release! ${{ github.repository }} v${{ github.event.release.tag_name }} - ${{ github.event.release.name }}! + + Please see the changelog: ${{ github.event.release.html_url }} + env: + BSKY_IDENTIFIER: ${{ secrets.BSKY_IDENTIFIER }} + BSKY_PASSWORD: ${{ secrets.BSKY_PASSWORD }} + # diff --git a/.github/workflows/template_version_comment.yml b/.github/workflows/template_version_comment.yml new file mode 100644 index 0000000..e8aafe4 --- /dev/null +++ b/.github/workflows/template_version_comment.yml @@ -0,0 +1,46 @@ +name: nf-core template version comment +# This workflow is triggered on PRs to check if the pipeline template version matches the latest nf-core version. +# It posts a comment to the PR, even if it comes from a fork. + +on: pull_request_target + +jobs: + template_version: + runs-on: ubuntu-latest + steps: + - name: Check out pipeline code + uses: actions/checkout@0ad4b8fadaa221de15dcec353f45205ec38ea70b # v4 + with: + ref: ${{ github.event.pull_request.head.sha }} + + - name: Read template version from .nf-core.yml + uses: nichmor/minimal-read-yaml@v0.0.2 + id: read_yml + with: + config: ${{ github.workspace }}/.nf-core.yml + + - name: Install nf-core + run: | + python -m pip install --upgrade pip + pip install nf-core==${{ steps.read_yml.outputs['nf_core_version'] }} + + - name: Check nf-core outdated + id: nf_core_outdated + run: echo "OUTPUT=$(pip list --outdated | grep nf-core)" >> ${GITHUB_ENV} + + - name: Post nf-core template version comment + uses: mshick/add-pr-comment@b8f338c590a895d50bcbfa6c5859251edc8952fc # v2 + if: | + contains(env.OUTPUT, 'nf-core') + with: + repo-token: ${{ secrets.NF_CORE_BOT_AUTH_TOKEN }} + allow-repeats: false + message: | + > [!WARNING] + > Newer version of the nf-core template is available. + > + > Your pipeline is using an old version of the nf-core template: ${{ steps.read_yml.outputs['nf_core_version'] }}. + > Please update your pipeline to the latest version. + > + > For more documentation on how to update your pipeline, please see the [nf-core documentation](https://github.com/nf-core/tools?tab=readme-ov-file#sync-a-pipeline-with-the-template) and [Synchronisation documentation](https://nf-co.re/docs/contributing/sync). + # diff --git a/.gitignore b/.gitignore index 5124c9a..a42ce01 100644 --- a/.gitignore +++ b/.gitignore @@ -6,3 +6,4 @@ results/ testing/ testing* *.pyc +null/ diff --git a/.gitpod.yml b/.gitpod.yml index 25488dc..4611863 100644 --- a/.gitpod.yml +++ b/.gitpod.yml @@ -7,13 +7,11 @@ tasks: vscode: extensions: # based on nf-core.nf-core-extensionpack - - codezombiech.gitignore # Language support for .gitignore files - # - cssho.vscode-svgviewer # SVG viewer - - esbenp.prettier-vscode # Markdown/CommonMark linting and style checking for Visual Studio Code - - eamodio.gitlens # Quickly glimpse into whom, why, and when a line or code block was changed + #- esbenp.prettier-vscode # Markdown/CommonMark linting and style checking for Visual Studio Code - EditorConfig.EditorConfig # override user/workspace settings with settings found in .editorconfig files - Gruntfuggly.todo-tree # Display TODO and FIXME in a tree view in the activity bar - mechatroner.rainbow-csv # Highlight columns in csv files in different colors - # - nextflow.nextflow # Nextflow syntax highlighting + - nextflow.nextflow # Nextflow syntax highlighting - oderwat.indent-rainbow # Highlight indentation level - streetsidesoftware.code-spell-checker # Spelling checker for source code + - charliermarsh.ruff # Code linter Ruff diff --git a/.nf-core.yml b/.nf-core.yml index 3805dc8..bdac84b 100644 --- a/.nf-core.yml +++ b/.nf-core.yml @@ -1 +1,16 @@ +bump_version: null +lint: null +nf_core_version: 3.0.2 +org_path: null repository_type: pipeline +template: + author: Martin Proks + description: MARS-seq v2 preprocessing pipeline + force: false + is_nfcore: true + name: marsseq + org: nf-core + outdir: . + skip_features: null + version: 1.0.3 +update: null diff --git a/.pre-commit-config.yaml b/.pre-commit-config.yaml index 0c31cdb..9e9f0e1 100644 --- a/.pre-commit-config.yaml +++ b/.pre-commit-config.yaml @@ -1,5 +1,13 @@ repos: - repo: https://github.com/pre-commit/mirrors-prettier - rev: "v2.7.1" + rev: "v3.1.0" hooks: - id: prettier + additional_dependencies: + - prettier@3.2.5 + + - repo: https://github.com/editorconfig-checker/editorconfig-checker.python + rev: "3.0.3" + hooks: + - id: editorconfig-checker + alias: ec diff --git a/CHANGELOG.md b/CHANGELOG.md index 6ac7673..8bf2189 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -3,6 +3,40 @@ The format is based on [Keep a Changelog](https://keepachangelog.com/en/1.0.0/) and this project adheres to [Semantic Versioning](https://semver.org/spec/v2.0.0.html). +## v1.1.0 - [02-06-2025] + +### Bug Fixes + +- linting issues - ([bedc4a8](https://github.com/nf-core/marsseq/commit/bedc4a887ed804a0f2a5168a4f59090b083d40bd)) +- test config - ([0b9410b](https://github.com/nf-core/marsseq/commit/0b9410bcb19ac0e3630ebd500e5891851e0c2c2b)) +- check that provided xlsx files are not empty after subset - ([e88075b](https://github.com/nf-core/marsseq/commit/e88075be0f56d9791229bfe590dba594a10122ce)) +- missing openpyxl in conda specification - ([41d617b](https://github.com/nf-core/marsseq/commit/41d617b3aa0deece111487ea29d208489662948c)) +- missing openpyxl conda dependency - ([d47f7f0](https://github.com/nf-core/marsseq/commit/d47f7f02a9b3367d870bd9b460df6811b61e95aa)) +- replace ubuntu image with conda packages - ([b4ef5a5](https://github.com/nf-core/marsseq/commit/b4ef5a520ff401a75451242df34e02aebccd3068)) +- perl not anymore in bioconda channel - ([7c8cf13](https://github.com/nf-core/marsseq/commit/7c8cf1320f0ff01710f48d1f08000c71351f1ab1)) +- move uncompressed genome and annotation to reference folder - ([4dea965](https://github.com/nf-core/marsseq/commit/4dea96557937785970ca12755a212817113e0753)) +- small and full AWS test - ([b72d716](https://github.com/nf-core/marsseq/commit/b72d716416f2c37499c708f2f9f4d1e415e0dfd5)) +- linting - ([4f6feee](https://github.com/nf-core/marsseq/commit/4f6feeefe85bfd5547bef81b38e052f6cf2f79e1)) + +### Documentation + +- linting for CITATIONS - ([98b5159](https://github.com/nf-core/marsseq/commit/98b5159c997ad964166c95de01c0673adc964695)) +- updated CHANGELOG - ([5a4e7f2](https://github.com/nf-core/marsseq/commit/5a4e7f2cdd5757cd1094a5534cddd702c173449e)) +- updated workflow and outputs - ([cddbe3b](https://github.com/nf-core/marsseq/commit/cddbe3b44b7fd0aa189b78eb3f79379ba74091b0)) + +### Features + +- merge with template and full refactor - ([7057892](https://github.com/nf-core/marsseq/commit/7057892182f2eb1e9b846e61e2fc30ba41d8726b)) +- support for compressed genome references - ([13b7cb6](https://github.com/nf-core/marsseq/commit/13b7cb67f5e7ed0f184411ba9a42e9f2e8f46b13)) + +### Miscellaneous Chores + +- merge pull request #22 from nf-core/nf-core-template-merge-3.0.2 - ([64a3ee5](https://github.com/nf-core/marsseq/commit/64a3ee5a7012a9f2fe7f4ee2bc116c92de24ce66)) + +### Wip + +- merge template 3.0.2 to dev - ([0b72b26](https://github.com/nf-core/marsseq/commit/0b72b2639d7f480cbf460533750343d5ad54d531)) + ## v1.0.3 - [11-07-2023] ### `Fixed` diff --git a/CITATIONS.md b/CITATIONS.md index fb931c7..1636008 100644 --- a/CITATIONS.md +++ b/CITATIONS.md @@ -16,6 +16,8 @@ - [FastQC](https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) + > Andrews, S. (2010). FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. + - [fastp](https://www.ncbi.nlm.nih.gov/pubmed/30423086/) > Chen S, Zhou Y, Chen Y, Gu J. fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics. 2018 Sep 1;34(17):i884-i890. doi: 10.1093/bioinformatics/bty560. PubMed PMID: 30423086; PubMed Central PMCID: PMC6129281. diff --git a/CODE_OF_CONDUCT.md b/CODE_OF_CONDUCT.md index f4fd052..c089ec7 100644 --- a/CODE_OF_CONDUCT.md +++ b/CODE_OF_CONDUCT.md @@ -1,18 +1,20 @@ -# Code of Conduct at nf-core (v1.0) +# Code of Conduct at nf-core (v1.4) ## Our Pledge -In the interest of fostering an open, collaborative, and welcoming environment, we as contributors and maintainers of nf-core, pledge to making participation in our projects and community a harassment-free experience for everyone, regardless of: +In the interest of fostering an open, collaborative, and welcoming environment, we as contributors and maintainers of nf-core pledge to making participation in our projects and community a harassment-free experience for everyone, regardless of: - Age +- Ability - Body size +- Caste - Familial status - Gender identity and expression - Geographical location - Level of experience - Nationality and national origins - Native language -- Physical and neurological ability +- Neurodiversity - Race or ethnicity - Religion - Sexual identity and orientation @@ -22,80 +24,133 @@ Please note that the list above is alphabetised and is therefore not ranked in a ## Preamble -> Note: This Code of Conduct (CoC) has been drafted by the nf-core Safety Officer and been edited after input from members of the nf-core team and others. "We", in this document, refers to the Safety Officer and members of the nf-core core team, both of whom are deemed to be members of the nf-core community and are therefore required to abide by this Code of Conduct. This document will amended periodically to keep it up-to-date, and in case of any dispute, the most current version will apply. +:::note +This Code of Conduct (CoC) has been drafted by Renuka Kudva, Cris Tuñí, and Michael Heuer, with input from the nf-core Core Team and Susanna Marquez from the nf-core community. "We", in this document, refers to the Safety Officers and members of the nf-core Core Team, both of whom are deemed to be members of the nf-core community and are therefore required to abide by this Code of Conduct. This document will be amended periodically to keep it up-to-date. In case of any dispute, the most current version will apply. +::: -An up-to-date list of members of the nf-core core team can be found [here](https://nf-co.re/about). Our current safety officer is Renuka Kudva. +An up-to-date list of members of the nf-core core team can be found [here](https://nf-co.re/about). + +Our Safety Officers are Saba Nafees, Cris Tuñí, and Michael Heuer. nf-core is a young and growing community that welcomes contributions from anyone with a shared vision for [Open Science Policies](https://www.fosteropenscience.eu/taxonomy/term/8). Open science policies encompass inclusive behaviours and we strive to build and maintain a safe and inclusive environment for all individuals. -We have therefore adopted this code of conduct (CoC), which we require all members of our community and attendees in nf-core events to adhere to in all our workspaces at all times. Workspaces include but are not limited to Slack, meetings on Zoom, Jitsi, YouTube live etc. +We have therefore adopted this CoC, which we require all members of our community and attendees of nf-core events to adhere to in all our workspaces at all times. Workspaces include, but are not limited to, Slack, meetings on Zoom, gather.town, YouTube live etc. -Our CoC will be strictly enforced and the nf-core team reserve the right to exclude participants who do not comply with our guidelines from our workspaces and future nf-core activities. +Our CoC will be strictly enforced and the nf-core team reserves the right to exclude participants who do not comply with our guidelines from our workspaces and future nf-core activities. -We ask all members of our community to help maintain a supportive and productive workspace and to avoid behaviours that can make individuals feel unsafe or unwelcome. Please help us maintain and uphold this CoC. +We ask all members of our community to help maintain supportive and productive workspaces and to avoid behaviours that can make individuals feel unsafe or unwelcome. Please help us maintain and uphold this CoC. -Questions, concerns or ideas on what we can include? Contact safety [at] nf-co [dot] re +Questions, concerns, or ideas on what we can include? Contact members of the Safety Team on Slack or email safety [at] nf-co [dot] re. ## Our Responsibilities -The safety officer is responsible for clarifying the standards of acceptable behavior and are expected to take appropriate and fair corrective action in response to any instances of unacceptable behaviour. +Members of the Safety Team (the Safety Officers) are responsible for clarifying the standards of acceptable behavior and are expected to take appropriate and fair corrective action in response to any instances of unacceptable behaviour. -The safety officer in consultation with the nf-core core team have the right and responsibility to remove, edit, or reject comments, commits, code, wiki edits, issues, and other contributions that are not aligned to this Code of Conduct, or to ban temporarily or permanently any contributor for other behaviors that they deem inappropriate, threatening, offensive, or harmful. +The Safety Team, in consultation with the nf-core core team, have the right and responsibility to remove, edit, or reject comments, commits, code, wiki edits, issues, and other contributions that are not aligned to this CoC, or to ban temporarily or permanently any contributor for other behaviors that they deem inappropriate, threatening, offensive, or harmful. -Members of the core team or the safety officer who violate the CoC will be required to recuse themselves pending investigation. They will not have access to any reports of the violations and be subject to the same actions as others in violation of the CoC. +Members of the core team or the Safety Team who violate the CoC will be required to recuse themselves pending investigation. They will not have access to any reports of the violations and will be subject to the same actions as others in violation of the CoC. -## When are where does this Code of Conduct apply? +## When and where does this Code of Conduct apply? -Participation in the nf-core community is contingent on following these guidelines in all our workspaces and events. This includes but is not limited to the following listed alphabetically and therefore in no order of preference: +Participation in the nf-core community is contingent on following these guidelines in all our workspaces and events, such as hackathons, workshops, bytesize, and collaborative workspaces on gather.town. These guidelines include, but are not limited to, the following (listed alphabetically and therefore in no order of preference): - Communicating with an official project email address. - Communicating with community members within the nf-core Slack channel. - Participating in hackathons organised by nf-core (both online and in-person events). -- Participating in collaborative work on GitHub, Google Suite, community calls, mentorship meetings, email correspondence. -- Participating in workshops, training, and seminar series organised by nf-core (both online and in-person events). This applies to events hosted on web-based platforms such as Zoom, Jitsi, YouTube live etc. +- Participating in collaborative work on GitHub, Google Suite, community calls, mentorship meetings, email correspondence, and on the nf-core gather.town workspace. +- Participating in workshops, training, and seminar series organised by nf-core (both online and in-person events). This applies to events hosted on web-based platforms such as Zoom, gather.town, Jitsi, YouTube live etc. - Representing nf-core on social media. This includes both official and personal accounts. ## nf-core cares 😊 -nf-core's CoC and expectations of respectful behaviours for all participants (including organisers and the nf-core team) include but are not limited to the following (listed in alphabetical order): +nf-core's CoC and expectations of respectful behaviours for all participants (including organisers and the nf-core team) include, but are not limited to, the following (listed in alphabetical order): - Ask for consent before sharing another community member’s personal information (including photographs) on social media. - Be respectful of differing viewpoints and experiences. We are all here to learn from one another and a difference in opinion can present a good learning opportunity. -- Celebrate your accomplishments at events! (Get creative with your use of emojis 🎉 🥳 💯 🙌 !) +- Celebrate your accomplishments! (Get creative with your use of emojis 🎉 🥳 💯 🙌 !) - Demonstrate empathy towards other community members. (We don’t all have the same amount of time to dedicate to nf-core. If tasks are pending, don’t hesitate to gently remind members of your team. If you are leading a task, ask for help if you feel overwhelmed.) - Engage with and enquire after others. (This is especially important given the geographically remote nature of the nf-core community, so let’s do this the best we can) - Focus on what is best for the team and the community. (When in doubt, ask) -- Graciously accept constructive criticism, yet be unafraid to question, deliberate, and learn. +- Accept feedback, yet be unafraid to question, deliberate, and learn. - Introduce yourself to members of the community. (We’ve all been outsiders and we know that talking to strangers can be hard for some, but remember we’re interested in getting to know you and your visions for open science!) -- Show appreciation and **provide clear feedback**. (This is especially important because we don’t see each other in person and it can be harder to interpret subtleties. Also remember that not everyone understands a certain language to the same extent as you do, so **be clear in your communications to be kind.**) +- Show appreciation and **provide clear feedback**. (This is especially important because we don’t see each other in person and it can be harder to interpret subtleties. Also remember that not everyone understands a certain language to the same extent as you do, so **be clear in your communication to be kind.**) - Take breaks when you feel like you need them. -- Using welcoming and inclusive language. (Participants are encouraged to display their chosen pronouns on Zoom or in communication on Slack.) +- Use welcoming and inclusive language. (Participants are encouraged to display their chosen pronouns on Zoom or in communication on Slack) ## nf-core frowns on 😕 -The following behaviours from any participants within the nf-core community (including the organisers) will be considered unacceptable under this code of conduct. Engaging or advocating for any of the following could result in expulsion from nf-core workspaces. +The following behaviours from any participants within the nf-core community (including the organisers) will be considered unacceptable under this CoC. Engaging or advocating for any of the following could result in expulsion from nf-core workspaces: - Deliberate intimidation, stalking or following and sustained disruption of communication among participants of the community. This includes hijacking shared screens through actions such as using the annotate tool in conferencing software such as Zoom. - “Doxing” i.e. posting (or threatening to post) another person’s personal identifying information online. - Spamming or trolling of individuals on social media. -- Use of sexual or discriminatory imagery, comments, or jokes and unwelcome sexual attention. -- Verbal and text comments that reinforce social structures of domination related to gender, gender identity and expression, sexual orientation, ability, physical appearance, body size, race, age, religion or work experience. +- Use of sexual or discriminatory imagery, comments, jokes, or unwelcome sexual attention. +- Verbal and text comments that reinforce social structures of domination related to gender, gender identity and expression, sexual orientation, ability, physical appearance, body size, race, age, religion, or work experience. ### Online Trolling -The majority of nf-core interactions and events are held online. Unfortunately, holding events online comes with the added issue of online trolling. This is unacceptable, reports of such behaviour will be taken very seriously, and perpetrators will be excluded from activities immediately. +The majority of nf-core interactions and events are held online. Unfortunately, holding events online comes with the risk of online trolling. This is unacceptable — reports of such behaviour will be taken very seriously and perpetrators will be excluded from activities immediately. -All community members are required to ask members of the group they are working within for explicit consent prior to taking screenshots of individuals during video calls. +All community members are **required** to ask members of the group they are working with for explicit consent prior to taking screenshots of individuals during video calls. -## Procedures for Reporting CoC violations +## Procedures for reporting CoC violations If someone makes you feel uncomfortable through their behaviours or actions, report it as soon as possible. -You can reach out to members of the [nf-core core team](https://nf-co.re/about) and they will forward your concerns to the safety officer(s). +You can reach out to members of the Safety Team (Saba Nafees, Cris Tuñí, and Michael Heuer) on Slack. Alternatively, contact a member of the nf-core core team [nf-core core team](https://nf-co.re/about), and they will forward your concerns to the Safety Team. + +Issues directly concerning members of the Core Team or the Safety Team will be dealt with by other members of the core team and the safety manager — possible conflicts of interest will be taken into account. nf-core is also in discussions about having an ombudsperson and details will be shared in due course. + +All reports will be handled with the utmost discretion and confidentiality. + +You can also report any CoC violations to safety [at] nf-co [dot] re. In your email report, please do your best to include: + +- Your contact information. +- Identifying information (e.g. names, nicknames, pseudonyms) of the participant who has violated the Code of Conduct. +- The behaviour that was in violation and the circumstances surrounding the incident. +- The approximate time of the behaviour (if different than the time the report was made). +- Other people involved in the incident, if applicable. +- If you believe the incident is ongoing. +- If there is a publicly available record (e.g. mailing list record, a screenshot). +- Any additional information. + +After you file a report, one or more members of our Safety Team will contact you to follow up on your report. + +## Who will read and handle reports + +All reports will be read and handled by the members of the Safety Team at nf-core. + +If members of the Safety Team are deemed to have a conflict of interest with a report, they will be required to recuse themselves as per our Code of Conduct and will not have access to any follow-ups. + +To keep this first report confidential from any of the Safety Team members, please submit your first report by direct messaging on Slack/direct email to any of the nf-core members you are comfortable disclosing the information to, and be explicit about which member(s) you do not consent to sharing the information with. + +## Reviewing reports + +After receiving the report, members of the Safety Team will review the incident report to determine whether immediate action is required, for example, whether there is immediate threat to participants’ safety. + +The Safety Team, in consultation with members of the nf-core core team, will assess the information to determine whether the report constitutes a Code of Conduct violation, for them to decide on a course of action. + +In the case of insufficient information, one or more members of the Safety Team may contact the reporter, the reportee, or any other attendees to obtain more information. -Issues directly concerning members of the core team will be dealt with by other members of the core team and the safety manager, and possible conflicts of interest will be taken into account. nf-core is also in discussions about having an ombudsperson, and details will be shared in due course. +Once additional information is gathered, the Safety Team will collectively review and decide on the best course of action to take, if any. The Safety Team reserves the right to not act on a report. -All reports will be handled with utmost discretion and confidentially. +## Confidentiality + +All reports, and any additional information included, are only shared with the team of safety officers (and possibly members of the core team, in case the safety officer is in violation of the CoC). We will respect confidentiality requests for the purpose of protecting victims of abuse. + +We will not name harassment victims, beyond discussions between the safety officer and members of the nf-core team, without the explicit consent of the individuals involved. + +## Enforcement + +Actions taken by the nf-core’s Safety Team may include, but are not limited to: + +- Asking anyone to stop a behaviour. +- Asking anyone to leave the event and online spaces either temporarily, for the remainder of the event, or permanently. +- Removing access to the gather.town and Slack, either temporarily or permanently. +- Communicating to all participants to reinforce our expectations for conduct and remind what is unacceptable behaviour; this may be public for practical reasons. +- Communicating to all participants that an incident has taken place and how we will act or have acted — this may be for the purpose of letting event participants know we are aware of and dealing with the incident. +- Banning anyone from participating in nf-core-managed spaces, future events, and activities, either temporarily or permanently. +- No action. ## Attribution and Acknowledgements @@ -106,6 +161,22 @@ All reports will be handled with utmost discretion and confidentially. ## Changelog -### v1.0 - March 12th, 2021 +### v1.4 - February 8th, 2022 + +- Included a new member of the Safety Team. Corrected a typographical error in the text. + +### v1.3 - December 10th, 2021 + +- Added a statement that the CoC applies to nf-core gather.town workspaces. Corrected typographical errors in the text. + +### v1.2 - November 12th, 2021 + +- Removed information specific to reporting CoC violations at the Hackathon in October 2021. + +### v1.1 - October 14th, 2021 + +- Updated with names of new Safety Officers and specific information for the hackathon in October 2021. + +### v1.0 - March 15th, 2021 - Complete rewrite from original [Contributor Covenant](http://contributor-covenant.org/) CoC. diff --git a/README.md b/README.md index 6b2777e..3d593a7 100644 --- a/README.md +++ b/README.md @@ -1,12 +1,19 @@ -# ![nf-core/marsseq](docs/images/nf-core-marsseq_logo_light.png#gh-light-mode-only) ![nf-core/marsseq](docs/images/nf-core-marsseq_logo_dark.png#gh-dark-mode-only) - -[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/marsseq/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.8063539-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.8063539) - -[![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A523.04.0-23aa62.svg)](https://www.nextflow.io/) +

+ + + nf-core/marsseq + +

+ +[![GitHub Actions CI Status](https://github.com/nf-core/marsseq/actions/workflows/ci.yml/badge.svg)](https://github.com/nf-core/marsseq/actions/workflows/ci.yml) +[![GitHub Actions Linting Status](https://github.com/nf-core/marsseq/actions/workflows/linting.yml/badge.svg)](https://github.com/nf-core/marsseq/actions/workflows/linting.yml)[![AWS CI](https://img.shields.io/badge/CI%20tests-full%20size-FF9900?labelColor=000000&logo=Amazon%20AWS)](https://nf-co.re/marsseq/results)[![Cite with Zenodo](http://img.shields.io/badge/DOI-10.5281/zenodo.8063539-1073c8?labelColor=000000)](https://doi.org/10.5281/zenodo.8063539) +[![nf-test](https://img.shields.io/badge/unit_tests-nf--test-337ab7.svg)](https://www.nf-test.com) + +[![Nextflow](https://img.shields.io/badge/nextflow%20DSL2-%E2%89%A524.04.2-23aa62.svg)](https://www.nextflow.io/) [![run with conda](http://img.shields.io/badge/run%20with-conda-3EB049?labelColor=000000&logo=anaconda)](https://docs.conda.io/en/latest/) [![run with docker](https://img.shields.io/badge/run%20with-docker-0db7ed?labelColor=000000&logo=docker)](https://www.docker.com/) [![run with singularity](https://img.shields.io/badge/run%20with-singularity-1d355c.svg?labelColor=000000)](https://sylabs.io/docs/) -[![Launch on Nextflow Tower](https://img.shields.io/badge/Launch%20%F0%9F%9A%80-Nextflow%20Tower-%234256e7)](https://tower.nf/launch?pipeline=https://github.com/nf-core/marsseq) +[![Launch on Seqera Platform](https://img.shields.io/badge/Launch%20%F0%9F%9A%80-Seqera%20Platform-%234256e7)](https://cloud.seqera.io/launch?pipeline=https://github.com/nf-core/marsseq) [![Get help on Slack](http://img.shields.io/badge/slack-nf--core%20%23marsseq-4A154B?labelColor=000000&logo=slack)](https://nfcore.slack.com/channels/marsseq)[![Follow on Twitter](http://img.shields.io/badge/twitter-%40nf__core-1DA1F2?labelColor=000000&logo=twitter)](https://twitter.com/nf_core)[![Follow on Mastodon](https://img.shields.io/badge/mastodon-nf__core-6364ff?labelColor=FFFFFF&logo=mastodon)](https://mstdn.science/@nf_core)[![Watch on YouTube](http://img.shields.io/badge/youtube-nf--core-FF0000?labelColor=000000&logo=youtube)](https://www.youtube.com/c/nf-core) @@ -18,12 +25,10 @@ ## Usage -> **Note** -> If you are new to Nextflow and nf-core, please refer to [this page](https://nf-co.re/docs/usage/installation) on how -> to set-up Nextflow. Make sure to [test your setup](https://nf-co.re/docs/usage/introduction#how-to-run-a-pipeline) -> with `-profile test` before running the workflow on actual data. +> [!NOTE] +> If you are new to Nextflow and nf-core, please refer to [this page](https://nf-co.re/docs/usage/installation) on how to set-up Nextflow. Make sure to [test your setup](https://nf-co.re/docs/usage/introduction#how-to-run-a-pipeline) with `-profile test` before running the workflow on actual data. -To run the pipeline you have create experiment metadata files: +To run the pipeline you have to create experiment metadata files (see documentation for more details): - [amp_batches.xlsx](assets/amp_batches.xlsx) - [wells_cells.xlsx](assets/wells_cells.xlsx) @@ -31,31 +36,21 @@ To run the pipeline you have create experiment metadata files: and samplesheet (`samplesheet.csv`). We provide test example [here](assets/samplesheet.csv). -Next, you have to generate genome references to incorporate ERCC spike-ins. References are downloaded from [GENCODE](https://www.gencodegenes.org) database. - -```bash -nextflow run nf-core/marsseq \ - -profile \ - --genome \ - --build_references \ - --input samplsheet.csv \ - --outdir -``` - Now, you can run the pipeline using: ```bash nextflow run nf-core/marsseq \ -profile \ - --genome \ + --fasta reference_fasta \ + --gtf reference_gtf \ --input samplesheet.csv \ --outdir ``` -> **Warning:** -> Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those -> provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_; -> see [docs](https://nf-co.re/usage/configuration#custom-configuration-files). +We recommend to use references from [GENCODE](https://www.gencodegenes.org). + +> [!WARNING] +> Please provide pipeline parameters via the CLI or Nextflow `-params-file` option. Custom config files including those provided by the `-c` Nextflow option can be used to provide any configuration _**except for parameters**_; see [docs](https://nf-co.re/docs/usage/getting_started/configuration#custom-configuration-files). For more details and further functionality, please refer to the [usage documentation](https://nf-co.re/marsseq/usage) and the [parameter documentation](https://nf-co.re/marsseq/parameters). @@ -84,7 +79,9 @@ For further information or help, don't hesitate to get in touch on the [Slack `# ## Citations -If you use nf-core/marsseq for your analysis, please cite it using the following doi: [10.5281/zenodo.8063539](https://doi.org/10.5281/zenodo.8063539) +If you use nf-core/marsseq for your analysis, please cite the `nf-core/marsseq` article as follows: + +> Martin Proks, Jose Alejandro Romero Herrera, Jakub Sedzinski, Joshua M Brickman, nf-core/marsseq: systematic preprocessing pipeline for MARS-seq experiments, Bioinformatics Advances, Volume 5, Issue 1, 2025, vbaf089, https://doi.org/10.1093/bioadv/vbaf089 An extensive list of references for the tools used by the pipeline can be found in the [`CITATIONS.md`](CITATIONS.md) file. diff --git a/assets/email_template.html b/assets/email_template.html index 4a0dbab..83ae6ce 100644 --- a/assets/email_template.html +++ b/assets/email_template.html @@ -12,7 +12,7 @@ -

nf-core/marsseq v${version}

+

nf-core/marsseq ${version}

Run Name: $runName

<% if (!success){ diff --git a/assets/email_template.txt b/assets/email_template.txt index 3f5ab92..9893e15 100644 --- a/assets/email_template.txt +++ b/assets/email_template.txt @@ -4,7 +4,7 @@ |\\ | |__ __ / ` / \\ |__) |__ } { | \\| | \\__, \\__/ | \\ |___ \\`-._,-`-, `._,._,' - nf-core/marsseq v${version} + nf-core/marsseq ${version} ---------------------------------------------------- Run Name: $runName diff --git a/assets/multiqc_config.yml b/assets/multiqc_config.yml index 99a9c21..3311e3e 100644 --- a/assets/multiqc_config.yml +++ b/assets/multiqc_config.yml @@ -1,7 +1,7 @@ report_comment: > - This report has been generated by the nf-core/marsseq + This report has been generated by the nf-core/marsseq analysis pipeline. For information about how to interpret these results, please see the - documentation. + documentation. report_section_order: "nf-core-marsseq-methods-description": order: -1000 @@ -11,3 +11,5 @@ report_section_order: order: -1002 export_plots: true + +disable_version_detection: true diff --git a/assets/nf-core-marsseq_logo_light.png b/assets/nf-core-marsseq_logo_light.png index e089430..f4364da 100644 Binary files a/assets/nf-core-marsseq_logo_light.png and b/assets/nf-core-marsseq_logo_light.png differ diff --git a/assets/schema_input.json b/assets/schema_input.json index 4a572ad..898a3c2 100644 --- a/assets/schema_input.json +++ b/assets/schema_input.json @@ -1,5 +1,5 @@ { - "$schema": "http://json-schema.org/draft-07/schema", + "$schema": "https://json-schema.org/draft/2020-12/schema", "$id": "https://raw.githubusercontent.com/nf-core/marsseq/master/assets/schema_input.json", "title": "nf-core/marsseq pipeline - params.input schema", "description": "Schema for the file provided with params.input", @@ -10,40 +10,46 @@ "batch": { "type": "string", "pattern": "^\\S+$", - "errorMessage": "Batch name must be provided and cannot contain spaces" + "errorMessage": "Batch name must be provided and cannot contain spaces", + "meta": ["id"] }, "fastq_1": { "type": "string", + "format": "file-path", + "exists": true, "pattern": "^\\S+\\.f(ast)?q\\.gz$", "errorMessage": "FastQ file for reads 1 must be provided, cannot contain spaces and must have extension '.fq.gz' or '.fastq.gz'" }, "fastq_2": { - "errorMessage": "FastQ file for reads 2 cannot contain spaces and must have extension '.fq.gz' or '.fastq.gz'", - "anyOf": [ - { - "type": "string", - "pattern": "^\\S+\\.f(ast)?q\\.gz$" - }, - { - "type": "string", - "maxLength": 0 - } - ] + "type": "string", + "format": "file-path", + "exists": true, + "pattern": "^\\S+\\.f(ast)?q\\.gz$", + "errorMessage": "FastQ file for reads 2 cannot contain spaces and must have extension '.fq.gz' or '.fastq.gz'" }, "amp_batches": { "type": "string", + "format": "file-path", + "exists": true, "pattern": "^\\S+.xlsx$", - "errorMessage": "Amplification batches has to be in xlsx format" + "errorMessage": "Amplification batches has to be in xlsx format", + "meta": ["amp_batches"] }, "seq_batches": { "type": "string", + "format": "file-path", + "exists": true, "pattern": "^\\S+.xlsx$", - "errorMessage": "Sequencing batches has to be in xlsx format" + "errorMessage": "Sequencing batches has to be in xlsx format", + "meta": ["seq_batches"] }, "well_cells": { "type": "string", + "format": "file-path", + "exists": true, "pattern": "^\\S+.xlsx$", - "errorMessage": "Well cells has to be in xlsx format" + "errorMessage": "Well cells has to be in xlsx format", + "meta": ["well_cells"] } }, "required": ["batch", "fastq_1", "fastq_2", "amp_batches", "seq_batches", "well_cells"] diff --git a/assets/slackreport.json b/assets/slackreport.json index 461d6e2..ef0b81a 100644 --- a/assets/slackreport.json +++ b/assets/slackreport.json @@ -3,7 +3,7 @@ { "fallback": "Plain-text summary of the attachment.", "color": "<% if (success) { %>good<% } else { %>danger<%} %>", - "author_name": "nf-core/marsseq v${version} - ${runName}", + "author_name": "nf-core/marsseq ${version} - ${runName}", "author_icon": "https://www.nextflow.io/docs/latest/_static/favicon.ico", "text": "<% if (success) { %>Pipeline completed successfully!<% } else { %>Pipeline completed with errors<% } %>", "fields": [ diff --git a/bin/check_samplesheet.py b/bin/check_samplesheet.py deleted file mode 100755 index 66e66a7..0000000 --- a/bin/check_samplesheet.py +++ /dev/null @@ -1,248 +0,0 @@ -#!/usr/bin/env python - - -"""Provide a command line tool to validate and transform tabular samplesheets.""" - - -import argparse -import csv -import logging -import sys -from collections import Counter -from pathlib import Path - -logger = logging.getLogger() - - -class RowChecker: - """ - Define a service that can validate and transform each given row. - - Attributes: - modified (list): A list of dicts, where each dict corresponds to a previously - validated and transformed row. The order of rows is maintained. - - """ - - VALID_FORMATS = (".fq.gz", ".fastq.gz", ".xls", ".xlsx") - - def __init__( - self, - sample_col="sample", - first_col="fastq_1", - second_col="fastq_2", - single_col="single_end", - **kwargs, - ): - """ - Initialize the row checker with the expected column names. - - Args: - sample_col (str): The name of the column that contains the sample name - (default "sample"). - first_col (str): The name of the column that contains the first (or only) - FASTQ file path (default "fastq_1"). - second_col (str): The name of the column that contains the second (if any) - FASTQ file path (default "fastq_2"). - single_col (str): The name of the new column that will be inserted and - records whether the sample contains single- or paired-end sequencing - reads (default "single_end"). - - """ - super().__init__(**kwargs) - self._sample_col = sample_col - self._first_col = first_col - self._second_col = second_col - self._single_col = single_col - self._seen = set() - self.modified = [] - - def validate_and_transform(self, row): - """ - Perform all validations on the given row and insert the read pairing status. - - Args: - row (dict): A mapping from column headers (keys) to elements of that row - (values). - - """ - self._validate_sample(row) - self._validate_first(row) - self._validate_second(row) - self._validate_pair(row) - self._seen.add((row[self._sample_col], row[self._first_col])) - self.modified.append(row) - - def _validate_sample(self, row): - """Assert that the sample name exists and convert spaces to underscores.""" - if len(row[self._sample_col]) <= 0: - raise AssertionError("Sample input is required.") - # Sanitize samples slightly. - row[self._sample_col] = row[self._sample_col].replace(" ", "_") - - def _validate_first(self, row): - """Assert that the first FASTQ entry is non-empty and has the right format.""" - if len(row[self._first_col]) <= 0: - raise AssertionError("At least the first FASTQ file is required.") - self._validate_fastq_format(row[self._first_col]) - - def _validate_second(self, row): - """Assert that the second FASTQ entry has the right format if it exists.""" - if len(row[self._second_col]) > 0: - self._validate_fastq_format(row[self._second_col]) - - def _validate_pair(self, row): - """Assert that read pairs have the same file extension. Report pair status.""" - first_col_suffix = Path(row[self._first_col]).suffixes[-2:] - second_col_suffix = Path(row[self._second_col]).suffixes[-2:] - if first_col_suffix != second_col_suffix: - raise AssertionError("FASTQ pairs must have the same file extensions.") - - def _validate_fastq_format(self, filename): - """Assert that a given filename has one of the expected FASTQ extensions.""" - if not any(filename.endswith(extension) for extension in self.VALID_FORMATS): - raise AssertionError( - f"The FASTQ file has an unrecognized extension: {filename}\n" - f"It should be one of: {', '.join(self.VALID_FORMATS)}" - ) - - def validate_unique_samples(self): - """ - Assert that the combination of sample name and FASTQ filename is unique. - - In addition to the validation, also rename all samples to have a suffix of _T{n}, where n is the - number of times the same sample exist, but with different FASTQ files, e.g., multiple runs per experiment. - - """ - if len(self._seen) != len(self.modified): - raise AssertionError("The pair of sample name and FASTQ must be unique.") - # seen = Counter() - # for row in self.modified: - # sample = row[self._sample_col] - # seen[sample] += 1 - # row[self._sample_col] = f"{sample}_T{seen[sample]}" - - -def read_head(handle, num_lines=10): - """Read the specified number of lines from the current position in the file.""" - lines = [] - for idx, line in enumerate(handle): - if idx == num_lines: - break - lines.append(line) - return "".join(lines) - - -def sniff_format(handle): - """ - Detect the tabular format. - - Args: - handle (text file): A handle to a `text file`_ object. The read position is - expected to be at the beginning (index 0). - - Returns: - csv.Dialect: The detected tabular format. - - .. _text file: - https://docs.python.org/3/glossary.html#term-text-file - - """ - peek = read_head(handle) - handle.seek(0) - sniffer = csv.Sniffer() - dialect = sniffer.sniff(peek) - return dialect - - -def check_samplesheet(file_in, file_out): - """ - Check that the tabular samplesheet has the structure expected by nf-core pipelines. - - Validate the general shape of the table, expected columns, and each row. Also add - an additional column which records whether one or two FASTQ reads were found. - - Args: - file_in (pathlib.Path): The given tabular samplesheet. The format can be either - CSV, TSV, or any other format automatically recognized by ``csv.Sniffer``. - file_out (pathlib.Path): Where the validated and transformed samplesheet should - be created; always in CSV format. - - Example: - This function checks that the samplesheet follows the custom structure: - - batch,fastq_1,fastq_2,amp_batches,seq_batches,well_cells - BATCH,SAMPLE_PE_RUN1_1.fastq.gz,SAMPLE_PE_RUN1_2.fastq.gz,amp_batches.xls,seq_batches.xls,well_cells.xls - - .. _marsseq recon samplesheet: - https://raw.githubusercontent.com/nf-core/test-datasets/marsseq/samplesheet/samplesheet_test.csv - - """ - required_columns = {"batch", "fastq_1", "fastq_2", "amp_batches", "seq_batches", "well_cells"} - # See https://docs.python.org/3.9/library/csv.html#id3 to read up on `newline=""`. - with file_in.open(newline="") as in_handle: - reader = csv.DictReader(in_handle, dialect=sniff_format(in_handle)) - # Validate the existence of the expected header columns. - if not required_columns.issubset(reader.fieldnames): - req_cols = ", ".join(required_columns) - logger.critical(f"The sample sheet **must** contain these column headers: {req_cols}.") - sys.exit(1) - # Validate each row. - checker = RowChecker(sample_col="batch", single_col=None) - for i, row in enumerate(reader): - try: - checker.validate_and_transform(row) - except AssertionError as error: - logger.critical(f"{str(error)} On line {i + 2}.") - sys.exit(1) - checker.validate_unique_samples() - header = list(reader.fieldnames) - # See https://docs.python.org/3.9/library/csv.html#id3 to read up on `newline=""`. - with file_out.open(mode="w", newline="") as out_handle: - writer = csv.DictWriter(out_handle, header, delimiter=",") - writer.writeheader() - for row in checker.modified: - writer.writerow(row) - - -def parse_args(argv=None): - """Define and immediately parse command line arguments.""" - parser = argparse.ArgumentParser( - description="Validate and transform a tabular samplesheet.", - epilog="Example: python check_samplesheet.py samplesheet.csv samplesheet.valid.csv", - ) - parser.add_argument( - "file_in", - metavar="FILE_IN", - type=Path, - help="Tabular input samplesheet in CSV or TSV format.", - ) - parser.add_argument( - "file_out", - metavar="FILE_OUT", - type=Path, - help="Transformed output samplesheet in CSV format.", - ) - parser.add_argument( - "-l", - "--log-level", - help="The desired log level (default WARNING).", - choices=("CRITICAL", "ERROR", "WARNING", "INFO", "DEBUG"), - default="WARNING", - ) - return parser.parse_args(argv) - - -def main(argv=None): - """Coordinate argument parsing and program execution.""" - args = parse_args(argv) - logging.basicConfig(level=args.log_level, format="[%(levelname)s] %(message)s") - if not args.file_in.is_file(): - logger.error(f"The given input file {args.file_in} was not found!") - sys.exit(2) - args.file_out.parent.mkdir(parents=True, exist_ok=True) - check_samplesheet(args.file_in, args.file_out) - - -if __name__ == "__main__": - sys.exit(main()) diff --git a/bin/prepare_pipeline.py b/bin/prepare_pipeline.py index a19f023..c39ab3e 100755 --- a/bin/prepare_pipeline.py +++ b/bin/prepare_pipeline.py @@ -29,6 +29,11 @@ def read_input( seq = pd.read_excel(args.seq_batches).query("Seq_batch_ID == @args.batch") wells = pd.read_excel(args.well_cells).query("Amp_batch_ID in @amp.Amp_batch_ID") + if amp.empty or seq.empty or wells.empty: + raise ValueError( + "Make sure that sequencing and amplification batch match in names!" + ) + return amp, seq, wells @@ -130,13 +135,17 @@ def generate_gene_intervals(args: argparse.Namespace) -> None: # transcripts gtf_transcripts = gtf.query('type == "transcript"').copy() - gtf_transcripts["gene_name"] = gtf_transcripts.gene_id.str.split(";", expand=True)[3].str.replace("gene_name ", "") + gtf_transcripts["gene_name"] = gtf_transcripts.gene_id.str.split(";", expand=True)[ + 3 + ].str.replace("gene_name ", "") gtf_transcripts = gtf_transcripts[["chrom", "start", "end", "strand", "gene_name"]] # genes gtf_genes = gtf.query('type == "gene"').copy() gtf_genes["gene_name"] = ( - gtf_genes.gene_id.str.split(";", expand=True)[2].str[len("gene_name") + 1 :].replace("gene_name ", "") + gtf_genes.gene_id.str.split(";", expand=True)[2] + .str[len("gene_name") + 1 :] + .replace("gene_name ", "") ) gtf_genes = gtf_genes[["chrom", "start", "end", "strand", "gene_name"]] @@ -160,7 +169,9 @@ def args() -> argparse.Namespace: Returns: argparse.Namespace: Parsed arguments """ - arg_parser = argparse.ArgumentParser(description="Preprocessing script for MARS-seq pipeline.") + arg_parser = argparse.ArgumentParser( + description="Preprocessing script for MARS-seq pipeline." + ) arg_parser.add_argument("--version", "-v", action="version", version=f"v1.0") arg_parser.add_argument("--batch", action="store", type=str, required=True) @@ -202,7 +213,9 @@ def main(args: argparse.Namespace): sys.exit(ex) # processed new txt files - amp_out, seq_out, wells_out = prepare_batch_metadata(amp_batches, seq_batches, wells) + amp_out, seq_out, wells_out = prepare_batch_metadata( + amp_batches, seq_batches, wells + ) # store new results amp_out.to_csv(f"{args.output}/amp_batches.txt", sep="\t", index=False) diff --git a/bin/velocity.py b/bin/velocity.py index 7ffcc01..9afaa52 100755 --- a/bin/velocity.py +++ b/bin/velocity.py @@ -7,6 +7,7 @@ import os import sys from gzip import open as gzopen +from pathlib import Path from typing import Dict, List, Optional, Tuple import pandas as pd @@ -50,8 +51,12 @@ def trim_cdna(r1: List[str]) -> Tuple[str, str]: # [0]: header, [1]: seq, [2]: quality _, seq, qa = r1 - cdna: str = seq[(config["LEFT_ADAPTER"] + config["POOL_BARCODE"]) : -config["RIGHT_ADAPTER"]] - cdna_quality: str = qa[(config["LEFT_ADAPTER"] + config["POOL_BARCODE"]) : -config["RIGHT_ADAPTER"]] + cdna: str = seq[ + (config["LEFT_ADAPTER"] + config["POOL_BARCODE"]) : -config["RIGHT_ADAPTER"] + ] + cdna_quality: str = qa[ + (config["LEFT_ADAPTER"] + config["POOL_BARCODE"]) : -config["RIGHT_ADAPTER"] + ] return cdna, cdna_quality @@ -75,8 +80,12 @@ def create_r2(r1: FastqGeneralIterator, r2: FastqGeneralIterator) -> Tuple[str, _, r2_seq, r2_qa = r2 # get pool barcode - pb_seq: str = r1_seq[config["LEFT_ADAPTER"] : config["LEFT_ADAPTER"] + config["POOL_BARCODE"]] - pb_qa: str = r1_qa[config["LEFT_ADAPTER"] : config["LEFT_ADAPTER"] + config["POOL_BARCODE"]] + pb_seq: str = r1_seq[ + config["LEFT_ADAPTER"] : config["LEFT_ADAPTER"] + config["POOL_BARCODE"] + ] + pb_qa: str = r1_qa[ + config["LEFT_ADAPTER"] : config["LEFT_ADAPTER"] + config["POOL_BARCODE"] + ] barcode_len: int = config["POOL_BARCODE"] + config["CELL_BARCODE"] + config["UMI"] barcode_seq: str = f"{pb_seq}{r2_seq}"[:barcode_len] @@ -85,17 +94,20 @@ def create_r2(r1: FastqGeneralIterator, r2: FastqGeneralIterator) -> Tuple[str, return barcode_seq, barcode_qa -def convert_to_10x(params: Tuple[str, str, str, str], chunk_size: int = 100) -> None: +def convert_to_10x(params: Tuple[str, str, str], chunk_size: int = 1024) -> None: """Main function processing the reads. Args: - params (Tuple[str, str, str, str]): R1, R2, input, output folder + params (Tuple[str, str, str]): R1, R2, output folder """ - fastq_r1, fastq_r2, input_folder, output_folder = params - - with gzopen(fastq_r1, "rt") as fq_r1, gzopen(fastq_r2, "rt") as fq_r2, gzopen( - f"{output_folder}/{os.path.basename(fastq_r1)}", "wt" - ) as fastq_r1_out, gzopen(f"{output_folder}/{os.path.basename(fastq_r2)}", "wt") as fastq_r2_out: + fastq_r1, fastq_r2, output_folder = params + + with ( + gzopen(fastq_r1, "rt") as fq_r1, + gzopen(fastq_r2, "rt") as fq_r2, + gzopen(f"{output_folder}/{os.path.basename(fastq_r1)}", "wt") as fastq_r1_out, + gzopen(f"{output_folder}/{os.path.basename(fastq_r2)}", "wt") as fastq_r2_out, + ): fastq_r1 = FastqGeneralIterator(fq_r1) fastq_r2 = FastqGeneralIterator(fq_r2) @@ -108,7 +120,9 @@ def convert_to_10x(params: Tuple[str, str, str, str], chunk_size: int = 100) -> barcode, barcode_quality = create_r2(r1, r2) fastq_r1_content += f'@{r1[0]}:{config["DEFAULT_SAMPLE_NAME"]}\n{barcode}\n+\n{barcode_quality}\n' - fastq_r2_content += f'@{r2[0]}:{config["DEFAULT_SAMPLE_NAME"]}\n{cdna}\n+\n{cdna_quality}\n' + fastq_r2_content += ( + f'@{r2[0]}:{config["DEFAULT_SAMPLE_NAME"]}\n{cdna}\n+\n{cdna_quality}\n' + ) if counter % chunk_size == 0: fastq_r1_out.write(fastq_r1_content) @@ -136,19 +150,40 @@ def convert(fastqs_folder: str, output_folder: str, threads: int): r2_files = sorted(glob.glob(f"{fastqs_folder}/*R2*.fastq.gz")) if len(r1_files) != len(r2_files): - print(f"Something is off, please check you have the same amount of paired-end files!") + print( + f"Something is off, please check you have the same amount of paired-end files!" + ) sys.exit(-1) data = zip( r1_files, r2_files, - itertools.repeat(fastqs_folder, len(r1_files)), itertools.repeat(output_folder, len(r1_files)), ) with mp.Pool(threads) as pool: _ = pool.map(convert_to_10x, data) +def convert_read(fastq_r1: str, fastq_r2: str, output_folder: str): + """Main function for converting pair of MARS-seq read to 10X format. + + Args: + fastq_r1 (str): Input R1 FASTQ + fastq_r2 (str): Input R2 FASTQ + output_folder (str): Output folder + """ + + if not Path(fastq_r1).exists(): + raise ValueError(f"Provided R1 {fastq_r1} does not exist!") + + if not Path(fastq_r2).exists(): + raise ValueError(f"Provided R2 {fastq_r2} does not exist!") + + check_folder(output_folder) + + convert_to_10x((fastq_r1, fastq_r2, output_folder)) + + def whitelist(batch: str, amp_batches: str, well_cells: str): """Generate whitelist for StarSolo. The file should contain cell tags. @@ -169,7 +204,9 @@ def whitelist(batch: str, amp_batches: str, well_cells: str): wells["Cell_barcode"] = wells["Cell_barcode"].str.strip().astype("category") # merge and concat barcodes - wells["Amp_batch_ID"] = wells["Amp_batch_ID"].cat.rename_categories(batches.Pool_barcode.unique()) + wells["Amp_batch_ID"] = wells["Amp_batch_ID"].cat.rename_categories( + batches.Pool_barcode.unique() + ) wells["whitelist"] = wells[["Amp_batch_ID", "Cell_barcode"]].agg("".join, axis=1) # save @@ -180,27 +217,57 @@ def whitelist(batch: str, amp_batches: str, well_cells: str): logging.getLogger().setLevel(logging.INFO) formatter = logging.Formatter("%(asctime)s %(message)s", "%d-%m-%Y %H:%M:%S") - arg_parser = argparse.ArgumentParser(description="Plugin for converting and running velocity on MARS-seq v2.") + arg_parser = argparse.ArgumentParser( + description="Plugin for converting and running velocity on MARS-seq v2." + ) - arg_parser.add_argument("--version", "-v", action="version", version=f"velocity 0.1") + arg_parser.add_argument( + "--version", "-v", action="version", version=f"velocity 0.2" + ) command_parser = arg_parser.add_subparsers(dest="command") # convert - convert_parser = command_parser.add_parser("convert", help="Convert reads to 10X format") - convert_parser.add_argument("--input", type=str, help="Input folder with fastq files", required=True) - convert_parser.add_argument("--output", type=str, help="Output folder", required=True) - convert_parser.add_argument("--threads", type=int, help="Number of threads", required=True, default=4) + convert_parser = command_parser.add_parser( + "convert", help="Convert reads to 10X format" + ) + convert_parser.add_argument( + "--input", type=str, help="Input folder with fastq files", required=True + ) + convert_parser.add_argument( + "--output", type=str, help="Output folder", required=True + ) + convert_parser.add_argument( + "--threads", type=int, help="Number of threads", required=True, default=4 + ) + + # convert_read + convert_read_parser = command_parser.add_parser( + "convert_read", help="Convert one MARS-seq read into 10X format" + ) + convert_read_parser.add_argument("--r1", type=str, help="Input R1", required=True) + convert_read_parser.add_argument("--r2", type=str, help="Input R2", required=True) + convert_read_parser.add_argument( + "--output", type=str, help="Output folder", required=True + ) # whitelist - whitelist_parser = command_parser.add_parser("whitelist", help="Create whitelist for StarSolo.") + whitelist_parser = command_parser.add_parser( + "whitelist", help="Create whitelist for StarSolo." + ) whitelist_parser.add_argument("--batch", type=str, help="Batch name", required=True) - whitelist_parser.add_argument("--amp_batches", type=str, help="Amplification batches [xls]", required=True) - whitelist_parser.add_argument("--well_cells", type=str, help="Well cells [xls]", required=True) + whitelist_parser.add_argument( + "--amp_batches", type=str, help="Amplification batches [xls]", required=True + ) + whitelist_parser.add_argument( + "--well_cells", type=str, help="Well cells [xls]", required=True + ) args = arg_parser.parse_args() if args.command == "convert": convert(args.input, args.output, args.threads) + if args.command == "convert_read": + convert_read(args.r1, args.r2, args.output) elif args.command == "whitelist": whitelist(args.batch, args.amp_batches, args.well_cells) else: diff --git a/conf/base.config b/conf/base.config index 07f968b..3ec4645 100644 --- a/conf/base.config +++ b/conf/base.config @@ -10,9 +10,9 @@ process { - cpus = { check_max( 1 * task.attempt, 'cpus' ) } - memory = { check_max( 6.GB * task.attempt, 'memory' ) } - time = { check_max( 4.h * task.attempt, 'time' ) } + cpus = { 1 * task.attempt } + memory = { 6.GB * task.attempt } + time = { 4.h * task.attempt } errorStrategy = { task.exitStatus in ((130..145) + 104) ? 'retry' : 'finish' } maxRetries = 1 @@ -25,33 +25,30 @@ process { // adding in your local modules too. // See https://www.nextflow.io/docs/latest/config.html#config-process-selectors withLabel:process_single { - cpus = { check_max( 1 , 'cpus' ) } - memory = { check_max( 6.GB * task.attempt, 'memory' ) } - time = { check_max( 4.h * task.attempt, 'time' ) } + cpus = { 1 } + memory = { 6.GB * task.attempt } + time = { 4.h * task.attempt } } withLabel:process_low { - cpus = { check_max( 2 * task.attempt, 'cpus' ) } - memory = { check_max( 12.GB * task.attempt, 'memory' ) } - time = { check_max( 4.h * task.attempt, 'time' ) } + cpus = { 2 * task.attempt } + memory = { 12.GB * task.attempt } + time = { 4.h * task.attempt } } withLabel:process_medium { - cpus = { check_max( 6 * task.attempt, 'cpus' ) } - memory = { check_max( 36.GB * task.attempt, 'memory' ) } - time = { check_max( 8.h * task.attempt, 'time' ) } + cpus = { 6 * task.attempt } + memory = { 36.GB * task.attempt } + time = { 8.h * task.attempt } } withLabel:process_high { - cpus = { check_max( 12 * task.attempt, 'cpus' ) } - memory = { check_max( 72.GB * task.attempt, 'memory' ) } - time = { check_max( 16.h * task.attempt, 'time' ) } + cpus = { 12 * task.attempt } + memory = { 72.GB * task.attempt } + time = { 16.h * task.attempt } } withLabel:process_long { - time = { check_max( 20.h * task.attempt, 'time' ) } + time = { 20.h * task.attempt } } withLabel:process_high_memory { - memory = { check_max( 200.GB * task.attempt, 'memory' ) } - } - withLabel:process_high_cpu { - cpus = { check_max( 30 * task.attempt, 'cpus' ) } + memory = { 200.GB * task.attempt } } withLabel:error_ignore { errorStrategy = 'ignore' @@ -60,7 +57,4 @@ process { errorStrategy = 'retry' maxRetries = 2 } - withName:CUSTOM_DUMPSOFTWAREVERSIONS { - cache = false - } } diff --git a/conf/genomes.config b/conf/genomes.config deleted file mode 100644 index b589c9a..0000000 --- a/conf/genomes.config +++ /dev/null @@ -1,48 +0,0 @@ -/* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - Nextflow config file for Genomes paths -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - These references have to be build manually due - to ERCC spike-ins. - Can be used by any config that customizes the base - path using $params.genomes_base / --genomes_base ----------------------------------------------------------------------------------------- -*/ - -params { - // GENCODE references (https://www.gencodegenes.org/) - genomes { - 'mm10_v32' { - bowtie2 = "${params.genomes_base}/mm10_v32/bowtie2/" - fasta = "${params.genomes_base}/mm10_v32/GRCm39.fa" - fasta_url = "http://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_mouse/release_M32/GRCm39.primary_assembly.genome.fa.gz" - gtf = "${params.genomes_base}/mm10_v32/GRCm39.gtf" - gtf_url = "http://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_mouse/release_M32/gencode.vM32.annotation.gtf.gz" - star = "${params.genomes_base}/mm10_v32/star/" - } - 'mm10' { - bowtie2 = "${params.genomes_base}/mm10/bowtie2/" - fasta = "${params.genomes_base}/mm10/GRCm39.fa" - fasta_url = "http://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_mouse/release_M27/GRCm39.primary_assembly.genome.fa.gz" - gtf = "${params.genomes_base}/mm10/GRCm39.gtf" - gtf_url = "http://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_mouse/release_M27/gencode.vM27.annotation.gtf.gz" - star = "${params.genomes_base}/mm10/star/" - } - 'mm9' { - bowtie2 = "${params.genomes_base}/mm9/bowtie2" - fasta = "${params.genomes_base}/mm9/mm9.fasta" - fasta_url = "https://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_mouse/release_M1/NCBIM37.genome.fa.gz" - gtf = "${params.genomes_base}/mm9/mm9.gtf" - gtf_url = "https://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_mouse/release_M1/gencode.vM1.annotation.gtf.gz" - star = "${params.genomes_base}/mm9/star/" - } - 'GRCh38_v43' { - bowtie2 = "${params.genomes_base}/GRCh38_v43/bowtie2/" - fasta = "${params.genomes_base}/GRCh38_v43/GRCh38.fa" - fasta_url = "http://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_43/GRCh38.primary_assembly.genome.fa.gz" - gtf = "${params.genomes_base}/GRCh38_v43/GRCh38.gtf" - gtf_url = "http://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_human/release_43/gencode.v43.annotation.gtf.gz" - star = "${params.genomes_base}/GRCh38_v43/star/" - } - } -} diff --git a/conf/igenomes.config b/conf/igenomes.config new file mode 100644 index 0000000..3f11437 --- /dev/null +++ b/conf/igenomes.config @@ -0,0 +1,440 @@ +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Nextflow config file for iGenomes paths +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Defines reference genomes using iGenome paths. + Can be used by any config that customises the base path using: + $params.igenomes_base / --igenomes_base +---------------------------------------------------------------------------------------- +*/ + +params { + // illumina iGenomes reference file paths + genomes { + 'GRCh37' { + fasta = "${params.igenomes_base}/Homo_sapiens/Ensembl/GRCh37/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Homo_sapiens/Ensembl/GRCh37/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Homo_sapiens/Ensembl/GRCh37/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Homo_sapiens/Ensembl/GRCh37/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Homo_sapiens/Ensembl/GRCh37/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Homo_sapiens/Ensembl/GRCh37/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Homo_sapiens/Ensembl/GRCh37/Annotation/Genes/genes.bed" + readme = "${params.igenomes_base}/Homo_sapiens/Ensembl/GRCh37/Annotation/README.txt" + mito_name = "MT" + macs_gsize = "2.7e9" + blacklist = "${projectDir}/assets/blacklists/GRCh37-blacklist.bed" + } + 'GRCh38' { + fasta = "${params.igenomes_base}/Homo_sapiens/NCBI/GRCh38/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Homo_sapiens/NCBI/GRCh38/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Homo_sapiens/NCBI/GRCh38/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Homo_sapiens/NCBI/GRCh38/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Homo_sapiens/NCBI/GRCh38/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Homo_sapiens/NCBI/GRCh38/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Homo_sapiens/NCBI/GRCh38/Annotation/Genes/genes.bed" + mito_name = "chrM" + macs_gsize = "2.7e9" + blacklist = "${projectDir}/assets/blacklists/hg38-blacklist.bed" + } + 'CHM13' { + fasta = "${params.igenomes_base}/Homo_sapiens/UCSC/CHM13/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Homo_sapiens/UCSC/CHM13/Sequence/BWAIndex/" + bwamem2 = "${params.igenomes_base}/Homo_sapiens/UCSC/CHM13/Sequence/BWAmem2Index/" + gtf = "${params.igenomes_base}/Homo_sapiens/NCBI/CHM13/Annotation/Genes/genes.gtf" + gff = "ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/009/914/755/GCF_009914755.1_T2T-CHM13v2.0/GCF_009914755.1_T2T-CHM13v2.0_genomic.gff.gz" + mito_name = "chrM" + } + 'GRCm38' { + fasta = "${params.igenomes_base}/Mus_musculus/Ensembl/GRCm38/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Mus_musculus/Ensembl/GRCm38/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Mus_musculus/Ensembl/GRCm38/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Mus_musculus/Ensembl/GRCm38/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Mus_musculus/Ensembl/GRCm38/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Mus_musculus/Ensembl/GRCm38/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Mus_musculus/Ensembl/GRCm38/Annotation/Genes/genes.bed" + readme = "${params.igenomes_base}/Mus_musculus/Ensembl/GRCm38/Annotation/README.txt" + mito_name = "MT" + macs_gsize = "1.87e9" + blacklist = "${projectDir}/assets/blacklists/GRCm38-blacklist.bed" + } + 'TAIR10' { + fasta = "${params.igenomes_base}/Arabidopsis_thaliana/Ensembl/TAIR10/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Arabidopsis_thaliana/Ensembl/TAIR10/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Arabidopsis_thaliana/Ensembl/TAIR10/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Arabidopsis_thaliana/Ensembl/TAIR10/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Arabidopsis_thaliana/Ensembl/TAIR10/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Arabidopsis_thaliana/Ensembl/TAIR10/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Arabidopsis_thaliana/Ensembl/TAIR10/Annotation/Genes/genes.bed" + readme = "${params.igenomes_base}/Arabidopsis_thaliana/Ensembl/TAIR10/Annotation/README.txt" + mito_name = "Mt" + } + 'EB2' { + fasta = "${params.igenomes_base}/Bacillus_subtilis_168/Ensembl/EB2/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Bacillus_subtilis_168/Ensembl/EB2/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Bacillus_subtilis_168/Ensembl/EB2/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Bacillus_subtilis_168/Ensembl/EB2/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Bacillus_subtilis_168/Ensembl/EB2/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Bacillus_subtilis_168/Ensembl/EB2/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Bacillus_subtilis_168/Ensembl/EB2/Annotation/Genes/genes.bed" + readme = "${params.igenomes_base}/Bacillus_subtilis_168/Ensembl/EB2/Annotation/README.txt" + } + 'UMD3.1' { + fasta = "${params.igenomes_base}/Bos_taurus/Ensembl/UMD3.1/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Bos_taurus/Ensembl/UMD3.1/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Bos_taurus/Ensembl/UMD3.1/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Bos_taurus/Ensembl/UMD3.1/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Bos_taurus/Ensembl/UMD3.1/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Bos_taurus/Ensembl/UMD3.1/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Bos_taurus/Ensembl/UMD3.1/Annotation/Genes/genes.bed" + readme = "${params.igenomes_base}/Bos_taurus/Ensembl/UMD3.1/Annotation/README.txt" + mito_name = "MT" + } + 'WBcel235' { + fasta = "${params.igenomes_base}/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Caenorhabditis_elegans/Ensembl/WBcel235/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Caenorhabditis_elegans/Ensembl/WBcel235/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Caenorhabditis_elegans/Ensembl/WBcel235/Annotation/Genes/genes.bed" + mito_name = "MtDNA" + macs_gsize = "9e7" + } + 'CanFam3.1' { + fasta = "${params.igenomes_base}/Canis_familiaris/Ensembl/CanFam3.1/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Canis_familiaris/Ensembl/CanFam3.1/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Canis_familiaris/Ensembl/CanFam3.1/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Canis_familiaris/Ensembl/CanFam3.1/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Canis_familiaris/Ensembl/CanFam3.1/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Canis_familiaris/Ensembl/CanFam3.1/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Canis_familiaris/Ensembl/CanFam3.1/Annotation/Genes/genes.bed" + readme = "${params.igenomes_base}/Canis_familiaris/Ensembl/CanFam3.1/Annotation/README.txt" + mito_name = "MT" + } + 'GRCz10' { + fasta = "${params.igenomes_base}/Danio_rerio/Ensembl/GRCz10/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Danio_rerio/Ensembl/GRCz10/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Danio_rerio/Ensembl/GRCz10/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Danio_rerio/Ensembl/GRCz10/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Danio_rerio/Ensembl/GRCz10/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Danio_rerio/Ensembl/GRCz10/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Danio_rerio/Ensembl/GRCz10/Annotation/Genes/genes.bed" + mito_name = "MT" + } + 'BDGP6' { + fasta = "${params.igenomes_base}/Drosophila_melanogaster/Ensembl/BDGP6/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Drosophila_melanogaster/Ensembl/BDGP6/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Drosophila_melanogaster/Ensembl/BDGP6/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Drosophila_melanogaster/Ensembl/BDGP6/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Drosophila_melanogaster/Ensembl/BDGP6/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Drosophila_melanogaster/Ensembl/BDGP6/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Drosophila_melanogaster/Ensembl/BDGP6/Annotation/Genes/genes.bed" + mito_name = "M" + macs_gsize = "1.2e8" + } + 'EquCab2' { + fasta = "${params.igenomes_base}/Equus_caballus/Ensembl/EquCab2/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Equus_caballus/Ensembl/EquCab2/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Equus_caballus/Ensembl/EquCab2/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Equus_caballus/Ensembl/EquCab2/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Equus_caballus/Ensembl/EquCab2/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Equus_caballus/Ensembl/EquCab2/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Equus_caballus/Ensembl/EquCab2/Annotation/Genes/genes.bed" + readme = "${params.igenomes_base}/Equus_caballus/Ensembl/EquCab2/Annotation/README.txt" + mito_name = "MT" + } + 'EB1' { + fasta = "${params.igenomes_base}/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Annotation/Genes/genes.bed" + readme = "${params.igenomes_base}/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Annotation/README.txt" + } + 'Galgal4' { + fasta = "${params.igenomes_base}/Gallus_gallus/Ensembl/Galgal4/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Gallus_gallus/Ensembl/Galgal4/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Gallus_gallus/Ensembl/Galgal4/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Gallus_gallus/Ensembl/Galgal4/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Gallus_gallus/Ensembl/Galgal4/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Gallus_gallus/Ensembl/Galgal4/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Gallus_gallus/Ensembl/Galgal4/Annotation/Genes/genes.bed" + mito_name = "MT" + } + 'Gm01' { + fasta = "${params.igenomes_base}/Glycine_max/Ensembl/Gm01/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Glycine_max/Ensembl/Gm01/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Glycine_max/Ensembl/Gm01/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Glycine_max/Ensembl/Gm01/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Glycine_max/Ensembl/Gm01/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Glycine_max/Ensembl/Gm01/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Glycine_max/Ensembl/Gm01/Annotation/Genes/genes.bed" + readme = "${params.igenomes_base}/Glycine_max/Ensembl/Gm01/Annotation/README.txt" + } + 'Mmul_1' { + fasta = "${params.igenomes_base}/Macaca_mulatta/Ensembl/Mmul_1/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Macaca_mulatta/Ensembl/Mmul_1/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Macaca_mulatta/Ensembl/Mmul_1/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Macaca_mulatta/Ensembl/Mmul_1/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Macaca_mulatta/Ensembl/Mmul_1/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Macaca_mulatta/Ensembl/Mmul_1/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Macaca_mulatta/Ensembl/Mmul_1/Annotation/Genes/genes.bed" + readme = "${params.igenomes_base}/Macaca_mulatta/Ensembl/Mmul_1/Annotation/README.txt" + mito_name = "MT" + } + 'IRGSP-1.0' { + fasta = "${params.igenomes_base}/Oryza_sativa_japonica/Ensembl/IRGSP-1.0/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Oryza_sativa_japonica/Ensembl/IRGSP-1.0/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Oryza_sativa_japonica/Ensembl/IRGSP-1.0/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Oryza_sativa_japonica/Ensembl/IRGSP-1.0/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Oryza_sativa_japonica/Ensembl/IRGSP-1.0/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Oryza_sativa_japonica/Ensembl/IRGSP-1.0/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Oryza_sativa_japonica/Ensembl/IRGSP-1.0/Annotation/Genes/genes.bed" + mito_name = "Mt" + } + 'CHIMP2.1.4' { + fasta = "${params.igenomes_base}/Pan_troglodytes/Ensembl/CHIMP2.1.4/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Pan_troglodytes/Ensembl/CHIMP2.1.4/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Pan_troglodytes/Ensembl/CHIMP2.1.4/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Pan_troglodytes/Ensembl/CHIMP2.1.4/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Pan_troglodytes/Ensembl/CHIMP2.1.4/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Pan_troglodytes/Ensembl/CHIMP2.1.4/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Pan_troglodytes/Ensembl/CHIMP2.1.4/Annotation/Genes/genes.bed" + readme = "${params.igenomes_base}/Pan_troglodytes/Ensembl/CHIMP2.1.4/Annotation/README.txt" + mito_name = "MT" + } + 'Rnor_5.0' { + fasta = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_5.0/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_5.0/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_5.0/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_5.0/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_5.0/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_5.0/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_5.0/Annotation/Genes/genes.bed" + mito_name = "MT" + } + 'Rnor_6.0' { + fasta = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_6.0/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_6.0/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_6.0/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_6.0/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_6.0/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_6.0/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Rattus_norvegicus/Ensembl/Rnor_6.0/Annotation/Genes/genes.bed" + mito_name = "MT" + } + 'R64-1-1' { + fasta = "${params.igenomes_base}/Saccharomyces_cerevisiae/Ensembl/R64-1-1/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Saccharomyces_cerevisiae/Ensembl/R64-1-1/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Saccharomyces_cerevisiae/Ensembl/R64-1-1/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Saccharomyces_cerevisiae/Ensembl/R64-1-1/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Saccharomyces_cerevisiae/Ensembl/R64-1-1/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Saccharomyces_cerevisiae/Ensembl/R64-1-1/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Saccharomyces_cerevisiae/Ensembl/R64-1-1/Annotation/Genes/genes.bed" + mito_name = "MT" + macs_gsize = "1.2e7" + } + 'EF2' { + fasta = "${params.igenomes_base}/Schizosaccharomyces_pombe/Ensembl/EF2/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Schizosaccharomyces_pombe/Ensembl/EF2/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Schizosaccharomyces_pombe/Ensembl/EF2/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Schizosaccharomyces_pombe/Ensembl/EF2/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Schizosaccharomyces_pombe/Ensembl/EF2/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Schizosaccharomyces_pombe/Ensembl/EF2/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Schizosaccharomyces_pombe/Ensembl/EF2/Annotation/Genes/genes.bed" + readme = "${params.igenomes_base}/Schizosaccharomyces_pombe/Ensembl/EF2/Annotation/README.txt" + mito_name = "MT" + macs_gsize = "1.21e7" + } + 'Sbi1' { + fasta = "${params.igenomes_base}/Sorghum_bicolor/Ensembl/Sbi1/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Sorghum_bicolor/Ensembl/Sbi1/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Sorghum_bicolor/Ensembl/Sbi1/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Sorghum_bicolor/Ensembl/Sbi1/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Sorghum_bicolor/Ensembl/Sbi1/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Sorghum_bicolor/Ensembl/Sbi1/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Sorghum_bicolor/Ensembl/Sbi1/Annotation/Genes/genes.bed" + readme = "${params.igenomes_base}/Sorghum_bicolor/Ensembl/Sbi1/Annotation/README.txt" + } + 'Sscrofa10.2' { + fasta = "${params.igenomes_base}/Sus_scrofa/Ensembl/Sscrofa10.2/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Sus_scrofa/Ensembl/Sscrofa10.2/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Sus_scrofa/Ensembl/Sscrofa10.2/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Sus_scrofa/Ensembl/Sscrofa10.2/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Sus_scrofa/Ensembl/Sscrofa10.2/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Sus_scrofa/Ensembl/Sscrofa10.2/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Sus_scrofa/Ensembl/Sscrofa10.2/Annotation/Genes/genes.bed" + readme = "${params.igenomes_base}/Sus_scrofa/Ensembl/Sscrofa10.2/Annotation/README.txt" + mito_name = "MT" + } + 'AGPv3' { + fasta = "${params.igenomes_base}/Zea_mays/Ensembl/AGPv3/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Zea_mays/Ensembl/AGPv3/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Zea_mays/Ensembl/AGPv3/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Zea_mays/Ensembl/AGPv3/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Zea_mays/Ensembl/AGPv3/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Zea_mays/Ensembl/AGPv3/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Zea_mays/Ensembl/AGPv3/Annotation/Genes/genes.bed" + mito_name = "Mt" + } + 'hg38' { + fasta = "${params.igenomes_base}/Homo_sapiens/UCSC/hg38/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Homo_sapiens/UCSC/hg38/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Homo_sapiens/UCSC/hg38/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Homo_sapiens/UCSC/hg38/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Homo_sapiens/UCSC/hg38/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Homo_sapiens/UCSC/hg38/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Homo_sapiens/UCSC/hg38/Annotation/Genes/genes.bed" + mito_name = "chrM" + macs_gsize = "2.7e9" + blacklist = "${projectDir}/assets/blacklists/hg38-blacklist.bed" + } + 'hg19' { + fasta = "${params.igenomes_base}/Homo_sapiens/UCSC/hg19/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Homo_sapiens/UCSC/hg19/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Homo_sapiens/UCSC/hg19/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Homo_sapiens/UCSC/hg19/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Homo_sapiens/UCSC/hg19/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Homo_sapiens/UCSC/hg19/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Homo_sapiens/UCSC/hg19/Annotation/Genes/genes.bed" + readme = "${params.igenomes_base}/Homo_sapiens/UCSC/hg19/Annotation/README.txt" + mito_name = "chrM" + macs_gsize = "2.7e9" + blacklist = "${projectDir}/assets/blacklists/hg19-blacklist.bed" + } + 'mm10' { + fasta = "${params.igenomes_base}/Mus_musculus/UCSC/mm10/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Mus_musculus/UCSC/mm10/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Mus_musculus/UCSC/mm10/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Mus_musculus/UCSC/mm10/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Mus_musculus/UCSC/mm10/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Mus_musculus/UCSC/mm10/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Mus_musculus/UCSC/mm10/Annotation/Genes/genes.bed" + readme = "${params.igenomes_base}/Mus_musculus/UCSC/mm10/Annotation/README.txt" + mito_name = "chrM" + macs_gsize = "1.87e9" + blacklist = "${projectDir}/assets/blacklists/mm10-blacklist.bed" + } + 'bosTau8' { + fasta = "${params.igenomes_base}/Bos_taurus/UCSC/bosTau8/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Bos_taurus/UCSC/bosTau8/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Bos_taurus/UCSC/bosTau8/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Bos_taurus/UCSC/bosTau8/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Bos_taurus/UCSC/bosTau8/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Bos_taurus/UCSC/bosTau8/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Bos_taurus/UCSC/bosTau8/Annotation/Genes/genes.bed" + mito_name = "chrM" + } + 'ce10' { + fasta = "${params.igenomes_base}/Caenorhabditis_elegans/UCSC/ce10/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Caenorhabditis_elegans/UCSC/ce10/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Caenorhabditis_elegans/UCSC/ce10/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Caenorhabditis_elegans/UCSC/ce10/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Caenorhabditis_elegans/UCSC/ce10/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Caenorhabditis_elegans/UCSC/ce10/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Caenorhabditis_elegans/UCSC/ce10/Annotation/Genes/genes.bed" + readme = "${params.igenomes_base}/Caenorhabditis_elegans/UCSC/ce10/Annotation/README.txt" + mito_name = "chrM" + macs_gsize = "9e7" + } + 'canFam3' { + fasta = "${params.igenomes_base}/Canis_familiaris/UCSC/canFam3/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Canis_familiaris/UCSC/canFam3/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Canis_familiaris/UCSC/canFam3/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Canis_familiaris/UCSC/canFam3/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Canis_familiaris/UCSC/canFam3/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Canis_familiaris/UCSC/canFam3/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Canis_familiaris/UCSC/canFam3/Annotation/Genes/genes.bed" + readme = "${params.igenomes_base}/Canis_familiaris/UCSC/canFam3/Annotation/README.txt" + mito_name = "chrM" + } + 'danRer10' { + fasta = "${params.igenomes_base}/Danio_rerio/UCSC/danRer10/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Danio_rerio/UCSC/danRer10/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Danio_rerio/UCSC/danRer10/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Danio_rerio/UCSC/danRer10/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Danio_rerio/UCSC/danRer10/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Danio_rerio/UCSC/danRer10/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Danio_rerio/UCSC/danRer10/Annotation/Genes/genes.bed" + mito_name = "chrM" + macs_gsize = "1.37e9" + } + 'dm6' { + fasta = "${params.igenomes_base}/Drosophila_melanogaster/UCSC/dm6/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Drosophila_melanogaster/UCSC/dm6/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Drosophila_melanogaster/UCSC/dm6/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Drosophila_melanogaster/UCSC/dm6/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Drosophila_melanogaster/UCSC/dm6/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Drosophila_melanogaster/UCSC/dm6/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Drosophila_melanogaster/UCSC/dm6/Annotation/Genes/genes.bed" + mito_name = "chrM" + macs_gsize = "1.2e8" + } + 'equCab2' { + fasta = "${params.igenomes_base}/Equus_caballus/UCSC/equCab2/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Equus_caballus/UCSC/equCab2/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Equus_caballus/UCSC/equCab2/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Equus_caballus/UCSC/equCab2/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Equus_caballus/UCSC/equCab2/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Equus_caballus/UCSC/equCab2/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Equus_caballus/UCSC/equCab2/Annotation/Genes/genes.bed" + readme = "${params.igenomes_base}/Equus_caballus/UCSC/equCab2/Annotation/README.txt" + mito_name = "chrM" + } + 'galGal4' { + fasta = "${params.igenomes_base}/Gallus_gallus/UCSC/galGal4/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Gallus_gallus/UCSC/galGal4/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Gallus_gallus/UCSC/galGal4/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Gallus_gallus/UCSC/galGal4/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Gallus_gallus/UCSC/galGal4/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Gallus_gallus/UCSC/galGal4/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Gallus_gallus/UCSC/galGal4/Annotation/Genes/genes.bed" + readme = "${params.igenomes_base}/Gallus_gallus/UCSC/galGal4/Annotation/README.txt" + mito_name = "chrM" + } + 'panTro4' { + fasta = "${params.igenomes_base}/Pan_troglodytes/UCSC/panTro4/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Pan_troglodytes/UCSC/panTro4/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Pan_troglodytes/UCSC/panTro4/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Pan_troglodytes/UCSC/panTro4/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Pan_troglodytes/UCSC/panTro4/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Pan_troglodytes/UCSC/panTro4/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Pan_troglodytes/UCSC/panTro4/Annotation/Genes/genes.bed" + readme = "${params.igenomes_base}/Pan_troglodytes/UCSC/panTro4/Annotation/README.txt" + mito_name = "chrM" + } + 'rn6' { + fasta = "${params.igenomes_base}/Rattus_norvegicus/UCSC/rn6/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Rattus_norvegicus/UCSC/rn6/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Rattus_norvegicus/UCSC/rn6/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Rattus_norvegicus/UCSC/rn6/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Rattus_norvegicus/UCSC/rn6/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Rattus_norvegicus/UCSC/rn6/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Rattus_norvegicus/UCSC/rn6/Annotation/Genes/genes.bed" + mito_name = "chrM" + } + 'sacCer3' { + fasta = "${params.igenomes_base}/Saccharomyces_cerevisiae/UCSC/sacCer3/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Saccharomyces_cerevisiae/UCSC/sacCer3/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Saccharomyces_cerevisiae/UCSC/sacCer3/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Saccharomyces_cerevisiae/UCSC/sacCer3/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Saccharomyces_cerevisiae/UCSC/sacCer3/Sequence/BismarkIndex/" + readme = "${params.igenomes_base}/Saccharomyces_cerevisiae/UCSC/sacCer3/Annotation/README.txt" + mito_name = "chrM" + macs_gsize = "1.2e7" + } + 'susScr3' { + fasta = "${params.igenomes_base}/Sus_scrofa/UCSC/susScr3/Sequence/WholeGenomeFasta/genome.fa" + bwa = "${params.igenomes_base}/Sus_scrofa/UCSC/susScr3/Sequence/BWAIndex/version0.6.0/" + bowtie2 = "${params.igenomes_base}/Sus_scrofa/UCSC/susScr3/Sequence/Bowtie2Index/" + star = "${params.igenomes_base}/Sus_scrofa/UCSC/susScr3/Sequence/STARIndex/" + bismark = "${params.igenomes_base}/Sus_scrofa/UCSC/susScr3/Sequence/BismarkIndex/" + gtf = "${params.igenomes_base}/Sus_scrofa/UCSC/susScr3/Annotation/Genes/genes.gtf" + bed12 = "${params.igenomes_base}/Sus_scrofa/UCSC/susScr3/Annotation/Genes/genes.bed" + readme = "${params.igenomes_base}/Sus_scrofa/UCSC/susScr3/Annotation/README.txt" + mito_name = "chrM" + } + } +} diff --git a/conf/igenomes_ignored.config b/conf/igenomes_ignored.config new file mode 100644 index 0000000..b4034d8 --- /dev/null +++ b/conf/igenomes_ignored.config @@ -0,0 +1,9 @@ +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Nextflow config file for iGenomes paths +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + Empty genomes dictionary to use when igenomes is ignored. +---------------------------------------------------------------------------------------- +*/ + +params.genomes = [:] diff --git a/conf/modules.config b/conf/modules.config index 1cb69c5..096f297 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -18,20 +18,21 @@ process { saveAs: { filename -> filename.equals('versions.yml') ? null : filename } ] - withName: SAMPLESHEET_CHECK { + withName: FASTQC { + ext.args = '--quiet' + ext.when = { !params.skip_fastqc } publishDir = [ - path: { "${params.outdir}/pipeline_info" }, + path: { "${params.outdir}/${meta.id}/fastqc/" }, mode: params.publish_dir_mode, - saveAs: { filename -> filename.equals('versions.yml') ? null : filename } ] } - withName: FASTQC { - ext.args = '--quiet' - ext.when = { !params.skip_qc } + withName: 'MULTIQC' { + ext.args = { params.multiqc_title ? "--title \"$params.multiqc_title\"" : '' } publishDir = [ - path: { "${params.outdir}/${meta.id}/fastqc/" }, + path: { "${params.outdir}/multiqc" }, mode: params.publish_dir_mode, + saveAs: { filename -> filename.equals('versions.yml') ? null : filename } ] } @@ -43,21 +44,9 @@ process { ] } - withName: "DOWNLOAD_FASTA|DOWNLOAD_GTF" { - publishDir = [ - enabled: false - ] - } - - withName: "GUNZIP_FASTA" { + withName: 'GUNZIP_FASTA|GUNZIP_GTF'{ publishDir = [ - enabled: false - ] - } - - withName: "GUNZIP_GTF" { - publishDir = [ - path: { "${params.outdir}/references/${params.genome}/" }, + path: { "${params.outdir}/references/" }, mode: params.publish_dir_mode, ] } @@ -70,25 +59,22 @@ process { withName: CAT_FASTA { publishDir = [ - path: { "${params.outdir}/references/${params.genome}/" }, + path: { "${params.outdir}/references/" }, mode: params.publish_dir_mode, ] } withName: BOWTIE2_BUILD { publishDir = [ - path: { "${params.outdir}/references/${params.genome}" }, + path: { "${params.outdir}/references/" }, mode: params.publish_dir_mode, ] } withName: STAR_GENOMEGENERATE { ext.args = "--sjdbOverhang ${params.read_length - 1}" - cpus = { check_max( 24 * task.attempt, 'cpus' ) } - memory = { check_max( 100.GB * task.attempt, 'memory' ) } - time = { check_max( 2.d * task.attempt, 'time' ) } publishDir = [ - path: { "${params.outdir}/references/${params.genome}" }, + path: { "${params.outdir}/references/" }, mode: params.publish_dir_mode, saveAs: { filename -> filename.equals('versions.yml') ? null : filename }, ] @@ -176,7 +162,7 @@ process { ] } - withName: VELOCITY_CONVERT { + withName: 'VELOCITY_CONVERT|CAT_FASTQ' { publishDir = [ enabled: false ] @@ -199,8 +185,8 @@ process { ] } - withName: VELOCITY_STARSOLO { - ext.args = "--readFilesCommand zcat --soloType CB_UMI_Simple --soloCBstart 1 --soloCBlen 11 --soloUMIstart 12 --soloUMIlen 8 --outSAMtype BAM SortedByCoordinate --soloFeatures Gene Velocyto" + withName: STARSOLO { + ext.args = "--outSAMtype BAM SortedByCoordinate --soloFeatures Gene Velocyto" publishDir = [ path: { "${params.outdir}/${meta.id}/velocity/" }, mode: params.publish_dir_mode, @@ -208,13 +194,4 @@ process { ] } - withName: MULTIQC { - ext.when = { !params.skip_qc } - publishDir = [ - path: { "${params.outdir}/multiqc" }, - mode: params.publish_dir_mode, - saveAs: { filename -> filename.equals('versions.yml') ? null : filename } - ] - } - } diff --git a/conf/test.config b/conf/test.config index 27b93f6..fd272f3 100644 --- a/conf/test.config +++ b/conf/test.config @@ -10,18 +10,20 @@ ---------------------------------------------------------------------------------------- */ +process { + resourceLimits = [ + cpus: 4, + memory: '15.GB', + time: '1.h' + ] +} + params { config_profile_name = 'Test profile' config_profile_description = 'Minimal test dataset to check pipeline function' - // Limit resources so that this can run on GitHub Actions - max_cpus = 2 - max_memory = '6.GB' - max_time = '6.h' - // Input data input = 'https://raw.githubusercontent.com/nf-core/test-datasets/marsseq/SB26-AB339.csv' - - // Genome references - genome = 'mm10' + fasta = 'https://github.com/nf-core/test-datasets/raw/scrnaseq/reference/GRCm38.p6.genome.chr19.fa' + gtf = 'https://github.com/nf-core/test-datasets/raw/scrnaseq/reference/gencode.vM19.annotation.chr19.gtf' } diff --git a/conf/test_full.config b/conf/test_full.config index 1e37473..8e7acc6 100644 --- a/conf/test_full.config +++ b/conf/test_full.config @@ -16,7 +16,6 @@ params { // Input data for full size test input = 'https://raw.githubusercontent.com/nf-core/test-datasets/marsseq/SB26.csv' - - // Genome references - genome = 'mm10' + fasta = 'https://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_mouse/release_M32/GRCm39.primary_assembly.genome.fa.gz' + gtf = 'https://ftp.ebi.ac.uk/pub/databases/gencode/Gencode_mouse/release_M32/gencode.vM32.annotation.gtf.gz' } diff --git a/docs/images/mqc_fastqc_adapter.png b/docs/images/mqc_fastqc_adapter.png deleted file mode 100755 index 361d0e4..0000000 Binary files a/docs/images/mqc_fastqc_adapter.png and /dev/null differ diff --git a/docs/images/mqc_fastqc_counts.png b/docs/images/mqc_fastqc_counts.png deleted file mode 100755 index cb39ebb..0000000 Binary files a/docs/images/mqc_fastqc_counts.png and /dev/null differ diff --git a/docs/images/mqc_fastqc_quality.png b/docs/images/mqc_fastqc_quality.png deleted file mode 100755 index a4b89bf..0000000 Binary files a/docs/images/mqc_fastqc_quality.png and /dev/null differ diff --git a/docs/images/nf-core-marsseq_logo_dark.png b/docs/images/nf-core-marsseq_logo_dark.png index 325cce6..ddf056f 100644 Binary files a/docs/images/nf-core-marsseq_logo_dark.png and b/docs/images/nf-core-marsseq_logo_dark.png differ diff --git a/docs/images/nf-core-marsseq_logo_light.png b/docs/images/nf-core-marsseq_logo_light.png index e089430..4b22493 100644 Binary files a/docs/images/nf-core-marsseq_logo_light.png and b/docs/images/nf-core-marsseq_logo_light.png differ diff --git a/docs/images/workflow.png b/docs/images/workflow.png index 2a70cce..c587481 100644 Binary files a/docs/images/workflow.png and b/docs/images/workflow.png differ diff --git a/docs/output.md b/docs/output.md index e391ee7..5baffdf 100644 --- a/docs/output.md +++ b/docs/output.md @@ -10,7 +10,7 @@ The directories listed below will be created in the results directory after the The pipeline is built using [Nextflow](https://www.nextflow.io/) and processes data using the following steps: -- [Download and build references](#download-and-build-references) - Build references needer to run the pipeline +- [Prepare genome](#prepare-genome) - Build references needer to run the pipeline - [Prepare pipeline](#prepare-pipeline) - [Label reads](#label-reads) - [Align reads](#align-preads) @@ -26,55 +26,35 @@ The pipeline is executed per `Batch` and therefore the folder structure looks li ```console results/ -|-- multiqc -|-- pipeline_info -|-- references -`-- +├── multiqc +├── pipeline_info +├── references +└── SB26 + ├── data + ├── fastqc + ├── output + ├── QC + ├── SB26.sam + └── velocity ``` -## Download and build references +## Prepare genome -
-Output files +The pipeline requires ERCC (spike-ins) to be included in the reference genome. To +accomdate this, the pipeline requires `fasta` and `gtf` reference files. We recommend +using files from [GENCODE](https://www.gencodegenes.org). Reference indexes are built +based on set `--aligner` parameter. ```console -. -└── - ├── bowtie2 - │ ├── .1.bt2 - │ ├── .2.bt2 - │ ├── .3.bt2 - │ ├── .4.bt2 - │ ├── .rev.1.bt2 - │ └── .rev.2.bt2 - ├── .fa - ├── .gtf - ├── star - │ ├── chrLength.txt - │ ├── chrNameLength.txt - │ ├── chrName.txt - │ ├── chrStart.txt - │ ├── exonGeTrInfo.tab - │ ├── exonInfo.tab - │ ├── geneInfo.tab - │ ├── Genome - │ ├── genomeParameters.txt - │ ├── Log.out - │ ├── SA - │ ├── SAindex - │ ├── sjdbInfo.txt - │ ├── sjdbList.fromGTF.out.tab - │ ├── sjdbList.out.tab - │ └── transcriptInfo.tab - └── versions.yml +results/references +├── bowtie2 +├── gencode.vM32.annotation.gtf +├── GRCm39.primary_assembly.genome_ercc.fa +├── GRCm39.primary_assembly.genome.fa +├── star +└── versions.yml ``` -
- -The pipeline downloads references from GENCODE database. This is required, because -the MARS-seq is using ERCC spike-ins, which have to be appended. Next it builds -bowtie2 index. If `--velocity` flag is set, star index is also built. - ## Prepare pipeline
@@ -85,7 +65,6 @@ bowtie2 index. If `--velocity` flag is set, star index is also built. - `gene_intervals.txt`: Information about gene (chromosome, start, end, strand and symbol) - `seq_batches.txt`: Sequencing batches - `wells_cells.txt`: Well cells - - `*fastq.gz`: Raw reads
@@ -121,11 +100,11 @@ folder. Split reads are aligned using `bowtie2`. Next, all the aligned reads are merged into one `SAM` file which is used as an input for demultiplexing. -If `--velocity` flag is set, the reads are also aligned using `StarSolo` to estimated -both spliced and unspliced reads which can be used for RNA velocity estimation. -This is an additional plugin which we developed. In short MARS-seq2.0 reads are -converted to `10X v2` format. Additionally, a whitelist is generated for aligned -to perform demultiplexing. +If `--aligner` flag is set to `bowtie2_star` or `star`, the reads are also aligned +using `StarSolo` to estimated both spliced and unspliced reads which can be used +for RNA velocity estimation. This is an additional plugin which we developed. +In short MARS-seq2.0 reads are converted to `10X v2` format. Additionally, a +whitelist is generated for aligned to perform demultiplexing.
Output files @@ -133,13 +112,11 @@ to perform demultiplexing. - `` - `.sam`: Merged aligned reads into one SAM file with `bowtie2` - `velocity/` - - `Solo.out/*`: Output from StarSolo (Gene, GeneFull, SJ, Velocyto and Barcode.stats) - - `Aligned.sortedByCoord.out.bam`: Aligned reads - - `Log.final.out`: STAR alignment report containing the mapping results summary - - `Log.out` and `Log.progress.out`: STAR log files containing detailed information about the run. Typically only useful for debugging purposes - - `.cutadapt.log`: Log file from running `cutadapt` - `_{1,2}.trim.fastq.gz`: Trimmed pair-end converted `10X v2` reads - - `SJ.out.tab`: File containing filtered splice junctions detected after mapping the reads + - `.cutadapt.log`: Log file from running `cutadapt` + - `.Log.final.out`: STAR alignment report containing the mapping results summary + - `.Log.out` and `.Log.progress.out`: STAR log files containing detailed information about the run. Typically only useful for debugging purposes + - `.Solo.out/*`: Output from StarSolo (Gene, GeneFull, SJ, Velocyto and Barcode.stats) - `whitelist.txt`: File containing cell barcodes (combination of pool and cell barcode)
@@ -194,14 +171,6 @@ Internal script for generating QC report after `bowtie2` alignment and demultipl [FastQC](http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) gives general quality metrics about your sequenced reads. It provides information about the quality score distribution across your reads, per base sequence content (%A/T/G/C), adapter contamination and overrepresented sequences. For further reading and documentation see the [FastQC help pages](http://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/). -![MultiQC - FastQC sequence counts plot](images/mqc_fastqc_counts.png) - -![MultiQC - FastQC mean quality scores plot](images/mqc_fastqc_quality.png) - -![MultiQC - FastQC adapter content plot](images/mqc_fastqc_adapter.png) - -> **NB:** The FastQC plots displayed in the MultiQC report shows _untrimmed_ reads. They may contain adapter sequence and potentially regions with low quality. - ### MultiQC
@@ -229,6 +198,7 @@ Results generated by MultiQC collate pipeline QC from supported tools e.g. FastQ - Reports generated by Nextflow: `execution_report.html`, `execution_timeline.html`, `execution_trace.txt` and `pipeline_dag.dot`/`pipeline_dag.svg`. - Reports generated by the pipeline: `pipeline_report.html`, `pipeline_report.txt` and `software_versions.yml`. The `pipeline_report*` files will only be present if the `--email` / `--email_on_fail` parameter's are used when running the pipeline. - Reformatted samplesheet files used as input to the pipeline: `samplesheet.valid.csv`. + - Parameters used by the pipeline run: `params.json`.
diff --git a/docs/usage.md b/docs/usage.md index 66e92cf..d50baf4 100644 --- a/docs/usage.md +++ b/docs/usage.md @@ -6,8 +6,45 @@ ## Introduction -nf-core/marsseq is a pre-processing pipeline for MARS-seq experiments. We additionally introduce RNA velocity workflow that can be used to study -cell dynamics along differentiation. +nf-core/marsseq is a pre-processing pipeline for MARS-seq experiments. We additionally introduce RNA velocity workflow that can be used to study cell dynamics along differentiation. + +## Metadata information + +The pipeline requires 3 additional files for experiment. + +- [amp_batches.xlsx](../assets/amp_batches.xlsx) + - **Amp_batch_ID**: Amplification batch unique identifier + - **Seq_batch_ID**: The ID of the sequencing batch associated with this amplification batch + - **Protocol_version_ID**: `Mars_2` (do not change, will be deprecated in next release) + - **Pool_barcode**: Pool barcode sequence + - **R2_design**: `7W.8R` (do not change, used by `demultiplex.pl`) + - asdsa + - **Experiment_ID**: An experiment ID + - **Owner**: The person conducted the experiment + - **Description**: Description of amplification batch +- [wells_cells.xlsx](../assets/wells_cells.xlsx) + - **Well_ID**: Well/Cell unique identifier + - **Well_coordinates**: The position of the well on the place (row & column, e.g. L23) + - **plate_ID**: The ID of the plate associated with this well + - **Subject_ID**: The ID of the subject that donated the cell for this well (e.g. mouse ID) + - **Amp_batch_ID**: The amplification batch associated with this well + - **Cell_barcode**: The well barcode sequence + - **Spike_type**: `ERCC_mix1` (do not change) + - **Spike_dilution**: `0.000025` (do not change unless required) + - **Spike_volume_ul**: `0.01` (do not change unless required) + - **Number_of_cells**: `1` (do not change unless required) + - **is_primer_added**: `1` (do not change unless required) +- [seq_batches.xslx](../assets/seq_batches.xlsx) + - **Seq_batch_ID**: Sequencing batch Unique identifier + - **Run_name**: Short description + - **Date**: Date of sequencing + - **Genome_assembly**: Genome (not used in the pipeline, will be deprecated in next release) + - **Spike_type**: Usually "ERCC_mix1" (do not change) + - **R1_design**: `5I.4P.51M` (do not change, used by `demultiplex.pl`) + - Explanation: 5bps Ignore, 4bps Pool barcode, 51bps mRNA + - **Notes**: Additional notes (ignored in pipeline) + +For more examples please see [SB26](https://raw.githubusercontent.com/nf-core/test-datasets/marsseq/SB26.csv). The original documentation for MARS-seq2.0 can be found [here](https://tanaylab.github.io/old_resources/pages/672.html). ## Samplesheet input @@ -59,7 +96,7 @@ An [example samplesheet](../assets/samplesheet.csv) has been provided with the p The typical command for running the pipeline is as follows: ```bash -nextflow run nf-core/marsseq --input ./samplesheet.csv --outdir ./results --genome GRCh37 -profile docker +nextflow run nf-core/marsseq --input ./samplesheet.csv --outdir ./results --fasta genome.fasta --gtf annotation.gtf -profile docker ``` This will launch the pipeline with the `docker` configuration profile. See below for more information about profiles. @@ -77,7 +114,9 @@ If you wish to repeatedly use the same parameters for multiple runs, rather than Pipeline settings can be provided in a `yaml` or `json` file via `-params-file `. -> ⚠️ Do not use `-c ` to specify parameters as this will result in errors. Custom config files specified with `-c` must only be used for [tuning process resource specifications](https://nf-co.re/docs/usage/configuration#tuning-workflow-resources), other infrastructural tweaks (such as output directories), or module arguments (args). +:::warning +Do not use `-c ` to specify parameters as this will result in errors. Custom config files specified with `-c` must only be used for [tuning process resource specifications](https://nf-co.re/docs/usage/configuration#tuning-workflow-resources), other infrastructural tweaks (such as output directories), or module arguments (args). +::: The above pipeline run specified with a params file in yaml format: @@ -85,12 +124,13 @@ The above pipeline run specified with a params file in yaml format: nextflow run nf-core/marsseq -profile docker -params-file params.yaml ``` -with `params.yaml` containing: +with: -```yaml +```yaml title="params.yaml" input: './samplesheet.csv' outdir: './results/' -genome: 'GRCh37' +fasta: 'genome.fasta' +gtf: 'annotation.gtf' <...> ``` @@ -114,11 +154,15 @@ This version number will be logged in reports when you run the pipeline, so that To further assist in reproducbility, you can use share and re-use [parameter files](#running-the-pipeline) to repeat pipeline runs with the same settings without having to write out a command with every single parameter. -> 💡 If you wish to share such profile (such as upload as supplementary material for academic publications), make sure to NOT include cluster specific paths to files, nor institutional specific profiles. +:::tip +If you wish to share such profile (such as upload as supplementary material for academic publications), make sure to NOT include cluster specific paths to files, nor institutional specific profiles. +::: ## Core Nextflow arguments -> **NB:** These options are part of Nextflow and use a _single_ hyphen (pipeline parameters use a double-hyphen). +:::note +These options are part of Nextflow and use a _single_ hyphen (pipeline parameters use a double-hyphen). +::: ### `-profile` @@ -126,7 +170,9 @@ Use this parameter to choose a configuration profile. Profiles can give configur Several generic profiles are bundled with the pipeline which instruct the pipeline to use software packaged using different methods (Docker, Singularity, Podman, Shifter, Charliecloud, Apptainer, Conda) - see below. -> We highly recommend the use of Docker or Singularity containers for full pipeline reproducibility, however when this is not possible, Conda is also supported. +:::info +We highly recommend the use of Docker or Singularity containers for full pipeline reproducibility, however when this is not possible, Conda is also supported. +::: The pipeline also dynamically loads configurations from [https://github.com/nf-core/configs](https://github.com/nf-core/configs) when it runs, making multiple config profiles for various institutional clusters available at run time. For more information and to see if your system is available in these configs please see the [nf-core/configs documentation](https://github.com/nf-core/configs#documentation). @@ -150,6 +196,8 @@ If `-profile` is not specified, the pipeline will run locally and expect all sof - A generic configuration profile to be used with [Charliecloud](https://hpc.github.io/charliecloud/) - `apptainer` - A generic configuration profile to be used with [Apptainer](https://apptainer.org/) +- `wave` + - A generic configuration profile to enable [Wave](https://seqera.io/wave/) containers. Use together with one of the above (requires Nextflow ` 24.03.0-edge` or later). - `conda` - A generic configuration profile to be used with [Conda](https://conda.io/docs/). Please only use Conda as a last resort i.e. when it's not possible to run the pipeline with Docker, Singularity, Podman, Shifter, Charliecloud, or Apptainer. @@ -191,14 +239,6 @@ See the main [Nextflow documentation](https://www.nextflow.io/docs/latest/config If you have any questions or issues please send us a message on [Slack](https://nf-co.re/join/slack) on the [`#configs` channel](https://nfcore.slack.com/channels/configs). -## Azure Resource Requests - -To be used with the `azurebatch` profile by specifying the `-profile azurebatch`. -We recommend providing a compute `params.vm_type` of `Standard_D16_v3` VMs by default but these options can be changed if required. - -Note that the choice of VM size depends on your quota and the overall workload during the analysis. -For a thorough list, please refer the [Azure Sizes for virtual machines in Azure](https://docs.microsoft.com/en-us/azure/virtual-machines/sizes). - ## Running in the background Nextflow handles job submissions and supervises the running jobs. The Nextflow process must run until the pipeline is finished. diff --git a/lib/NfcoreTemplate.groovy b/lib/NfcoreTemplate.groovy deleted file mode 100755 index 408951a..0000000 --- a/lib/NfcoreTemplate.groovy +++ /dev/null @@ -1,336 +0,0 @@ -// -// This file holds several functions used within the nf-core pipeline template. -// - -import org.yaml.snakeyaml.Yaml - -class NfcoreTemplate { - - // - // Check AWS Batch related parameters have been specified correctly - // - public static void awsBatch(workflow, params) { - if (workflow.profile.contains('awsbatch')) { - // Check params.awsqueue and params.awsregion have been set if running on AWSBatch - assert (params.awsqueue && params.awsregion) : "Specify correct --awsqueue and --awsregion parameters on AWSBatch!" - // Check outdir paths to be S3 buckets if running on AWSBatch - assert params.outdir.startsWith('s3:') : "Outdir not on S3 - specify S3 Bucket to run on AWSBatch!" - } - } - - // - // Warn if a -profile or Nextflow config has not been provided to run the pipeline - // - public static void checkConfigProvided(workflow, log) { - if (workflow.profile == 'standard' && workflow.configFiles.size() <= 1) { - log.warn "[$workflow.manifest.name] You are attempting to run the pipeline without any custom configuration!\n\n" + - "This will be dependent on your local compute environment but can be achieved via one or more of the following:\n" + - " (1) Using an existing pipeline profile e.g. `-profile docker` or `-profile singularity`\n" + - " (2) Using an existing nf-core/configs for your Institution e.g. `-profile crick` or `-profile uppmax`\n" + - " (3) Using your own local custom config e.g. `-c /path/to/your/custom.config`\n\n" + - "Please refer to the quick start section and usage docs for the pipeline.\n " - } - } - - // - // Generate version string - // - public static String version(workflow) { - String version_string = "" - - if (workflow.manifest.version) { - def prefix_v = workflow.manifest.version[0] != 'v' ? 'v' : '' - version_string += "${prefix_v}${workflow.manifest.version}" - } - - if (workflow.commitId) { - def git_shortsha = workflow.commitId.substring(0, 7) - version_string += "-g${git_shortsha}" - } - - return version_string - } - - // - // Construct and send completion email - // - public static void email(workflow, params, summary_params, projectDir, log, multiqc_report=[]) { - - // Set up the e-mail variables - def subject = "[$workflow.manifest.name] Successful: $workflow.runName" - if (!workflow.success) { - subject = "[$workflow.manifest.name] FAILED: $workflow.runName" - } - - def summary = [:] - for (group in summary_params.keySet()) { - summary << summary_params[group] - } - - def misc_fields = [:] - misc_fields['Date Started'] = workflow.start - misc_fields['Date Completed'] = workflow.complete - misc_fields['Pipeline script file path'] = workflow.scriptFile - misc_fields['Pipeline script hash ID'] = workflow.scriptId - if (workflow.repository) misc_fields['Pipeline repository Git URL'] = workflow.repository - if (workflow.commitId) misc_fields['Pipeline repository Git Commit'] = workflow.commitId - if (workflow.revision) misc_fields['Pipeline Git branch/tag'] = workflow.revision - misc_fields['Nextflow Version'] = workflow.nextflow.version - misc_fields['Nextflow Build'] = workflow.nextflow.build - misc_fields['Nextflow Compile Timestamp'] = workflow.nextflow.timestamp - - def email_fields = [:] - email_fields['version'] = NfcoreTemplate.version(workflow) - email_fields['runName'] = workflow.runName - email_fields['success'] = workflow.success - email_fields['dateComplete'] = workflow.complete - email_fields['duration'] = workflow.duration - email_fields['exitStatus'] = workflow.exitStatus - email_fields['errorMessage'] = (workflow.errorMessage ?: 'None') - email_fields['errorReport'] = (workflow.errorReport ?: 'None') - email_fields['commandLine'] = workflow.commandLine - email_fields['projectDir'] = workflow.projectDir - email_fields['summary'] = summary << misc_fields - - // On success try attach the multiqc report - def mqc_report = null - try { - if (workflow.success) { - mqc_report = multiqc_report.getVal() - if (mqc_report.getClass() == ArrayList && mqc_report.size() >= 1) { - if (mqc_report.size() > 1) { - log.warn "[$workflow.manifest.name] Found multiple reports from process 'MULTIQC', will use only one" - } - mqc_report = mqc_report[0] - } - } - } catch (all) { - if (multiqc_report) { - log.warn "[$workflow.manifest.name] Could not attach MultiQC report to summary email" - } - } - - // Check if we are only sending emails on failure - def email_address = params.email - if (!params.email && params.email_on_fail && !workflow.success) { - email_address = params.email_on_fail - } - - // Render the TXT template - def engine = new groovy.text.GStringTemplateEngine() - def tf = new File("$projectDir/assets/email_template.txt") - def txt_template = engine.createTemplate(tf).make(email_fields) - def email_txt = txt_template.toString() - - // Render the HTML template - def hf = new File("$projectDir/assets/email_template.html") - def html_template = engine.createTemplate(hf).make(email_fields) - def email_html = html_template.toString() - - // Render the sendmail template - def max_multiqc_email_size = (params.containsKey('max_multiqc_email_size') ? params.max_multiqc_email_size : 0) as nextflow.util.MemoryUnit - def smail_fields = [ email: email_address, subject: subject, email_txt: email_txt, email_html: email_html, projectDir: "$projectDir", mqcFile: mqc_report, mqcMaxSize: max_multiqc_email_size.toBytes() ] - def sf = new File("$projectDir/assets/sendmail_template.txt") - def sendmail_template = engine.createTemplate(sf).make(smail_fields) - def sendmail_html = sendmail_template.toString() - - // Send the HTML e-mail - Map colors = logColours(params.monochrome_logs) - if (email_address) { - try { - if (params.plaintext_email) { throw GroovyException('Send plaintext e-mail, not HTML') } - // Try to send HTML e-mail using sendmail - [ 'sendmail', '-t' ].execute() << sendmail_html - log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Sent summary e-mail to $email_address (sendmail)-" - } catch (all) { - // Catch failures and try with plaintext - def mail_cmd = [ 'mail', '-s', subject, '--content-type=text/html', email_address ] - if ( mqc_report.size() <= max_multiqc_email_size.toBytes() ) { - mail_cmd += [ '-A', mqc_report ] - } - mail_cmd.execute() << email_html - log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Sent summary e-mail to $email_address (mail)-" - } - } - - // Write summary e-mail HTML to a file - def output_d = new File("${params.outdir}/pipeline_info/") - if (!output_d.exists()) { - output_d.mkdirs() - } - def output_hf = new File(output_d, "pipeline_report.html") - output_hf.withWriter { w -> w << email_html } - def output_tf = new File(output_d, "pipeline_report.txt") - output_tf.withWriter { w -> w << email_txt } - } - - // - // Construct and send a notification to a web server as JSON - // e.g. Microsoft Teams and Slack - // - public static void IM_notification(workflow, params, summary_params, projectDir, log) { - def hook_url = params.hook_url - - def summary = [:] - for (group in summary_params.keySet()) { - summary << summary_params[group] - } - - def misc_fields = [:] - misc_fields['start'] = workflow.start - misc_fields['complete'] = workflow.complete - misc_fields['scriptfile'] = workflow.scriptFile - misc_fields['scriptid'] = workflow.scriptId - if (workflow.repository) misc_fields['repository'] = workflow.repository - if (workflow.commitId) misc_fields['commitid'] = workflow.commitId - if (workflow.revision) misc_fields['revision'] = workflow.revision - misc_fields['nxf_version'] = workflow.nextflow.version - misc_fields['nxf_build'] = workflow.nextflow.build - misc_fields['nxf_timestamp'] = workflow.nextflow.timestamp - - def msg_fields = [:] - msg_fields['version'] = NfcoreTemplate.version(workflow) - msg_fields['runName'] = workflow.runName - msg_fields['success'] = workflow.success - msg_fields['dateComplete'] = workflow.complete - msg_fields['duration'] = workflow.duration - msg_fields['exitStatus'] = workflow.exitStatus - msg_fields['errorMessage'] = (workflow.errorMessage ?: 'None') - msg_fields['errorReport'] = (workflow.errorReport ?: 'None') - msg_fields['commandLine'] = workflow.commandLine.replaceFirst(/ +--hook_url +[^ ]+/, "") - msg_fields['projectDir'] = workflow.projectDir - msg_fields['summary'] = summary << misc_fields - - // Render the JSON template - def engine = new groovy.text.GStringTemplateEngine() - // Different JSON depending on the service provider - // Defaults to "Adaptive Cards" (https://adaptivecards.io), except Slack which has its own format - def json_path = hook_url.contains("hooks.slack.com") ? "slackreport.json" : "adaptivecard.json" - def hf = new File("$projectDir/assets/${json_path}") - def json_template = engine.createTemplate(hf).make(msg_fields) - def json_message = json_template.toString() - - // POST - def post = new URL(hook_url).openConnection(); - post.setRequestMethod("POST") - post.setDoOutput(true) - post.setRequestProperty("Content-Type", "application/json") - post.getOutputStream().write(json_message.getBytes("UTF-8")); - def postRC = post.getResponseCode(); - if (! postRC.equals(200)) { - log.warn(post.getErrorStream().getText()); - } - } - - // - // Print pipeline summary on completion - // - public static void summary(workflow, params, log) { - Map colors = logColours(params.monochrome_logs) - if (workflow.success) { - if (workflow.stats.ignoredCount == 0) { - log.info "-${colors.purple}[$workflow.manifest.name]${colors.green} Pipeline completed successfully${colors.reset}-" - } else { - log.info "-${colors.purple}[$workflow.manifest.name]${colors.yellow} Pipeline completed successfully, but with errored process(es) ${colors.reset}-" - } - } else { - log.info "-${colors.purple}[$workflow.manifest.name]${colors.red} Pipeline completed with errors${colors.reset}-" - } - } - - // - // ANSII Colours used for terminal logging - // - public static Map logColours(Boolean monochrome_logs) { - Map colorcodes = [:] - - // Reset / Meta - colorcodes['reset'] = monochrome_logs ? '' : "\033[0m" - colorcodes['bold'] = monochrome_logs ? '' : "\033[1m" - colorcodes['dim'] = monochrome_logs ? '' : "\033[2m" - colorcodes['underlined'] = monochrome_logs ? '' : "\033[4m" - colorcodes['blink'] = monochrome_logs ? '' : "\033[5m" - colorcodes['reverse'] = monochrome_logs ? '' : "\033[7m" - colorcodes['hidden'] = monochrome_logs ? '' : "\033[8m" - - // Regular Colors - colorcodes['black'] = monochrome_logs ? '' : "\033[0;30m" - colorcodes['red'] = monochrome_logs ? '' : "\033[0;31m" - colorcodes['green'] = monochrome_logs ? '' : "\033[0;32m" - colorcodes['yellow'] = monochrome_logs ? '' : "\033[0;33m" - colorcodes['blue'] = monochrome_logs ? '' : "\033[0;34m" - colorcodes['purple'] = monochrome_logs ? '' : "\033[0;35m" - colorcodes['cyan'] = monochrome_logs ? '' : "\033[0;36m" - colorcodes['white'] = monochrome_logs ? '' : "\033[0;37m" - - // Bold - colorcodes['bblack'] = monochrome_logs ? '' : "\033[1;30m" - colorcodes['bred'] = monochrome_logs ? '' : "\033[1;31m" - colorcodes['bgreen'] = monochrome_logs ? '' : "\033[1;32m" - colorcodes['byellow'] = monochrome_logs ? '' : "\033[1;33m" - colorcodes['bblue'] = monochrome_logs ? '' : "\033[1;34m" - colorcodes['bpurple'] = monochrome_logs ? '' : "\033[1;35m" - colorcodes['bcyan'] = monochrome_logs ? '' : "\033[1;36m" - colorcodes['bwhite'] = monochrome_logs ? '' : "\033[1;37m" - - // Underline - colorcodes['ublack'] = monochrome_logs ? '' : "\033[4;30m" - colorcodes['ured'] = monochrome_logs ? '' : "\033[4;31m" - colorcodes['ugreen'] = monochrome_logs ? '' : "\033[4;32m" - colorcodes['uyellow'] = monochrome_logs ? '' : "\033[4;33m" - colorcodes['ublue'] = monochrome_logs ? '' : "\033[4;34m" - colorcodes['upurple'] = monochrome_logs ? '' : "\033[4;35m" - colorcodes['ucyan'] = monochrome_logs ? '' : "\033[4;36m" - colorcodes['uwhite'] = monochrome_logs ? '' : "\033[4;37m" - - // High Intensity - colorcodes['iblack'] = monochrome_logs ? '' : "\033[0;90m" - colorcodes['ired'] = monochrome_logs ? '' : "\033[0;91m" - colorcodes['igreen'] = monochrome_logs ? '' : "\033[0;92m" - colorcodes['iyellow'] = monochrome_logs ? '' : "\033[0;93m" - colorcodes['iblue'] = monochrome_logs ? '' : "\033[0;94m" - colorcodes['ipurple'] = monochrome_logs ? '' : "\033[0;95m" - colorcodes['icyan'] = monochrome_logs ? '' : "\033[0;96m" - colorcodes['iwhite'] = monochrome_logs ? '' : "\033[0;97m" - - // Bold High Intensity - colorcodes['biblack'] = monochrome_logs ? '' : "\033[1;90m" - colorcodes['bired'] = monochrome_logs ? '' : "\033[1;91m" - colorcodes['bigreen'] = monochrome_logs ? '' : "\033[1;92m" - colorcodes['biyellow'] = monochrome_logs ? '' : "\033[1;93m" - colorcodes['biblue'] = monochrome_logs ? '' : "\033[1;94m" - colorcodes['bipurple'] = monochrome_logs ? '' : "\033[1;95m" - colorcodes['bicyan'] = monochrome_logs ? '' : "\033[1;96m" - colorcodes['biwhite'] = monochrome_logs ? '' : "\033[1;97m" - - return colorcodes - } - - // - // Does what is says on the tin - // - public static String dashedLine(monochrome_logs) { - Map colors = logColours(monochrome_logs) - return "-${colors.dim}----------------------------------------------------${colors.reset}-" - } - - // - // nf-core logo - // - public static String logo(workflow, monochrome_logs) { - Map colors = logColours(monochrome_logs) - String workflow_version = NfcoreTemplate.version(workflow) - String.format( - """\n - ${dashedLine(monochrome_logs)} - ${colors.green},--.${colors.black}/${colors.green},-.${colors.reset} - ${colors.blue} ___ __ __ __ ___ ${colors.green}/,-._.--~\'${colors.reset} - ${colors.blue} |\\ | |__ __ / ` / \\ |__) |__ ${colors.yellow}} {${colors.reset} - ${colors.blue} | \\| | \\__, \\__/ | \\ |___ ${colors.green}\\`-._,-`-,${colors.reset} - ${colors.green}`._,._,\'${colors.reset} - ${colors.purple} ${workflow.manifest.name} ${workflow_version}${colors.reset} - ${dashedLine(monochrome_logs)} - """.stripIndent() - ) - } -} diff --git a/lib/Utils.groovy b/lib/Utils.groovy deleted file mode 100644 index 8d030f4..0000000 --- a/lib/Utils.groovy +++ /dev/null @@ -1,47 +0,0 @@ -// -// This file holds several Groovy functions that could be useful for any Nextflow pipeline -// - -import org.yaml.snakeyaml.Yaml - -class Utils { - - // - // When running with -profile conda, warn if channels have not been set-up appropriately - // - public static void checkCondaChannels(log) { - Yaml parser = new Yaml() - def channels = [] - try { - def config = parser.load("conda config --show channels".execute().text) - channels = config.channels - } catch(NullPointerException | IOException e) { - log.warn "Could not verify conda channel configuration." - return - } - - // Check that all channels are present - // This channel list is ordered by required channel priority. - def required_channels_in_order = ['conda-forge', 'bioconda', 'defaults'] - def channels_missing = ((required_channels_in_order as Set) - (channels as Set)) as Boolean - - // Check that they are in the right order - def channel_priority_violation = false - def n = required_channels_in_order.size() - for (int i = 0; i < n - 1; i++) { - channel_priority_violation |= !(channels.indexOf(required_channels_in_order[i]) < channels.indexOf(required_channels_in_order[i+1])) - } - - if (channels_missing | channel_priority_violation) { - log.warn "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n" + - " There is a problem with your Conda configuration!\n\n" + - " You will need to set-up the conda-forge and bioconda channels correctly.\n" + - " Please refer to https://bioconda.github.io/\n" + - " The observed channel order is \n" + - " ${channels}\n" + - " but the following channel order is required:\n" + - " ${required_channels_in_order}\n" + - "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" - } - } -} diff --git a/lib/WorkflowMain.groovy b/lib/WorkflowMain.groovy deleted file mode 100755 index 55eb6b2..0000000 --- a/lib/WorkflowMain.groovy +++ /dev/null @@ -1,62 +0,0 @@ -// -// This file holds several functions specific to the main.nf workflow in the nf-core/marsseq pipeline -// - -import nextflow.Nextflow - -class WorkflowMain { - - // - // Citation string for pipeline - // - public static String citation(workflow) { - return "If you use ${workflow.manifest.name} for your analysis please cite:\n\n" + - "* The pipeline\n" + - " https://doi.org/10.5281/zenodo.8063539\n\n" + - "* The nf-core framework\n" + - " https://doi.org/10.1038/s41587-020-0439-x\n\n" + - "* Software dependencies\n" + - " https://github.com/${workflow.manifest.name}/blob/master/CITATIONS.md" - } - - - // - // Validate parameters and print summary to screen - // - public static void initialise(workflow, params, log) { - - // Print workflow version and exit on --version - if (params.version) { - String workflow_version = NfcoreTemplate.version(workflow) - log.info "${workflow.manifest.name} ${workflow_version}" - System.exit(0) - } - - // Check that a -profile or Nextflow config has been provided to run the pipeline - NfcoreTemplate.checkConfigProvided(workflow, log) - - // Check that conda channels are set-up correctly - if (workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1) { - Utils.checkCondaChannels(log) - } - - // Check AWS batch settings - NfcoreTemplate.awsBatch(workflow, params) - - // Check input has been provided - if (!params.input) { - Nextflow.error("Please provide an input samplesheet to the pipeline e.g. '--input samplesheet.csv'") - } - } - // - // Get attribute from genome config file e.g. fasta - // - public static Object getGenomeAttribute(params, attribute) { - if (params.genomes && params.genome && params.genomes.containsKey(params.genome)) { - if (params.genomes[ params.genome ].containsKey(attribute)) { - return params.genomes[ params.genome ][ attribute ] - } - } - return null - } -} diff --git a/lib/WorkflowMarsseq.groovy b/lib/WorkflowMarsseq.groovy deleted file mode 100755 index 80ea449..0000000 --- a/lib/WorkflowMarsseq.groovy +++ /dev/null @@ -1,122 +0,0 @@ -// -// This file holds several functions specific to the workflow/marsseq.nf in the nf-core/marsseq pipeline -// - -import nextflow.Nextflow -import groovy.text.SimpleTemplateEngine - -class WorkflowMarsseq { - - // - // Check and validate parameters - // - public static void initialise(params, log) { - - genomeExistsError(params, log) - - - if (!params.fasta) { - Nextflow.error "Genome fasta file not specified with e.g. '--fasta genome.fa' or via a detectable config file." - } - } - - // - // Get workflow summary for MultiQC - // - public static String paramsSummaryMultiqc(workflow, summary) { - String summary_section = '' - for (group in summary.keySet()) { - def group_params = summary.get(group) // This gets the parameters of that particular group - if (group_params) { - summary_section += "

$group

\n" - summary_section += "
\n" - for (param in group_params.keySet()) { - summary_section += "
$param
${group_params.get(param) ?: 'N/A'}
\n" - } - summary_section += "
\n" - } - } - - String yaml_file_text = "id: '${workflow.manifest.name.replace('/','-')}-summary'\n" - yaml_file_text += "description: ' - this information is collected when the pipeline is started.'\n" - yaml_file_text += "section_name: '${workflow.manifest.name} Workflow Summary'\n" - yaml_file_text += "section_href: 'https://github.com/${workflow.manifest.name}'\n" - yaml_file_text += "plot_type: 'html'\n" - yaml_file_text += "data: |\n" - yaml_file_text += "${summary_section}" - return yaml_file_text - } - - // - // Generate methods description for MultiQC - // - - public static String toolCitationText(params) { - - // TODO Optionally add in-text citation tools to this list. - // Can use ternary operators to dynamically construct based conditions, e.g. params["run_xyz"] ? "Tool (Foo et al. 2023)" : "", - // Uncomment function in methodsDescriptionText to render in MultiQC report - def citation_text = [ - "Tools used in the workflow included:", - "FastQC (Andrews 2010),", - "MultiQC (Ewels et al. 2016)", - "." - ].join(' ').trim() - - return citation_text - } - - public static String toolBibliographyText(params) { - - // TODO Optionally add bibliographic entries to this list. - // Can use ternary operators to dynamically construct based conditions, e.g. params["run_xyz"] ? "
  • Author (2023) Pub name, Journal, DOI
  • " : "", - // Uncomment function in methodsDescriptionText to render in MultiQC report - def reference_text = [ - "
  • Andrews S, (2010) FastQC, URL: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/).
  • ", - "
  • Ewels, P., Magnusson, M., Lundin, S., & Käller, M. (2016). MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics , 32(19), 3047–3048. doi: /10.1093/bioinformatics/btw354
  • " - ].join(' ').trim() - - return reference_text - } - - public static String methodsDescriptionText(run_workflow, mqc_methods_yaml, params) { - // Convert to a named map so can be used as with familar NXF ${workflow} variable syntax in the MultiQC YML file - def meta = [:] - meta.workflow = run_workflow.toMap() - meta["manifest_map"] = run_workflow.manifest.toMap() - - // Pipeline DOI - meta["doi_text"] = meta.manifest_map.doi ? "(doi: ${meta.manifest_map.doi})" : "" - meta["nodoi_text"] = meta.manifest_map.doi ? "": "
  • If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
  • " - - // Tool references - meta["tool_citations"] = "" - meta["tool_bibliography"] = "" - - // TODO Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled! - //meta["tool_citations"] = toolCitationText(params).replaceAll(", \\.", ".").replaceAll("\\. \\.", ".").replaceAll(", \\.", ".") - //meta["tool_bibliography"] = toolBibliographyText(params) - - - def methods_text = mqc_methods_yaml.text - - def engine = new SimpleTemplateEngine() - def description_html = engine.createTemplate(methods_text).make(meta) - - return description_html - } - - // - // Exit pipeline if incorrect --genome key provided - // - private static void genomeExistsError(params, log) { - if (params.genomes && params.genome && !params.genomes.containsKey(params.genome)) { - def error_string = "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n" + - " Genome '${params.genome}' not found in any config files provided to the pipeline.\n" + - " Currently, the available genome keys are:\n" + - " ${params.genomes.keySet().join(", ")}\n" + - "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" - Nextflow.error(error_string) - } - } -} diff --git a/lib/nfcore_external_java_deps.jar b/lib/nfcore_external_java_deps.jar deleted file mode 100644 index 805c8bb..0000000 Binary files a/lib/nfcore_external_java_deps.jar and /dev/null differ diff --git a/main.nf b/main.nf index bb6fca2..9766da4 100644 --- a/main.nf +++ b/main.nf @@ -9,78 +9,94 @@ ---------------------------------------------------------------------------------------- */ -nextflow.enable.dsl = 2 - /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - GENOME PARAMETER VALUES + IMPORT FUNCTIONS / MODULES / SUBWORKFLOWS / WORKFLOWS ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ -params.fasta = WorkflowMain.getGenomeAttribute(params, 'fasta') -params.gtf = WorkflowMain.getGenomeAttribute(params, 'gtf') -params.bowtie2_index = WorkflowMain.getGenomeAttribute(params, 'bowtie2') -params.star_index = WorkflowMain.getGenomeAttribute(params, 'star') - -/* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - VALIDATE & PRINT PARAMETER SUMMARY -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -*/ - -include { validateParameters; paramsHelp } from 'plugin/nf-validation' - -// Print help message if needed -if (params.help) { - def logo = NfcoreTemplate.logo(workflow, params.monochrome_logs) - def citation = '\n' + WorkflowMain.citation(workflow) + '\n' - def String command = "nextflow run ${workflow.manifest.name} --input samplesheet.csv --genome mm10 -profile docker" - log.info logo + paramsHelp(command) + citation + NfcoreTemplate.dashedLine(params.monochrome_logs) - System.exit(0) -} - -WorkflowMain.initialise(workflow, params, log) +include { MARSSEQ } from './workflows/marsseq' +include { PIPELINE_INITIALISATION } from './subworkflows/local/utils_nfcore_marsseq_pipeline' +include { PIPELINE_COMPLETION } from './subworkflows/local/utils_nfcore_marsseq_pipeline' +include { PREPARE_GENOME } from './subworkflows/local/prepare_genome' /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - NAMED WORKFLOW FOR PIPELINE + NAMED WORKFLOWS FOR PIPELINE ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ -include { BUILD_REFERENCES } from './workflows/build_references' -include { MARSSEQ } from './workflows/marsseq' - // -// WORKFLOW: Run main nf-core/marsseq analysis pipeline +// WORKFLOW: Run main analysis pipeline depending on type of input // workflow NFCORE_MARSSEQ { - if (params.build_references) { - BUILD_REFERENCES () - } else { - - // Validate input parameters - if (params.validate_params) { - validateParameters() - } - - MARSSEQ () - } - + take: + samplesheet // channel: samplesheet read in from --input + + main: + + PREPARE_GENOME ( + params.aligner, + params.fasta, + params.gtf, + params.bowtie2_index, + params.star_index + ) + + MARSSEQ ( + samplesheet, + params.aligner, + PREPARE_GENOME.out.fasta, + PREPARE_GENOME.out.gtf, + PREPARE_GENOME.out.bowtie2_index, + PREPARE_GENOME.out.star_index, + PREPARE_GENOME.out.versions + ) + + emit: + multiqc_report = MARSSEQ.out.multiqc_report // channel: /path/to/multiqc_report.html } - /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - RUN ALL WORKFLOWS + RUN MAIN WORKFLOW ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ -// -// WORKFLOW: Execute a single named workflow for the pipeline -// See: https://github.com/nf-core/rnaseq/issues/619 -// workflow { - NFCORE_MARSSEQ () + + main: + // + // SUBWORKFLOW: Run initialisation tasks + // + PIPELINE_INITIALISATION ( + params.version, + params.validate_params, + params.monochrome_logs, + args, + params.outdir, + params.input + ) + + // + // WORKFLOW: Run main workflow + // + NFCORE_MARSSEQ ( + PIPELINE_INITIALISATION.out.samplesheet + ) + + // + // SUBWORKFLOW: Run completion tasks + // + PIPELINE_COMPLETION ( + params.email, + params.email_on_fail, + params.plaintext_email, + params.outdir, + params.monochrome_logs, + params.hook_url, + NFCORE_MARSSEQ.out.multiqc_report + ) } /* diff --git a/modules.json b/modules.json index aaa8382..60c601c 100644 --- a/modules.json +++ b/modules.json @@ -7,56 +7,79 @@ "nf-core": { "bowtie2/align": { "branch": "master", - "git_sha": "fe54581f8bed20e4c4a51c616c93fd3379d89820", + "git_sha": "2d20463181b1c38981a02e90d3084b5f9fa8d540", "installed_by": ["modules"] }, "bowtie2/build": { "branch": "master", - "git_sha": "6a24fbe314bb2e6fe6306c29a63076ea87e8eb3c", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", "installed_by": ["modules"] }, "cat/cat": { "branch": "master", - "git_sha": "911696ea0b62df80e900ef244d7867d177971f73", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", + "installed_by": ["modules"] + }, + "cat/fastq": { + "branch": "master", + "git_sha": "a1abf90966a2a4016d3c3e41e228bfcbd4811ccc", "installed_by": ["modules"] }, "custom/dumpsoftwareversions": { "branch": "master", - "git_sha": "911696ea0b62df80e900ef244d7867d177971f73", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", "installed_by": ["modules"] }, "cutadapt": { "branch": "master", - "git_sha": "0efbaeb95c58da5a1096c99b5e919bc0c99cc952", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", "installed_by": ["modules"] }, "fastqc": { "branch": "master", - "git_sha": "bd8092b67b5103bdd52e300f75889442275c3117", + "git_sha": "dc94b6ee04a05ddb9f7ae050712ff30a13149164", "installed_by": ["modules"] }, "gunzip": { "branch": "master", - "git_sha": "5c460c5a4736974abde2843294f35307ee2b0e5e", + "git_sha": "666652151335353eef2fcd58880bcef5bc2928e1", "installed_by": ["modules"] }, "multiqc": { "branch": "master", - "git_sha": "911696ea0b62df80e900ef244d7867d177971f73", + "git_sha": "cf17ca47590cc578dfb47db1c2a44ef86f89976d", "installed_by": ["modules"] }, - "star/align": { + "star/genomegenerate": { "branch": "master", - "git_sha": "57d75dbac06812c59798a48585032f6e50bb1914", - "installed_by": ["modules"], - "patch": "modules/nf-core/star/align/star-align.diff" + "git_sha": "a5ad53288c79fa52c5ae708c317e09ec2dd149ab", + "installed_by": ["modules"] }, - "star/genomegenerate": { + "star/starsolo": { "branch": "master", - "git_sha": "603ecbd9f45300c9788f197d2a15a005685b4220", + "git_sha": "a5ad53288c79fa52c5ae708c317e09ec2dd149ab", "installed_by": ["modules"] } } + }, + "subworkflows": { + "nf-core": { + "utils_nextflow_pipeline": { + "branch": "master", + "git_sha": "3aa0aec1d52d492fe241919f0c6100ebf0074082", + "installed_by": ["subworkflows"] + }, + "utils_nfcore_pipeline": { + "branch": "master", + "git_sha": "1b6b9a3338d011367137808b49b923515080e3ba", + "installed_by": ["subworkflows"] + }, + "utils_nfschema_plugin": { + "branch": "master", + "git_sha": "bbd5a41f4535a8defafe6080e00ea74c45f4f96c", + "installed_by": ["subworkflows"] + } + } } } } diff --git a/modules/local/demultiplex/main.nf b/modules/local/demultiplex/main.nf index cdf74e9..f4705f9 100644 --- a/modules/local/demultiplex/main.nf +++ b/modules/local/demultiplex/main.nf @@ -7,7 +7,7 @@ process DEMULTIPLEX { tag "$meta.id [$meta.amp_batch]" label 'process_medium' - conda "bioconda::conda-forge==5.30.0" + conda "conda-forge::perl==5.26.2" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' : 'nf-core/ubuntu:20.04' }" diff --git a/modules/local/ercc/main.nf b/modules/local/ercc/main.nf index 04ae3b3..9fdb326 100644 --- a/modules/local/ercc/main.nf +++ b/modules/local/ercc/main.nf @@ -2,7 +2,7 @@ process ERCC_CREATE { tag "ercc.fa" label "process_low" - conda "bioconda::openpyxl==2.6.1 conda-forge::pandas==1.2.4" + conda "anaconda::openpyxl==2.6.1 conda-forge::pandas==1.2.4" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/mulled-v2-0bcca2890a3ab7be29a83e813a02d340d6f54660:4cb478c6e57df2ef85ea5f8eae6d717c017962cd-0': 'biocontainers/mulled-v2-0bcca2890a3ab7be29a83e813a02d340d6f54660:4cb478c6e57df2ef85ea5f8eae6d717c017962cd-0' }" diff --git a/modules/local/extract/main.nf b/modules/local/extract/main.nf index eed4c9b..5f3abcc 100644 --- a/modules/local/extract/main.nf +++ b/modules/local/extract/main.nf @@ -6,7 +6,7 @@ process EXTRACT_LABELS { tag "$meta.id" label 'process_medium' - conda "bioconda::conda-forge==5.30.0" + conda "conda-forge::perl==5.26.2 conda-forge::grep=3.11 conda-forge::sed=4.8 conda-forge::tar=1.34" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' : 'nf-core/ubuntu:20.04' }" diff --git a/modules/local/prepare/main.nf b/modules/local/prepare/main.nf index 48431c4..7474b29 100644 --- a/modules/local/prepare/main.nf +++ b/modules/local/prepare/main.nf @@ -11,7 +11,7 @@ process PREPARE { tag "$meta.id" label 'process_tiny' - conda "bioconda::openpyxl==2.6.1 conda-forge::pandas==1.2.4 conda-forge::fsspec==2023.5.0" + conda "anaconda::openpyxl==2.6.1 conda-forge::pandas==1.2.4 conda-forge::fsspec==2023.5.0" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/mulled-v2-0bcca2890a3ab7be29a83e813a02d340d6f54660:4cb478c6e57df2ef85ea5f8eae6d717c017962cd-0' : 'biocontainers/mulled-v2-0bcca2890a3ab7be29a83e813a02d340d6f54660:4cb478c6e57df2ef85ea5f8eae6d717c017962cd-0' }" diff --git a/modules/local/samplesheet_check.nf b/modules/local/samplesheet_check.nf deleted file mode 100644 index 3dc5d10..0000000 --- a/modules/local/samplesheet_check.nf +++ /dev/null @@ -1,31 +0,0 @@ -process SAMPLESHEET_CHECK { - tag "$samplesheet" - label 'process_single' - - conda "conda-forge::python=3.8.3" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/python:3.8.3' : - 'biocontainers/python:3.8.3' }" - - input: - path samplesheet - - output: - path '*.csv' , emit: csv - path "versions.yml", emit: versions - - when: - task.ext.when == null || task.ext.when - - script: // This script is bundled with the pipeline, in nf-core/marsseq/bin/ - """ - check_samplesheet.py \\ - $samplesheet \\ - samplesheet.valid.csv - - cat <<-END_VERSIONS > versions.yml - "${task.process}": - python: \$(python --version | sed 's/Python //g') - END_VERSIONS - """ -} diff --git a/modules/local/velocity/convert/main.nf b/modules/local/velocity/convert/main.nf index 8582c56..92145f6 100644 --- a/modules/local/velocity/convert/main.nf +++ b/modules/local/velocity/convert/main.nf @@ -5,7 +5,7 @@ process VELOCITY_CONVERT { tag "$meta.id" label 'process_high_cpu' - conda "bioconda::openpyxl==2.6.1 conda-forge::pandas==1.2.4" + conda "anaconda::openpyxl==2.6.1 conda-forge::pandas==1.2.4" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/mulled-v2-0bcca2890a3ab7be29a83e813a02d340d6f54660:4cb478c6e57df2ef85ea5f8eae6d717c017962cd-0' : 'biocontainers/mulled-v2-0bcca2890a3ab7be29a83e813a02d340d6f54660:4cb478c6e57df2ef85ea5f8eae6d717c017962cd-0' }" @@ -14,21 +14,18 @@ process VELOCITY_CONVERT { tuple val(meta), path(reads) output: - tuple val(meta), path("*.fastq.gz"), emit: reads - path "versions.yml" , emit: versions + tuple val(meta), path("_temp/*.fastq.gz"), emit: reads + path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when script: """ - velocity.py convert \\ - --input $reads \\ - --output _temp/ \\ - --threads $task.cpus - - for f in _temp/*R1*.fastq.gz; do cat \$f >> Undetermined_S0_R1_001.fastq.gz; done - for f in _temp/*R2*.fastq.gz; do cat \$f >> Undetermined_S0_R2_001.fastq.gz; done + velocity.py convert_read \\ + --r1 ${reads[0]} \\ + --r2 ${reads[1]} \\ + --output _temp/ cat <<-END_VERSIONS > versions.yml "${task.process}": @@ -38,7 +35,8 @@ process VELOCITY_CONVERT { stub: """ - touch Undetermined_S0_R{1,2}_001.fastq.gz + mkdir _temp + touch _temp/0001.Undetermined_S0_L001_R{1,2}_001.fastq.gz cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/local/velocity/whitelist/main.nf b/modules/local/velocity/whitelist/main.nf index fa3e294..1f0873b 100644 --- a/modules/local/velocity/whitelist/main.nf +++ b/modules/local/velocity/whitelist/main.nf @@ -5,7 +5,7 @@ process VELOCITY_WHITELIST { tag "$meta.id" label 'process_low' - conda "bioconda::openpyxl==2.6.1 conda-forge::pandas==1.2.4" + conda "anaconda::openpyxl==2.6.1 conda-forge::pandas==1.2.4" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? 'https://depot.galaxyproject.org/singularity/mulled-v2-0bcca2890a3ab7be29a83e813a02d340d6f54660:4cb478c6e57df2ef85ea5f8eae6d717c017962cd-0' : 'biocontainers/mulled-v2-0bcca2890a3ab7be29a83e813a02d340d6f54660:4cb478c6e57df2ef85ea5f8eae6d717c017962cd-0' }" diff --git a/modules/nf-core/bowtie2/align/environment.yml b/modules/nf-core/bowtie2/align/environment.yml new file mode 100644 index 0000000..9090f21 --- /dev/null +++ b/modules/nf-core/bowtie2/align/environment.yml @@ -0,0 +1,7 @@ +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::bowtie2=2.5.2 + - bioconda::samtools=1.18 + - conda-forge::pigz=2.6 diff --git a/modules/nf-core/bowtie2/align/main.nf b/modules/nf-core/bowtie2/align/main.nf index a77114d..7b2f25e 100644 --- a/modules/nf-core/bowtie2/align/main.nf +++ b/modules/nf-core/bowtie2/align/main.nf @@ -1,22 +1,27 @@ process BOWTIE2_ALIGN { tag "$meta.id" - label "process_high" + label 'process_high' - conda "bioconda::bowtie2=2.4.4 bioconda::samtools=1.16.1 conda-forge::pigz=2.6" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/mulled-v2-ac74a7f02cebcfcc07d8e8d1d750af9c83b4d45a:a0ffedb52808e102887f6ce600d092675bf3528a-0' : - 'biocontainers/mulled-v2-ac74a7f02cebcfcc07d8e8d1d750af9c83b4d45a:a0ffedb52808e102887f6ce600d092675bf3528a-0' }" + 'https://depot.galaxyproject.org/singularity/mulled-v2-ac74a7f02cebcfcc07d8e8d1d750af9c83b4d45a:f70b31a2db15c023d641c32f433fb02cd04df5a6-0' : + 'biocontainers/mulled-v2-ac74a7f02cebcfcc07d8e8d1d750af9c83b4d45a:f70b31a2db15c023d641c32f433fb02cd04df5a6-0' }" input: tuple val(meta) , path(reads) tuple val(meta2), path(index) + tuple val(meta3), path(fasta) val save_unaligned val sort_bam output: - tuple val(meta), path("*.{bam,sam}"), emit: aligned + tuple val(meta), path("*.sam") , emit: sam , optional:true + tuple val(meta), path("*.bam") , emit: bam , optional:true + tuple val(meta), path("*.cram") , emit: cram , optional:true + tuple val(meta), path("*.csi") , emit: csi , optional:true + tuple val(meta), path("*.crai") , emit: crai , optional:true tuple val(meta), path("*.log") , emit: log - tuple val(meta), path("*fastq.gz") , emit: fastq, optional:true + tuple val(meta), path("*fastq.gz") , emit: fastq , optional:true path "versions.yml" , emit: versions when: @@ -39,7 +44,10 @@ process BOWTIE2_ALIGN { def samtools_command = sort_bam ? 'sort' : 'view' def extension_pattern = /(--output-fmt|-O)+\s+(\S+)/ - def extension = (args2 ==~ extension_pattern) ? (args2 =~ extension_pattern)[0][2].toLowerCase() : "bam" + def extension_matcher = (args2 =~ extension_pattern) + def extension = extension_matcher.getCount() > 0 ? extension_matcher[0][2].toLowerCase() : "bam" + def reference = fasta && extension=="cram" ? "--reference ${fasta}" : "" + if (!fasta && extension=="cram") error "Fasta reference is required for CRAM output" """ INDEX=`find -L ./ -name "*.rev.1.bt2" | sed "s/\\.rev.1.bt2\$//"` @@ -52,8 +60,8 @@ process BOWTIE2_ALIGN { --threads $task.cpus \\ $unaligned \\ $args \\ - 2> ${prefix}.bowtie2.log \\ - | samtools $samtools_command $args2 --threads $task.cpus -o ${prefix}.${extension} - + 2> >(tee ${prefix}.bowtie2.log >&2) \\ + | samtools $samtools_command $args2 --threads $task.cpus ${reference} -o ${prefix}.${extension} - if [ -f ${prefix}.unmapped.fastq.1.gz ]; then mv ${prefix}.unmapped.fastq.1.gz ${prefix}.unmapped_1.fastq.gz @@ -76,12 +84,26 @@ process BOWTIE2_ALIGN { def prefix = task.ext.prefix ?: "${meta.id}" def extension_pattern = /(--output-fmt|-O)+\s+(\S+)/ def extension = (args2 ==~ extension_pattern) ? (args2 =~ extension_pattern)[0][2].toLowerCase() : "bam" + def create_unmapped = "" + if (meta.single_end) { + create_unmapped = save_unaligned ? "touch ${prefix}.unmapped.fastq.gz" : "" + } else { + create_unmapped = save_unaligned ? "touch ${prefix}.unmapped_1.fastq.gz && touch ${prefix}.unmapped_2.fastq.gz" : "" + } + if (!fasta && extension=="cram") error "Fasta reference is required for CRAM output" + + def create_index = "" + if (extension == "cram") { + create_index = "touch ${prefix}.crai" + } else if (extension == "bam") { + create_index = "touch ${prefix}.csi" + } """ touch ${prefix}.${extension} + ${create_index} touch ${prefix}.bowtie2.log - touch ${prefix}.unmapped_1.fastq.gz - touch ${prefix}.unmapped_2.fastq.gz + ${create_unmapped} cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/bowtie2/align/meta.yml b/modules/nf-core/bowtie2/align/meta.yml index 60d04c1..f841f78 100644 --- a/modules/nf-core/bowtie2/align/meta.yml +++ b/modules/nf-core/bowtie2/align/meta.yml @@ -16,52 +16,117 @@ tools: documentation: http://bowtie-bio.sourceforge.net/bowtie2/manual.shtml doi: 10.1038/nmeth.1923 licence: ["GPL-3.0-or-later"] + identifier: "" input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - reads: - type: file - description: | - List of input FastQ files of size 1 and 2 for single-end and paired-end data, - respectively. - - meta2: - type: map - description: | - Groovy Map containing reference information - e.g. [ id:'test', single_end:false ] - - index: - type: file - description: Bowtie2 genome index files - pattern: "*.ebwt" - - save_unaligned: - type: boolean - description: | - Save reads that do not map to the reference (true) or discard them (false) - (default: false) - - sort_bam: - type: boolean - description: use samtools sort (true) or samtools view (false) - pattern: "true or false" + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: | + List of input FastQ files of size 1 and 2 for single-end and paired-end data, + respectively. + - - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test', single_end:false ] + - index: + type: file + description: Bowtie2 genome index files + pattern: "*.ebwt" + - - meta3: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test', single_end:false ] + - fasta: + type: file + description: Bowtie2 genome fasta file + pattern: "*.fasta" + - - save_unaligned: + type: boolean + description: | + Save reads that do not map to the reference (true) or discard them (false) + (default: false) + - - sort_bam: + type: boolean + description: use samtools sort (true) or samtools view (false) + pattern: "true or false" output: - - aligned: - type: file - description: Output BAM/SAM file containing read alignments - pattern: "*.{bam,sam}" - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" - - fastq: - type: file - description: Unaligned FastQ files - pattern: "*.fastq.gz" + - sam: + - meta: + type: file + description: Output SAM file containing read alignments + pattern: "*.sam" + - "*.sam": + type: file + description: Output SAM file containing read alignments + pattern: "*.sam" + - bam: + - meta: + type: file + description: Output BAM file containing read alignments + pattern: "*.bam" + - "*.bam": + type: file + description: Output BAM file containing read alignments + pattern: "*.bam" + - cram: + - meta: + type: file + description: Output CRAM file containing read alignments + pattern: "*.cram" + - "*.cram": + type: file + description: Output CRAM file containing read alignments + pattern: "*.cram" + - csi: + - meta: + type: file + description: Output SAM/BAM index for large inputs + pattern: "*.csi" + - "*.csi": + type: file + description: Output SAM/BAM index for large inputs + pattern: "*.csi" + - crai: + - meta: + type: file + description: Output CRAM index + pattern: "*.crai" + - "*.crai": + type: file + description: Output CRAM index + pattern: "*.crai" - log: - type: file - description: Aligment log - pattern: "*.log" + - meta: + type: file + description: Aligment log + pattern: "*.log" + - "*.log": + type: file + description: Aligment log + pattern: "*.log" + - fastq: + - meta: + type: file + description: Unaligned FastQ files + pattern: "*.fastq.gz" + - "*fastq.gz": + type: file + description: Unaligned FastQ files + pattern: "*.fastq.gz" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@joseespinosa" - "@drpatelh" +maintainers: + - "@joseespinosa" + - "@drpatelh" diff --git a/modules/nf-core/bowtie2/align/tests/cram_crai.config b/modules/nf-core/bowtie2/align/tests/cram_crai.config new file mode 100644 index 0000000..03f1d5e --- /dev/null +++ b/modules/nf-core/bowtie2/align/tests/cram_crai.config @@ -0,0 +1,5 @@ +process { + withName: BOWTIE2_ALIGN { + ext.args2 = '--output-fmt cram --write-index' + } +} diff --git a/modules/nf-core/bowtie2/align/tests/large_index.config b/modules/nf-core/bowtie2/align/tests/large_index.config new file mode 100644 index 0000000..fdc1c59 --- /dev/null +++ b/modules/nf-core/bowtie2/align/tests/large_index.config @@ -0,0 +1,5 @@ +process { + withName: BOWTIE2_BUILD { + ext.args = '--large-index' + } +} \ No newline at end of file diff --git a/modules/nf-core/bowtie2/align/tests/main.nf.test b/modules/nf-core/bowtie2/align/tests/main.nf.test new file mode 100644 index 0000000..0de5950 --- /dev/null +++ b/modules/nf-core/bowtie2/align/tests/main.nf.test @@ -0,0 +1,623 @@ +nextflow_process { + + name "Test Process BOWTIE2_ALIGN" + script "../main.nf" + process "BOWTIE2_ALIGN" + tag "modules" + tag "modules_nfcore" + tag "bowtie2" + tag "bowtie2/build" + tag "bowtie2/align" + + test("sarscov2 - fastq, index, fasta, false, false - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, index, fasta, false, false - sam") { + + config "./sam.config" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.sam[0][1]).readLines()[0..4], + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, index, fasta, false, false - sam2") { + + config "./sam2.config" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.sam[0][1]).readLines()[0..4], + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, index, fasta, false, true - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], index, fasta, false, false - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], index, fasta, false, true - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, large_index, fasta, false, false - bam") { + + config "./large_index.config" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], large_index, fasta, false, false - bam") { + + config "./large_index.config" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], index, fasta, true, false - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, index, fasta, true, false - bam") { + + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + process.out.log, + process.out.fastq, + process.out.versions + ).match() } + + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], index, fasta, true, true - cram") { + + config "./cram_crai.config" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = true //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.cram[0][1]).name, + file(process.out.crai[0][1]).name + ).match() } + ) + } + + } + + test("sarscov2 - [fastq1, fastq2], index, fasta, false, false - stub") { + + options "-stub" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + file(process.out.csi[0][1]).name, + file(process.out.log[0][1]).name, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + + test("sarscov2 - fastq, index, fasta, true, false - stub") { + + options "-stub" + setup { + run("BOWTIE2_BUILD") { + script "../../build/main.nf" + process { + """ + input[0] = [ + [ id:'test'], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ] + """ + } + } + } + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + input[1] = BOWTIE2_BUILD.out.index + input[2] = [[ id:'test'], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true)] + input[3] = false //save_unaligned + input[4] = false //sort + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.bam[0][1]).name, + file(process.out.csi[0][1]).name, + file(process.out.log[0][1]).name, + process.out.fastq, + process.out.versions + ).match() } + ) + } + + } + +} diff --git a/modules/nf-core/bowtie2/align/tests/main.nf.test.snap b/modules/nf-core/bowtie2/align/tests/main.nf.test.snap new file mode 100644 index 0000000..028e7da --- /dev/null +++ b/modules/nf-core/bowtie2/align/tests/main.nf.test.snap @@ -0,0 +1,311 @@ +{ + "sarscov2 - [fastq1, fastq2], large_index, fasta, false, false - bam": { + "content": [ + "test.bam", + [ + [ + { + "id": "test", + "single_end": false + }, + "test.bowtie2.log:md5,bd89ce1b28c93bf822bae391ffcedd19" + ] + ], + [ + + ], + [ + "versions.yml:md5,01d18ab035146ea790e9a0f70adb758f" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-18T13:19:25.337323" + }, + "sarscov2 - fastq, index, fasta, false, false - sam2": { + "content": [ + [ + "ERR5069949.2151832\t16\tMT192765.1\t17453\t42\t150M\t*\t0\t0\tACGCACATTGCTAACTAAGGGCACACTAGAACCAGAATATTTCAATTCAGTGTGTAGACTTATGAAAACTATAGGTCCAGACATGTTCCTCGGAACTTGTCGGCGTTGTCCTGCTGAAATTGTTGACACTGTGAGTGCTTTGGTTTATGA\tAAAAMT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/PC00101P/2020, complete genome", + "GTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGT", + "GTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAG", + "TAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTTGTCCGG", + "GTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTT", + "ACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAG" + ], + 374, + [ + "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:52:02.774016" + }, + "test_cat_unzipped_zipped": { + "content": [ + [ + ">MT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/PC00101P/2020, complete genome", + "GTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAATCTGT", + "GTGGCTGTCACTCGGCTGCATGCTTAGTGCACTCACGCAGTATAATTAATAACTAATTACTGTCGTTGACAGGACACGAG", + "TAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTTGTCCGG", + "GTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTT", + "ACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAG" + ], + 375, + [ + "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:51:57.581523" + } +} \ No newline at end of file diff --git a/modules/nf-core/cat/cat/tests/nextflow_unzipped_zipped.config b/modules/nf-core/cat/cat/tests/nextflow_unzipped_zipped.config new file mode 100644 index 0000000..ec26b0f --- /dev/null +++ b/modules/nf-core/cat/cat/tests/nextflow_unzipped_zipped.config @@ -0,0 +1,6 @@ + +process { + withName: CAT_CAT { + ext.prefix = 'cat.txt.gz' + } +} diff --git a/modules/nf-core/cat/cat/tests/nextflow_zipped_unzipped.config b/modules/nf-core/cat/cat/tests/nextflow_zipped_unzipped.config new file mode 100644 index 0000000..fbc7978 --- /dev/null +++ b/modules/nf-core/cat/cat/tests/nextflow_zipped_unzipped.config @@ -0,0 +1,8 @@ + +process { + + withName: CAT_CAT { + ext.prefix = 'cat.txt' + } + +} diff --git a/modules/nf-core/cat/cat/tests/tags.yml b/modules/nf-core/cat/cat/tests/tags.yml new file mode 100644 index 0000000..37b578f --- /dev/null +++ b/modules/nf-core/cat/cat/tests/tags.yml @@ -0,0 +1,2 @@ +cat/cat: + - modules/nf-core/cat/cat/** diff --git a/modules/nf-core/cat/fastq/environment.yml b/modules/nf-core/cat/fastq/environment.yml new file mode 100644 index 0000000..71e04c3 --- /dev/null +++ b/modules/nf-core/cat/fastq/environment.yml @@ -0,0 +1,5 @@ +channels: + - conda-forge + - bioconda +dependencies: + - conda-forge::coreutils=9.5 diff --git a/modules/nf-core/cat/fastq/main.nf b/modules/nf-core/cat/fastq/main.nf new file mode 100644 index 0000000..4364a38 --- /dev/null +++ b/modules/nf-core/cat/fastq/main.nf @@ -0,0 +1,79 @@ +process CAT_FASTQ { + tag "$meta.id" + label 'process_single' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/c2/c262fc09eca59edb5a724080eeceb00fb06396f510aefb229c2d2c6897e63975/data' : + 'community.wave.seqera.io/library/coreutils:9.5--ae99c88a9b28c264' }" + + input: + tuple val(meta), path(reads, stageAs: "input*/*") + + output: + tuple val(meta), path("*.merged.fastq.gz"), emit: reads + path "versions.yml" , emit: versions + + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + def readList = reads instanceof List ? reads.collect{ it.toString() } : [reads.toString()] + if (meta.single_end) { + if (readList.size >= 1) { + """ + cat ${readList.join(' ')} > ${prefix}.merged.fastq.gz + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + cat: \$(echo \$(cat --version 2>&1) | sed 's/^.*coreutils) //; s/ .*\$//') + END_VERSIONS + """ + } + } else { + if (readList.size >= 2) { + def read1 = [] + def read2 = [] + readList.eachWithIndex{ v, ix -> ( ix & 1 ? read2 : read1 ) << v } + """ + cat ${read1.join(' ')} > ${prefix}_1.merged.fastq.gz + cat ${read2.join(' ')} > ${prefix}_2.merged.fastq.gz + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + cat: \$(echo \$(cat --version 2>&1) | sed 's/^.*coreutils) //; s/ .*\$//') + END_VERSIONS + """ + } + } + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + def readList = reads instanceof List ? reads.collect{ it.toString() } : [reads.toString()] + if (meta.single_end) { + if (readList.size >= 1) { + """ + echo '' | gzip > ${prefix}.merged.fastq.gz + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + cat: \$(echo \$(cat --version 2>&1) | sed 's/^.*coreutils) //; s/ .*\$//') + END_VERSIONS + """ + } + } else { + if (readList.size >= 2) { + """ + echo '' | gzip > ${prefix}_1.merged.fastq.gz + echo '' | gzip > ${prefix}_2.merged.fastq.gz + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + cat: \$(echo \$(cat --version 2>&1) | sed 's/^.*coreutils) //; s/ .*\$//') + END_VERSIONS + """ + } + } +} diff --git a/modules/nf-core/cat/fastq/meta.yml b/modules/nf-core/cat/fastq/meta.yml new file mode 100644 index 0000000..91ff2fb --- /dev/null +++ b/modules/nf-core/cat/fastq/meta.yml @@ -0,0 +1,45 @@ +name: cat_fastq +description: Concatenates fastq files +keywords: + - cat + - fastq + - concatenate +tools: + - cat: + description: | + The cat utility reads files sequentially, writing them to the standard output. + documentation: https://www.gnu.org/software/coreutils/manual/html_node/cat-invocation.html + licence: ["GPL-3.0-or-later"] + identifier: "" +input: + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: | + List of input FastQ files to be concatenated. +output: + - reads: + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.merged.fastq.gz": + type: file + description: Merged fastq file + pattern: "*.{merged.fastq.gz}" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@joseespinosa" + - "@drpatelh" +maintainers: + - "@joseespinosa" + - "@drpatelh" diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test b/modules/nf-core/cat/fastq/tests/main.nf.test new file mode 100644 index 0000000..f88a78b --- /dev/null +++ b/modules/nf-core/cat/fastq/tests/main.nf.test @@ -0,0 +1,248 @@ +// NOTE The version snaps may not be consistant +// https://github.com/nf-core/modules/pull/4087#issuecomment-1767948035 +nextflow_process { + + name "Test Process CAT_FASTQ" + script "../main.nf" + process "CAT_FASTQ" + tag "modules" + tag "modules_nfcore" + tag "cat" + tag "cat/fastq" + + test("test_cat_fastq_single_end") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_paired_end") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_single_end_same_name") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_paired_end_same_name") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_single_end_single_file") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_single_end - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_paired_end - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_single_end_same_name - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_paired_end_same_name - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_single_end_single_file - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test.snap b/modules/nf-core/cat/fastq/tests/main.nf.test.snap new file mode 100644 index 0000000..f8689a1 --- /dev/null +++ b/modules/nf-core/cat/fastq/tests/main.nf.test.snap @@ -0,0 +1,376 @@ +{ + "test_cat_fastq_single_end": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,ee314a9bd568d06617171b0c85f508da" + ] + ], + "1": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,ee314a9bd568d06617171b0c85f508da" + ] + ], + "versions": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-19T20:02:07.519211144" + }, + "test_cat_fastq_single_end_same_name": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22" + ] + ], + "1": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22" + ] + ], + "versions": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-19T20:02:31.618628921" + }, + "test_cat_fastq_single_end_single_file": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "1": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "versions": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-19T20:02:57.904149581" + }, + "test_cat_fastq_paired_end_same_name": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22", + "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5" + ] + ] + ], + "1": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22", + "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5" + ] + ] + ], + "versions": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-19T20:02:44.577183829" + }, + "test_cat_fastq_single_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "versions": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-19T20:03:10.603734777" + }, + "test_cat_fastq_paired_end_same_name - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "1": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "versions": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-19T20:03:46.041808828" + }, + "test_cat_fastq_single_end_same_name - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "versions": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-19T20:03:34.13865402" + }, + "test_cat_fastq_paired_end": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22", + "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5" + ] + ] + ], + "1": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,3ad9406595fafec8172368f9cd0b6a22", + "test_2.merged.fastq.gz:md5,a52cab0b840c7178b0ea83df1fdbe8d5" + ] + ] + ], + "versions": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-19T20:02:19.64383573" + }, + "test_cat_fastq_paired_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "1": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "versions": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-19T20:03:22.597246066" + }, + "test_cat_fastq_single_end_single_file - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "versions": [ + "versions.yml:md5,6ef4fd28546a005865b9454bbedbf81a" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-19T20:03:58.44849001" + } +} \ No newline at end of file diff --git a/modules/nf-core/cat/fastq/tests/tags.yml b/modules/nf-core/cat/fastq/tests/tags.yml new file mode 100644 index 0000000..6ac4361 --- /dev/null +++ b/modules/nf-core/cat/fastq/tests/tags.yml @@ -0,0 +1,2 @@ +cat/fastq: + - modules/nf-core/cat/fastq/** diff --git a/modules/nf-core/custom/dumpsoftwareversions/environment.yml b/modules/nf-core/custom/dumpsoftwareversions/environment.yml new file mode 100644 index 0000000..9d79af9 --- /dev/null +++ b/modules/nf-core/custom/dumpsoftwareversions/environment.yml @@ -0,0 +1,5 @@ +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::multiqc=1.20 diff --git a/modules/nf-core/custom/dumpsoftwareversions/main.nf b/modules/nf-core/custom/dumpsoftwareversions/main.nf index ebc8727..105f926 100644 --- a/modules/nf-core/custom/dumpsoftwareversions/main.nf +++ b/modules/nf-core/custom/dumpsoftwareversions/main.nf @@ -2,10 +2,10 @@ process CUSTOM_DUMPSOFTWAREVERSIONS { label 'process_single' // Requires `pyyaml` which does not have a dedicated container but is in the MultiQC container - conda "bioconda::multiqc=1.14" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/multiqc:1.14--pyhdfd78af_0' : - 'biocontainers/multiqc:1.14--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/multiqc:1.20--pyhdfd78af_0' : + 'biocontainers/multiqc:1.20--pyhdfd78af_0' }" input: path versions diff --git a/modules/nf-core/custom/dumpsoftwareversions/meta.yml b/modules/nf-core/custom/dumpsoftwareversions/meta.yml index c32657d..dc1e412 100644 --- a/modules/nf-core/custom/dumpsoftwareversions/meta.yml +++ b/modules/nf-core/custom/dumpsoftwareversions/meta.yml @@ -1,36 +1,43 @@ -# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/yaml-schema.json +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/meta-schema.json name: custom_dumpsoftwareversions -description: Custom module used to dump software versions within the nf-core pipeline template +description: Custom module used to dump software versions within the nf-core pipeline + template keywords: - custom - dump - version tools: - custom: - description: Custom module used to dump software versions within the nf-core pipeline template + description: Custom module used to dump software versions within the nf-core pipeline + template homepage: https://github.com/nf-core/tools documentation: https://github.com/nf-core/tools licence: ["MIT"] + identifier: "" input: - - versions: - type: file - description: YML file containing software versions - pattern: "*.yml" - + - - versions: + type: file + description: YML file containing software versions + pattern: "*.yml" output: - yml: - type: file - description: Standard YML file containing software versions - pattern: "software_versions.yml" + - software_versions.yml: + type: file + description: Standard YML file containing software versions + pattern: "software_versions.yml" - mqc_yml: - type: file - description: MultiQC custom content YML file containing software versions - pattern: "software_versions_mqc.yml" + - software_versions_mqc.yml: + type: file + description: MultiQC custom content YML file containing software versions + pattern: "software_versions_mqc.yml" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" - + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@drpatelh" - "@grst" +maintainers: + - "@drpatelh" + - "@grst" diff --git a/modules/nf-core/custom/dumpsoftwareversions/templates/dumpsoftwareversions.py b/modules/nf-core/custom/dumpsoftwareversions/templates/dumpsoftwareversions.py index da03340..b83b32c 100755 --- a/modules/nf-core/custom/dumpsoftwareversions/templates/dumpsoftwareversions.py +++ b/modules/nf-core/custom/dumpsoftwareversions/templates/dumpsoftwareversions.py @@ -3,11 +3,11 @@ """Provide functions to merge multiple versions.yml files.""" - -import yaml import platform from textwrap import dedent +import yaml + def _make_versions_html(versions): """Generate a tabular HTML output of all versions for MultiQC.""" diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test new file mode 100644 index 0000000..b1e1630 --- /dev/null +++ b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test @@ -0,0 +1,43 @@ +nextflow_process { + + name "Test Process CUSTOM_DUMPSOFTWAREVERSIONS" + script "../main.nf" + process "CUSTOM_DUMPSOFTWAREVERSIONS" + tag "modules" + tag "modules_nfcore" + tag "custom" + tag "dumpsoftwareversions" + tag "custom/dumpsoftwareversions" + + test("Should run without failures") { + when { + process { + """ + def tool1_version = ''' + TOOL1: + tool1: 0.11.9 + '''.stripIndent() + + def tool2_version = ''' + TOOL2: + tool2: 1.9 + '''.stripIndent() + + input[0] = Channel.of(tool1_version, tool2_version).collectFile() + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.versions, + file(process.out.mqc_yml[0]).readLines()[0..10], + file(process.out.yml[0]).readLines()[0..7] + ).match() + } + ) + } + } +} diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap new file mode 100644 index 0000000..5f59a93 --- /dev/null +++ b/modules/nf-core/custom/dumpsoftwareversions/tests/main.nf.test.snap @@ -0,0 +1,33 @@ +{ + "Should run without failures": { + "content": [ + [ + "versions.yml:md5,76d454d92244589d32455833f7c1ba6d" + ], + [ + "data: \"\\n\\n \\n \\n \\n \\n \\n \\n \\n\\", + " \\n\\n\\n \\n \\n\\", + " \\ \\n\\n\\n\\n \\n \\", + " \\ \\n \\n\\n\\n\\n\\", + " \\n\\n \\n \\n\\", + " \\ \\n\\n\\n\\n\\n\\n \\n\\", + " \\ \\n \\n\\n\\n\\n\\", + " \\n\\n \\n \\n\\" + ], + [ + "CUSTOM_DUMPSOFTWAREVERSIONS:", + " python: 3.11.7", + " yaml: 5.4.1", + "TOOL1:", + " tool1: 0.11.9", + "TOOL2:", + " tool2: '1.9'", + "Workflow:" + ] + ], + "timestamp": "2024-01-09T23:01:18.710682" + } +} \ No newline at end of file diff --git a/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml b/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml new file mode 100644 index 0000000..405aa24 --- /dev/null +++ b/modules/nf-core/custom/dumpsoftwareversions/tests/tags.yml @@ -0,0 +1,2 @@ +custom/dumpsoftwareversions: + - modules/nf-core/custom/dumpsoftwareversions/** diff --git a/modules/nf-core/cutadapt/environment.yml b/modules/nf-core/cutadapt/environment.yml new file mode 100644 index 0000000..dfdbd1c --- /dev/null +++ b/modules/nf-core/cutadapt/environment.yml @@ -0,0 +1,5 @@ +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::cutadapt=4.6 diff --git a/modules/nf-core/cutadapt/main.nf b/modules/nf-core/cutadapt/main.nf index 60bd648..3d3e571 100644 --- a/modules/nf-core/cutadapt/main.nf +++ b/modules/nf-core/cutadapt/main.nf @@ -2,10 +2,10 @@ process CUTADAPT { tag "$meta.id" label 'process_medium' - conda "bioconda::cutadapt=3.4" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/cutadapt:3.4--py39h38f01e4_1' : - 'biocontainers/cutadapt:3.4--py39h38f01e4_1' }" + 'https://depot.galaxyproject.org/singularity/cutadapt:4.6--py39hf95cd2a_1' : + 'biocontainers/cutadapt:4.6--py39hf95cd2a_1' }" input: tuple val(meta), path(reads) @@ -24,6 +24,7 @@ process CUTADAPT { def trimmed = meta.single_end ? "-o ${prefix}.trim.fastq.gz" : "-o ${prefix}_1.trim.fastq.gz -p ${prefix}_2.trim.fastq.gz" """ cutadapt \\ + -Z \\ --cores $task.cpus \\ $args \\ $trimmed \\ diff --git a/modules/nf-core/cutadapt/meta.yml b/modules/nf-core/cutadapt/meta.yml index 768bac3..8844d86 100644 --- a/modules/nf-core/cutadapt/meta.yml +++ b/modules/nf-core/cutadapt/meta.yml @@ -12,35 +12,47 @@ tools: documentation: https://cutadapt.readthedocs.io/en/stable/index.html doi: 10.14806/ej.17.1.200 licence: ["MIT"] + identifier: biotools:cutadapt input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - reads: - type: file - description: | - List of input FastQ files of size 1 and 2 for single-end and paired-end data, - respectively. + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: | + List of input FastQ files of size 1 and 2 for single-end and paired-end data, + respectively. output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - reads: - type: file - description: The trimmed/modified fastq reads - pattern: "*fastq.gz" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.trim.fastq.gz": + type: file + description: The trimmed/modified fastq reads + pattern: "*fastq.gz" - log: - type: file - description: cuatadapt log file - pattern: "*cutadapt.log" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.log": + type: file + description: cuatadapt log file + pattern: "*cutadapt.log" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@drpatelh" - "@kevinmenden" +maintainers: + - "@drpatelh" + - "@kevinmenden" diff --git a/modules/nf-core/cutadapt/tests/main.nf.test b/modules/nf-core/cutadapt/tests/main.nf.test new file mode 100644 index 0000000..36927bd --- /dev/null +++ b/modules/nf-core/cutadapt/tests/main.nf.test @@ -0,0 +1,69 @@ +nextflow_process { + + name "Test Process CUTADAPT" + script "../main.nf" + process "CUTADAPT" + tag "modules" + tag "modules_nfcore" + tag "cutadapt" + + test("sarscov2 Illumina single end [fastq]") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id: 'test', single_end:true ], + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert process.out.reads != null }, + { assert process.out.reads.get(0).get(1) ==~ ".*.trim.fastq.gz" }, + { assert snapshot(process.out.versions).match("versions_single_end") }, + { assert snapshot(path(process.out.reads.get(0).get(1)).linesGzip[0]).match() } + ) + } + } + + test("sarscov2 Illumina paired-end [fastq]") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = [ + [ id: 'test', single_end:false ], + [ + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) + ] + ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert process.out.reads != null }, + { assert process.out.reads.get(0).get(1).get(0) ==~ ".*.1.trim.fastq.gz" }, + { assert process.out.reads.get(0).get(1).get(1) ==~ ".*.2.trim.fastq.gz" }, + { assert snapshot(path(process.out.reads.get(0).get(1).get(1)).linesGzip[0]).match() }, + { assert snapshot(process.out.versions).match("versions_paired_end") } + ) + } + } +} diff --git a/modules/nf-core/cutadapt/tests/main.nf.test.snap b/modules/nf-core/cutadapt/tests/main.nf.test.snap new file mode 100644 index 0000000..3df7389 --- /dev/null +++ b/modules/nf-core/cutadapt/tests/main.nf.test.snap @@ -0,0 +1,46 @@ +{ + "sarscov2 Illumina single end [fastq]": { + "content": [ + "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/1" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-06T10:27:15.235936866" + }, + "sarscov2 Illumina paired-end [fastq]": { + "content": [ + "@ERR5069949.2151832 NS500628:121:HK3MMAFX2:2:21208:10793:15304/2" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-06T10:27:24.38468252" + }, + "versions_paired_end": { + "content": [ + [ + "versions.yml:md5,bc9892c68bfa7084ec5dbffbb9e8322f" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-06T10:27:24.38799189" + }, + "versions_single_end": { + "content": [ + [ + "versions.yml:md5,bc9892c68bfa7084ec5dbffbb9e8322f" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-03-06T10:27:15.219246449" + } +} \ No newline at end of file diff --git a/modules/nf-core/cutadapt/tests/nextflow.config b/modules/nf-core/cutadapt/tests/nextflow.config new file mode 100644 index 0000000..6c3b425 --- /dev/null +++ b/modules/nf-core/cutadapt/tests/nextflow.config @@ -0,0 +1,7 @@ +process { + + withName: CUTADAPT { + ext.args = '-q 25' + } + +} diff --git a/modules/nf-core/cutadapt/tests/tags.yml b/modules/nf-core/cutadapt/tests/tags.yml new file mode 100644 index 0000000..f64f997 --- /dev/null +++ b/modules/nf-core/cutadapt/tests/tags.yml @@ -0,0 +1,2 @@ +cutadapt: + - modules/nf-core/cutadapt/** diff --git a/modules/nf-core/fastqc/environment.yml b/modules/nf-core/fastqc/environment.yml new file mode 100644 index 0000000..691d4c7 --- /dev/null +++ b/modules/nf-core/fastqc/environment.yml @@ -0,0 +1,5 @@ +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::fastqc=0.12.1 diff --git a/modules/nf-core/fastqc/main.nf b/modules/nf-core/fastqc/main.nf index 249f906..752c3a1 100644 --- a/modules/nf-core/fastqc/main.nf +++ b/modules/nf-core/fastqc/main.nf @@ -2,10 +2,10 @@ process FASTQC { tag "$meta.id" label 'process_medium' - conda "bioconda::fastqc=0.11.9" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/fastqc:0.11.9--0' : - 'biocontainers/fastqc:0.11.9--0' }" + 'https://depot.galaxyproject.org/singularity/fastqc:0.12.1--hdfd78af_0' : + 'biocontainers/fastqc:0.12.1--hdfd78af_0' }" input: tuple val(meta), path(reads) @@ -24,7 +24,15 @@ process FASTQC { // Make list of old name and new name pairs to use for renaming in the bash while loop def old_new_pairs = reads instanceof Path || reads.size() == 1 ? [[ reads, "${prefix}.${reads.extension}" ]] : reads.withIndex().collect { entry, index -> [ entry, "${prefix}_${index + 1}.${entry.extension}" ] } def rename_to = old_new_pairs*.join(' ').join(' ') - def renamed_files = old_new_pairs.collect{ old_name, new_name -> new_name }.join(' ') + def renamed_files = old_new_pairs.collect{ _old_name, new_name -> new_name }.join(' ') + + // The total amount of allocated RAM by FastQC is equal to the number of threads defined (--threads) time the amount of RAM defined (--memory) + // https://github.com/s-andrews/FastQC/blob/1faeea0412093224d7f6a07f777fad60a5650795/fastqc#L211-L222 + // Dividing the task.memory by task.cpu allows to stick to requested amount of RAM in the label + def memory_in_mb = MemoryUnit.of("${task.memory}").toUnit('MB') / task.cpus + // FastQC memory value allowed range (100 - 10000) + def fastqc_memory = memory_in_mb > 10000 ? 10000 : (memory_in_mb < 100 ? 100 : memory_in_mb) + """ printf "%s %s\\n" $rename_to | while read old_name new_name; do [ -f "\${new_name}" ] || ln -s \$old_name \$new_name @@ -33,11 +41,12 @@ process FASTQC { fastqc \\ $args \\ --threads $task.cpus \\ + --memory $fastqc_memory \\ $renamed_files cat <<-END_VERSIONS > versions.yml "${task.process}": - fastqc: \$( fastqc --version | sed -e "s/FastQC v//g" ) + fastqc: \$( fastqc --version | sed '/FastQC v/!d; s/.*v//' ) END_VERSIONS """ @@ -49,7 +58,7 @@ process FASTQC { cat <<-END_VERSIONS > versions.yml "${task.process}": - fastqc: \$( fastqc --version | sed -e "s/FastQC v//g" ) + fastqc: \$( fastqc --version | sed '/FastQC v/!d; s/.*v//' ) END_VERSIONS """ } diff --git a/modules/nf-core/fastqc/meta.yml b/modules/nf-core/fastqc/meta.yml index 4da5bb5..2b2e62b 100644 --- a/modules/nf-core/fastqc/meta.yml +++ b/modules/nf-core/fastqc/meta.yml @@ -11,42 +11,57 @@ tools: FastQC gives general quality metrics about your reads. It provides information about the quality score distribution across your reads, the per base sequence content (%A/C/G/T). + You get information about adapter contamination and other overrepresented sequences. homepage: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ documentation: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/Help/ licence: ["GPL-2.0-only"] + identifier: biotools:fastqc input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - reads: - type: file - description: | - List of input FastQ files of size 1 and 2 for single-end and paired-end data, - respectively. + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - reads: + type: file + description: | + List of input FastQ files of size 1 and 2 for single-end and paired-end data, + respectively. output: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - html: - type: file - description: FastQC report - pattern: "*_{fastqc.html}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.html": + type: file + description: FastQC report + pattern: "*_{fastqc.html}" - zip: - type: file - description: FastQC report archive - pattern: "*_{fastqc.zip}" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - "*.zip": + type: file + description: FastQC report archive + pattern: "*_{fastqc.zip}" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@drpatelh" - "@grst" - "@ewels" - "@FelixKrueger" +maintainers: + - "@drpatelh" + - "@grst" + - "@ewels" + - "@FelixKrueger" diff --git a/modules/nf-core/fastqc/tests/main.nf.test b/modules/nf-core/fastqc/tests/main.nf.test new file mode 100644 index 0000000..e9d79a0 --- /dev/null +++ b/modules/nf-core/fastqc/tests/main.nf.test @@ -0,0 +1,309 @@ +nextflow_process { + + name "Test Process FASTQC" + script "../main.nf" + process "FASTQC" + + tag "modules" + tag "modules_nfcore" + tag "fastqc" + + test("sarscov2 single-end [fastq]") { + + when { + process { + """ + input[0] = Channel.of([ + [ id: 'test', single_end:true ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it. + // looks like this:
    Mon 2 Oct 2023
    test.gz
    + // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039 + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("") }, + { assert snapshot(process.out.versions).match() } + ) + } + } + + test("sarscov2 paired-end [fastq]") { + + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, + { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, + { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, + { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, + { assert path(process.out.html[0][1][0]).text.contains("") }, + { assert path(process.out.html[0][1][1]).text.contains("") }, + { assert snapshot(process.out.versions).match() } + ) + } + } + + test("sarscov2 interleaved [fastq]") { + + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("") }, + { assert snapshot(process.out.versions).match() } + ) + } + } + + test("sarscov2 paired-end [bam]") { + + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("") }, + { assert snapshot(process.out.versions).match() } + ) + } + } + + test("sarscov2 multiple [fastq]") { + + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, + { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, + { assert process.out.html[0][1][2] ==~ ".*/test_3_fastqc.html" }, + { assert process.out.html[0][1][3] ==~ ".*/test_4_fastqc.html" }, + { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, + { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, + { assert process.out.zip[0][1][2] ==~ ".*/test_3_fastqc.zip" }, + { assert process.out.zip[0][1][3] ==~ ".*/test_4_fastqc.zip" }, + { assert path(process.out.html[0][1][0]).text.contains("") }, + { assert path(process.out.html[0][1][1]).text.contains("") }, + { assert path(process.out.html[0][1][2]).text.contains("") }, + { assert path(process.out.html[0][1][3]).text.contains("") }, + { assert snapshot(process.out.versions).match() } + ) + } + } + + test("sarscov2 custom_prefix") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'mysample', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert process.out.html[0][1] ==~ ".*/mysample_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/mysample_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("") }, + { assert snapshot(process.out.versions).match() } + ) + } + } + + test("sarscov2 single-end [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id: 'test', single_end:true ], + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 paired-end [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 interleaved [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 paired-end [bam] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 multiple [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 custom_prefix - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'mysample', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} diff --git a/modules/nf-core/fastqc/tests/main.nf.test.snap b/modules/nf-core/fastqc/tests/main.nf.test.snap new file mode 100644 index 0000000..d5db309 --- /dev/null +++ b/modules/nf-core/fastqc/tests/main.nf.test.snap @@ -0,0 +1,392 @@ +{ + "sarscov2 custom_prefix": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:16.374038" + }, + "sarscov2 single-end [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": true + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": true + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:24.993809" + }, + "sarscov2 custom_prefix - stub": { + "content": [ + { + "0": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:03:10.93942" + }, + "sarscov2 interleaved [fastq]": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:01:42.355718" + }, + "sarscov2 paired-end [bam]": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:01:53.276274" + }, + "sarscov2 multiple [fastq]": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:05.527626" + }, + "sarscov2 paired-end [fastq]": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:01:31.188871" + }, + "sarscov2 paired-end [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:34.273566" + }, + "sarscov2 multiple [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:03:02.304411" + }, + "sarscov2 single-end [fastq]": { + "content": [ + [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:01:19.095607" + }, + "sarscov2 interleaved [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:44.640184" + }, + "sarscov2 paired-end [bam] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:53.550742" + } +} \ No newline at end of file diff --git a/modules/nf-core/fastqc/tests/tags.yml b/modules/nf-core/fastqc/tests/tags.yml new file mode 100644 index 0000000..7834294 --- /dev/null +++ b/modules/nf-core/fastqc/tests/tags.yml @@ -0,0 +1,2 @@ +fastqc: + - modules/nf-core/fastqc/** diff --git a/modules/nf-core/gunzip/environment.yml b/modules/nf-core/gunzip/environment.yml new file mode 100644 index 0000000..c779485 --- /dev/null +++ b/modules/nf-core/gunzip/environment.yml @@ -0,0 +1,7 @@ +channels: + - conda-forge + - bioconda +dependencies: + - conda-forge::grep=3.11 + - conda-forge::sed=4.8 + - conda-forge::tar=1.34 diff --git a/modules/nf-core/gunzip/main.nf b/modules/nf-core/gunzip/main.nf index e7189d2..5e67e3b 100644 --- a/modules/nf-core/gunzip/main.nf +++ b/modules/nf-core/gunzip/main.nf @@ -2,10 +2,10 @@ process GUNZIP { tag "$archive" label 'process_single' - conda "conda-forge::sed=4.7" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' : - 'nf-core/ubuntu:20.04' }" + 'https://depot.galaxyproject.org/singularity/ubuntu:22.04' : + 'nf-core/ubuntu:22.04' }" input: tuple val(meta), path(archive) @@ -18,13 +18,20 @@ process GUNZIP { task.ext.when == null || task.ext.when script: - def args = task.ext.args ?: '' - gunzip = archive.toString() - '.gz' + def args = task.ext.args ?: '' + def extension = ( archive.toString() - '.gz' ).tokenize('.')[-1] + def name = archive.toString() - '.gz' - ".$extension" + def prefix = task.ext.prefix ?: name + gunzip = prefix + ".$extension" """ - gunzip \\ - -f \\ + # Not calling gunzip itself because it creates files + # with the original group ownership rather than the + # default one for that user / the work directory + gzip \\ + -cd \\ $args \\ - $archive + $archive \\ + > $gunzip cat <<-END_VERSIONS > versions.yml "${task.process}": @@ -33,7 +40,11 @@ process GUNZIP { """ stub: - gunzip = archive.toString() - '.gz' + def args = task.ext.args ?: '' + def extension = ( archive.toString() - '.gz' ).tokenize('.')[-1] + def name = archive.toString() - '.gz' - ".$extension" + def prefix = task.ext.prefix ?: name + gunzip = prefix + ".$extension" """ touch $gunzip cat <<-END_VERSIONS > versions.yml diff --git a/modules/nf-core/gunzip/meta.yml b/modules/nf-core/gunzip/meta.yml index 4cdcdf4..9066c03 100644 --- a/modules/nf-core/gunzip/meta.yml +++ b/modules/nf-core/gunzip/meta.yml @@ -10,26 +10,38 @@ tools: gzip is a file format and a software application used for file compression and decompression. documentation: https://www.gnu.org/software/gzip/manual/gzip.html licence: ["GPL-3.0-or-later"] + identifier: "" input: - - meta: - type: map - description: | - Optional groovy Map containing meta information - e.g. [ id:'test', single_end:false ] - - archive: - type: file - description: File to be compressed/uncompressed - pattern: "*.*" + - - meta: + type: map + description: | + Optional groovy Map containing meta information + e.g. [ id:'test', single_end:false ] + - archive: + type: file + description: File to be compressed/uncompressed + pattern: "*.*" output: - gunzip: - type: file - description: Compressed/uncompressed file - pattern: "*.*" + - meta: + type: file + description: Compressed/uncompressed file + pattern: "*.*" + - $gunzip: + type: file + description: Compressed/uncompressed file + pattern: "*.*" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@joseespinosa" - "@drpatelh" - "@jfy133" +maintainers: + - "@joseespinosa" + - "@drpatelh" + - "@jfy133" + - "@gallvp" diff --git a/modules/nf-core/gunzip/tests/main.nf.test b/modules/nf-core/gunzip/tests/main.nf.test new file mode 100644 index 0000000..776211a --- /dev/null +++ b/modules/nf-core/gunzip/tests/main.nf.test @@ -0,0 +1,121 @@ +nextflow_process { + + name "Test Process GUNZIP" + script "../main.nf" + process "GUNZIP" + tag "gunzip" + tag "modules_nfcore" + tag "modules" + + test("Should run without failures") { + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + ) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("Should run without failures - prefix") { + + config './nextflow.config' + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [ id: 'test' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + ) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("Should run without failures - stub") { + + options '-stub' + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + ) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("Should run without failures - prefix - stub") { + + options '-stub' + config './nextflow.config' + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [ id: 'test' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + ) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/gunzip/tests/main.nf.test.snap b/modules/nf-core/gunzip/tests/main.nf.test.snap new file mode 100644 index 0000000..069967e --- /dev/null +++ b/modules/nf-core/gunzip/tests/main.nf.test.snap @@ -0,0 +1,134 @@ +{ + "Should run without failures - prefix - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.xyz.fastq:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ], + "gunzip": [ + [ + { + "id": "test" + }, + "test.xyz.fastq:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-25T11:35:10.861293" + }, + "Should run without failures - stub": { + "content": [ + { + "0": [ + [ + [ + + ], + "test_1.fastq:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ], + "gunzip": [ + [ + [ + + ], + "test_1.fastq:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-25T11:35:05.857145" + }, + "Should run without failures": { + "content": [ + { + "0": [ + [ + [ + + ], + "test_1.fastq:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "1": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ], + "gunzip": [ + [ + [ + + ], + "test_1.fastq:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "versions": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2023-10-17T15:35:37.690477896" + }, + "Should run without failures - prefix": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.xyz.fastq:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "1": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ], + "gunzip": [ + [ + { + "id": "test" + }, + "test.xyz.fastq:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "versions": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-25T11:33:32.921739" + } +} \ No newline at end of file diff --git a/modules/nf-core/gunzip/tests/nextflow.config b/modules/nf-core/gunzip/tests/nextflow.config new file mode 100644 index 0000000..dec7764 --- /dev/null +++ b/modules/nf-core/gunzip/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: GUNZIP { + ext.prefix = { "${meta.id}.xyz" } + } +} diff --git a/modules/nf-core/gunzip/tests/tags.yml b/modules/nf-core/gunzip/tests/tags.yml new file mode 100644 index 0000000..fd3f691 --- /dev/null +++ b/modules/nf-core/gunzip/tests/tags.yml @@ -0,0 +1,2 @@ +gunzip: + - modules/nf-core/gunzip/** diff --git a/modules/nf-core/multiqc/environment.yml b/modules/nf-core/multiqc/environment.yml new file mode 100644 index 0000000..6f5b867 --- /dev/null +++ b/modules/nf-core/multiqc/environment.yml @@ -0,0 +1,5 @@ +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::multiqc=1.25.1 diff --git a/modules/nf-core/multiqc/main.nf b/modules/nf-core/multiqc/main.nf index 1fc387b..cc0643e 100644 --- a/modules/nf-core/multiqc/main.nf +++ b/modules/nf-core/multiqc/main.nf @@ -1,16 +1,18 @@ process MULTIQC { label 'process_single' - conda "bioconda::multiqc=1.14" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/multiqc:1.14--pyhdfd78af_0' : - 'biocontainers/multiqc:1.14--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/multiqc:1.25.1--pyhdfd78af_0' : + 'biocontainers/multiqc:1.25.1--pyhdfd78af_0' }" input: path multiqc_files, stageAs: "?/*" path(multiqc_config) path(extra_multiqc_config) path(multiqc_logo) + path(replace_names) + path(sample_names) output: path "*multiqc_report.html", emit: report @@ -23,14 +25,22 @@ process MULTIQC { script: def args = task.ext.args ?: '' + def prefix = task.ext.prefix ? "--filename ${task.ext.prefix}.html" : '' def config = multiqc_config ? "--config $multiqc_config" : '' def extra_config = extra_multiqc_config ? "--config $extra_multiqc_config" : '' + def logo = multiqc_logo ? "--cl-config 'custom_logo: \"${multiqc_logo}\"'" : '' + def replace = replace_names ? "--replace-names ${replace_names}" : '' + def samples = sample_names ? "--sample-names ${sample_names}" : '' """ multiqc \\ --force \\ $args \\ $config \\ + $prefix \\ $extra_config \\ + $logo \\ + $replace \\ + $samples \\ . cat <<-END_VERSIONS > versions.yml @@ -41,8 +51,8 @@ process MULTIQC { stub: """ - touch multiqc_data - touch multiqc_plots + mkdir multiqc_data + mkdir multiqc_plots touch multiqc_report.html cat <<-END_VERSIONS > versions.yml diff --git a/modules/nf-core/multiqc/meta.yml b/modules/nf-core/multiqc/meta.yml index f93b5ee..b16c187 100644 --- a/modules/nf-core/multiqc/meta.yml +++ b/modules/nf-core/multiqc/meta.yml @@ -1,6 +1,6 @@ -# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/modules/yaml-schema.json -name: MultiQC -description: Aggregate results from bioinformatics analyses across many samples into a single report +name: multiqc +description: Aggregate results from bioinformatics analyses across many samples into + a single report keywords: - QC - bioinformatics tools @@ -13,44 +13,66 @@ tools: homepage: https://multiqc.info/ documentation: https://multiqc.info/docs/ licence: ["GPL-3.0-or-later"] - + identifier: biotools:multiqc input: - - multiqc_files: - type: file - description: | - List of reports / files recognised by MultiQC, for example the html and zip output of FastQC - - multiqc_config: - type: file - description: Optional config yml for MultiQC - pattern: "*.{yml,yaml}" - - extra_multiqc_config: - type: file - description: Second optional config yml for MultiQC. Will override common sections in multiqc_config. - pattern: "*.{yml,yaml}" - - multiqc_logo: - type: file - description: Optional logo file for MultiQC - pattern: "*.{png}" - + - - multiqc_files: + type: file + description: | + List of reports / files recognised by MultiQC, for example the html and zip output of FastQC + - - multiqc_config: + type: file + description: Optional config yml for MultiQC + pattern: "*.{yml,yaml}" + - - extra_multiqc_config: + type: file + description: Second optional config yml for MultiQC. Will override common sections + in multiqc_config. + pattern: "*.{yml,yaml}" + - - multiqc_logo: + type: file + description: Optional logo file for MultiQC + pattern: "*.{png}" + - - replace_names: + type: file + description: | + Optional two-column sample renaming file. First column a set of + patterns, second column a set of corresponding replacements. Passed via + MultiQC's `--replace-names` option. + pattern: "*.{tsv}" + - - sample_names: + type: file + description: | + Optional TSV file with headers, passed to the MultiQC --sample_names + argument. + pattern: "*.{tsv}" output: - report: - type: file - description: MultiQC report file - pattern: "multiqc_report.html" + - "*multiqc_report.html": + type: file + description: MultiQC report file + pattern: "multiqc_report.html" - data: - type: directory - description: MultiQC data dir - pattern: "multiqc_data" + - "*_data": + type: directory + description: MultiQC data dir + pattern: "multiqc_data" - plots: - type: file - description: Plots created by MultiQC - pattern: "*_data" + - "*_plots": + type: file + description: Plots created by MultiQC + pattern: "*_data" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@abhi18av" - "@bunop" - "@drpatelh" - "@jfy133" +maintainers: + - "@abhi18av" + - "@bunop" + - "@drpatelh" + - "@jfy133" diff --git a/modules/nf-core/multiqc/tests/main.nf.test b/modules/nf-core/multiqc/tests/main.nf.test new file mode 100644 index 0000000..33316a7 --- /dev/null +++ b/modules/nf-core/multiqc/tests/main.nf.test @@ -0,0 +1,92 @@ +nextflow_process { + + name "Test Process MULTIQC" + script "../main.nf" + process "MULTIQC" + + tag "modules" + tag "modules_nfcore" + tag "multiqc" + + config "./nextflow.config" + + test("sarscov2 single-end [fastqc]") { + + when { + process { + """ + input[0] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastqc/test_fastqc.zip', checkIfExists: true)) + input[1] = [] + input[2] = [] + input[3] = [] + input[4] = [] + input[5] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert process.out.report[0] ==~ ".*/multiqc_report.html" }, + { assert process.out.data[0] ==~ ".*/multiqc_data" }, + { assert snapshot(process.out.versions).match("multiqc_versions_single") } + ) + } + + } + + test("sarscov2 single-end [fastqc] [config]") { + + when { + process { + """ + input[0] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastqc/test_fastqc.zip', checkIfExists: true)) + input[1] = Channel.of(file("https://github.com/nf-core/tools/raw/dev/nf_core/pipeline-template/assets/multiqc_config.yml", checkIfExists: true)) + input[2] = [] + input[3] = [] + input[4] = [] + input[5] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert process.out.report[0] ==~ ".*/multiqc_report.html" }, + { assert process.out.data[0] ==~ ".*/multiqc_data" }, + { assert snapshot(process.out.versions).match("multiqc_versions_config") } + ) + } + } + + test("sarscov2 single-end [fastqc] - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of(file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastqc/test_fastqc.zip', checkIfExists: true)) + input[1] = [] + input[2] = [] + input[3] = [] + input[4] = [] + input[5] = [] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.report.collect { file(it).getName() } + + process.out.data.collect { file(it).getName() } + + process.out.plots.collect { file(it).getName() } + + process.out.versions ).match("multiqc_stub") } + ) + } + + } +} diff --git a/modules/nf-core/multiqc/tests/main.nf.test.snap b/modules/nf-core/multiqc/tests/main.nf.test.snap new file mode 100644 index 0000000..2fcbb5f --- /dev/null +++ b/modules/nf-core/multiqc/tests/main.nf.test.snap @@ -0,0 +1,41 @@ +{ + "multiqc_versions_single": { + "content": [ + [ + "versions.yml:md5,41f391dcedce7f93ca188f3a3ffa0916" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-02T17:51:46.317523" + }, + "multiqc_stub": { + "content": [ + [ + "multiqc_report.html", + "multiqc_data", + "multiqc_plots", + "versions.yml:md5,41f391dcedce7f93ca188f3a3ffa0916" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-02T17:52:20.680978" + }, + "multiqc_versions_config": { + "content": [ + [ + "versions.yml:md5,41f391dcedce7f93ca188f3a3ffa0916" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-02T17:52:09.185842" + } +} \ No newline at end of file diff --git a/modules/nf-core/multiqc/tests/nextflow.config b/modules/nf-core/multiqc/tests/nextflow.config new file mode 100644 index 0000000..c537a6a --- /dev/null +++ b/modules/nf-core/multiqc/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: 'MULTIQC' { + ext.prefix = null + } +} diff --git a/modules/nf-core/multiqc/tests/tags.yml b/modules/nf-core/multiqc/tests/tags.yml new file mode 100644 index 0000000..bea6c0d --- /dev/null +++ b/modules/nf-core/multiqc/tests/tags.yml @@ -0,0 +1,2 @@ +multiqc: + - modules/nf-core/multiqc/** diff --git a/modules/nf-core/star/align/main.nf b/modules/nf-core/star/align/main.nf deleted file mode 100644 index d2ecd1d..0000000 --- a/modules/nf-core/star/align/main.nf +++ /dev/null @@ -1,122 +0,0 @@ -process STAR_ALIGN { - tag "$meta.id" - label 'process_high' - - conda "bioconda::star=2.7.9a bioconda::samtools=1.16.1 conda-forge::gawk=5.1.0" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:1df389393721fc66f3fd8778ad938ac711951107-0' : - 'biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:1df389393721fc66f3fd8778ad938ac711951107-0' }" - - input: - tuple val(meta), path(reads, stageAs: "input*/*") - path index - path gtf - path whitelist - val star_ignore_sjdbgtf - val seq_platform - val seq_center - - output: - tuple val(meta), path('*Log.final.out') , emit: log_final - tuple val(meta), path('*Log.out') , emit: log_out - tuple val(meta), path('*Log.progress.out'), emit: log_progress - path "versions.yml" , emit: versions - - tuple val(meta), path('*d.out.bam') , optional:true, emit: bam - tuple val(meta), path('*sortedByCoord.out.bam') , optional:true, emit: bam_sorted - tuple val(meta), path('*toTranscriptome.out.bam'), optional:true, emit: bam_transcript - tuple val(meta), path('*Aligned.unsort.out.bam') , optional:true, emit: bam_unsorted - tuple val(meta), path('*.Solo.out') , emit: counts - tuple val(meta), path('*fastq.gz') , optional:true, emit: fastq - tuple val(meta), path('*.tab') , optional:true, emit: tab - tuple val(meta), path('*.SJ.out.tab') , optional:true, emit: spl_junc_tab - tuple val(meta), path('*.ReadsPerGene.out.tab') , optional:true, emit: read_per_gene_tab - tuple val(meta), path('*.out.junction') , optional:true, emit: junction - tuple val(meta), path('*.out.sam') , optional:true, emit: sam - tuple val(meta), path('*.wig') , optional:true, emit: wig - tuple val(meta), path('*.bg') , optional:true, emit: bedgraph - - when: - task.ext.when == null || task.ext.when - - script: - def args = task.ext.args ?: '' - def prefix = task.ext.prefix ?: "${meta.id}" - def reads1 = [], reads2 = [] - meta.single_end ? [reads].flatten().each{reads1 << it} : reads.eachWithIndex{ v, ix -> ( ix & 1 ? reads2 : reads1) << v } - def ignore_gtf = star_ignore_sjdbgtf ? '' : "--sjdbGTFfile $gtf" - def seq_platform = seq_platform ? "'PL:$seq_platform'" : "" - def seq_center = seq_center ? "'CN:$seq_center'" : "" - def attrRG = args.contains("--outSAMattrRGline") ? "" : "--outSAMattrRGline 'ID:$prefix' $seq_center 'SM:$prefix' $seq_platform" - def out_sam_type = (args.contains('--outSAMtype')) ? '' : '--outSAMtype BAM Unsorted' - def mv_unsorted_bam = (args.contains('--outSAMtype BAM Unsorted SortedByCoordinate')) ? "mv ${prefix}.Aligned.out.bam ${prefix}.Aligned.unsort.out.bam" : '' - - // StarSolo - def solo_whitelist = whitelist ? "--soloCBwhitelist $whitelist" : '' - def in_reads = solo_whitelist != '' ? "${reads2.join(',')} ${reads1.join(',')}" : "${reads1.join(',')} ${reads2.join(',')}" - """ - STAR \\ - --genomeDir $index \\ - --readFilesIn $in_reads \\ - --runThreadN $task.cpus \\ - --outFileNamePrefix $prefix. \\ - $out_sam_type \\ - $ignore_gtf \\ - $solo_whitelist \\ - $attrRG \\ - $args - - $mv_unsorted_bam - - if [ -f ${prefix}.Unmapped.out.mate1 ]; then - mv ${prefix}.Unmapped.out.mate1 ${prefix}.unmapped_1.fastq - gzip ${prefix}.unmapped_1.fastq - fi - if [ -f ${prefix}.Unmapped.out.mate2 ]; then - mv ${prefix}.Unmapped.out.mate2 ${prefix}.unmapped_2.fastq - gzip ${prefix}.unmapped_2.fastq - fi - - if [ -d ${prefix}.Solo.out ]; then - # Backslashes still need to be escaped (https://github.com/nextflow-io/nextflow/issues/67) - find ${prefix}.Solo.out \\( -name "*.tsv" -o -name "*.mtx" \\) -exec gzip {} \\; - fi - - cat <<-END_VERSIONS > versions.yml - "${task.process}": - star: \$(STAR --version | sed -e "s/STAR_//g") - samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') - gawk: \$(echo \$(gawk --version 2>&1) | sed 's/^.*GNU Awk //; s/, .*\$//') - END_VERSIONS - """ - - stub: - def prefix = task.ext.prefix ?: "${meta.id}" - """ - touch ${prefix}Xd.out.bam - touch ${prefix}.Log.final.out - touch ${prefix}.Log.out - touch ${prefix}.Log.progress.out - touch ${prefix}.sortedByCoord.out.bam - mkdir ${prefix}.Solo.out - touch ${prefix}.toTranscriptome.out.bam - touch ${prefix}.Aligned.unsort.out.bam - touch ${prefix}.Aligned.sortedByCoord.out.bam - touch ${prefix}.unmapped_1.fastq.gz - touch ${prefix}.unmapped_2.fastq.gz - touch ${prefix}.tab - touch ${prefix}.SJ.out.tab - touch ${prefix}.ReadsPerGene.out.tab - touch ${prefix}.Chimeric.out.junction - touch ${prefix}.out.sam - touch ${prefix}.Signal.UniqueMultiple.str1.out.wig - touch ${prefix}.Signal.UniqueMultiple.str1.out.bg - - cat <<-END_VERSIONS > versions.yml - "${task.process}": - star: \$(STAR --version | sed -e "s/STAR_//g") - samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') - gawk: \$(echo \$(gawk --version 2>&1) | sed 's/^.*GNU Awk //; s/, .*\$//') - END_VERSIONS - """ -} diff --git a/modules/nf-core/star/align/meta.yml b/modules/nf-core/star/align/meta.yml deleted file mode 100644 index bce16d3..0000000 --- a/modules/nf-core/star/align/meta.yml +++ /dev/null @@ -1,89 +0,0 @@ -name: star_align -description: Align reads to a reference genome using STAR -keywords: - - align - - fasta - - genome - - reference -tools: - - star: - description: | - STAR is a software package for mapping DNA sequences against - a large reference genome, such as the human genome. - homepage: https://github.com/alexdobin/STAR - manual: https://github.com/alexdobin/STAR/blob/master/doc/STARmanual.pdf - doi: 10.1093/bioinformatics/bts635 - licence: ["MIT"] -input: - - meta: - type: map - description: | - Groovy Map containing sample information - e.g. [ id:'test', single_end:false ] - - reads: - type: file - description: | - List of input FastQ files of size 1 and 2 for single-end and paired-end data, - respectively. - - index: - type: directory - description: STAR genome index - pattern: "star" -output: - - bam: - type: file - description: Output BAM file containing read alignments - pattern: "*.{bam}" - - log_final: - type: file - description: STAR final log file - pattern: "*Log.final.out" - - log_out: - type: file - description: STAR lot out file - pattern: "*Log.out" - - log_progress: - type: file - description: STAR log progress file - pattern: "*Log.progress.out" - - versions: - type: file - description: File containing software versions - pattern: "versions.yml" - - bam_sorted: - type: file - description: Sorted BAM file of read alignments (optional) - pattern: "*sortedByCoord.out.bam" - - bam_transcript: - type: file - description: Output BAM file of transcriptome alignment (optional) - pattern: "*toTranscriptome.out.bam" - - bam_unsorted: - type: file - description: Unsorted BAM file of read alignments (optional) - pattern: "*Aligned.unsort.out.bam" - - fastq: - type: file - description: Unmapped FastQ files (optional) - pattern: "*fastq.gz" - - tab: - type: file - description: STAR output tab file(s) (optional) - pattern: "*.tab" - - junction: - type: file - description: STAR chimeric junction output file (optional) - pattern: "*.out.junction" - - wig: - type: file - description: STAR output wiggle format file(s) (optional) - pattern: "*.wig" - - bedgraph: - type: file - description: STAR output bedGraph format file(s) (optional) - pattern: "*.bg" - -authors: - - "@kevinmenden" - - "@drpatelh" - - "@praveenraj2018" diff --git a/modules/nf-core/star/align/star-align.diff b/modules/nf-core/star/align/star-align.diff deleted file mode 100644 index b6abf71..0000000 --- a/modules/nf-core/star/align/star-align.diff +++ /dev/null @@ -1,71 +0,0 @@ -Changes in module 'nf-core/star/align' ---- modules/nf-core/star/align/main.nf -+++ modules/nf-core/star/align/main.nf -@@ -2,7 +2,7 @@ - tag "$meta.id" - label 'process_high' - -- conda "bioconda::star=2.7.10a bioconda::samtools=1.16.1 conda-forge::gawk=5.1.0" -+ conda "bioconda::star=2.7.9a bioconda::samtools=1.16.1 conda-forge::gawk=5.1.0" - container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:1df389393721fc66f3fd8778ad938ac711951107-0' : - 'biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:1df389393721fc66f3fd8778ad938ac711951107-0' }" -@@ -11,6 +11,7 @@ - tuple val(meta), path(reads, stageAs: "input*/*") - path index - path gtf -+ path whitelist - val star_ignore_sjdbgtf - val seq_platform - val seq_center -@@ -25,6 +26,7 @@ - tuple val(meta), path('*sortedByCoord.out.bam') , optional:true, emit: bam_sorted - tuple val(meta), path('*toTranscriptome.out.bam'), optional:true, emit: bam_transcript - tuple val(meta), path('*Aligned.unsort.out.bam') , optional:true, emit: bam_unsorted -+ tuple val(meta), path('*.Solo.out') , emit: counts - tuple val(meta), path('*fastq.gz') , optional:true, emit: fastq - tuple val(meta), path('*.tab') , optional:true, emit: tab - tuple val(meta), path('*.SJ.out.tab') , optional:true, emit: spl_junc_tab -@@ -48,14 +50,19 @@ - def attrRG = args.contains("--outSAMattrRGline") ? "" : "--outSAMattrRGline 'ID:$prefix' $seq_center 'SM:$prefix' $seq_platform" - def out_sam_type = (args.contains('--outSAMtype')) ? '' : '--outSAMtype BAM Unsorted' - def mv_unsorted_bam = (args.contains('--outSAMtype BAM Unsorted SortedByCoordinate')) ? "mv ${prefix}.Aligned.out.bam ${prefix}.Aligned.unsort.out.bam" : '' -+ -+ // StarSolo -+ def solo_whitelist = whitelist ? "--soloCBwhitelist $whitelist" : '' -+ def in_reads = solo_whitelist != '' ? "${reads2.join(',')} ${reads1.join(',')}" : "${reads1.join(',')} ${reads2.join(',')}" - """ - STAR \\ - --genomeDir $index \\ -- --readFilesIn ${reads1.join(",")} ${reads2.join(",")} \\ -+ --readFilesIn $in_reads \\ - --runThreadN $task.cpus \\ - --outFileNamePrefix $prefix. \\ - $out_sam_type \\ - $ignore_gtf \\ -+ $solo_whitelist \\ - $attrRG \\ - $args - -@@ -68,6 +75,11 @@ - if [ -f ${prefix}.Unmapped.out.mate2 ]; then - mv ${prefix}.Unmapped.out.mate2 ${prefix}.unmapped_2.fastq - gzip ${prefix}.unmapped_2.fastq -+ fi -+ -+ if [ -d ${prefix}.Solo.out ]; then -+ # Backslashes still need to be escaped (https://github.com/nextflow-io/nextflow/issues/67) -+ find ${prefix}.Solo.out \\( -name "*.tsv" -o -name "*.mtx" \\) -exec gzip {} \\; - fi - - cat <<-END_VERSIONS > versions.yml -@@ -86,6 +98,7 @@ - touch ${prefix}.Log.out - touch ${prefix}.Log.progress.out - touch ${prefix}.sortedByCoord.out.bam -+ mkdir ${prefix}.Solo.out - touch ${prefix}.toTranscriptome.out.bam - touch ${prefix}.Aligned.unsort.out.bam - touch ${prefix}.Aligned.sortedByCoord.out.bam - -************************************************************ diff --git a/modules/nf-core/star/genomegenerate/environment.yml b/modules/nf-core/star/genomegenerate/environment.yml new file mode 100644 index 0000000..7c57530 --- /dev/null +++ b/modules/nf-core/star/genomegenerate/environment.yml @@ -0,0 +1,9 @@ +channels: + - conda-forge + - bioconda + +dependencies: + - bioconda::htslib=1.20 + - bioconda::samtools=1.20 + - bioconda::star=2.7.11b + - conda-forge::gawk=5.1.0 diff --git a/modules/nf-core/star/genomegenerate/main.nf b/modules/nf-core/star/genomegenerate/main.nf index 2407d00..8f0c67e 100644 --- a/modules/nf-core/star/genomegenerate/main.nf +++ b/modules/nf-core/star/genomegenerate/main.nf @@ -2,26 +2,27 @@ process STAR_GENOMEGENERATE { tag "$fasta" label 'process_high' - conda "bioconda::star=2.7.10a bioconda::samtools=1.16.1 conda-forge::gawk=5.1.0" + conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:1df389393721fc66f3fd8778ad938ac711951107-0' : - 'biocontainers/mulled-v2-1fa26d1ce03c295fe2fdcf85831a92fbcbd7e8c2:1df389393721fc66f3fd8778ad938ac711951107-0' }" + 'https://community-cr-prod.seqera.io/docker/registry/v2/blobs/sha256/b4/b425bc2a95806d878993f9a66dae3ae80ac2dafff4c208c5ae01b7a90a32fa91/data' : + 'community.wave.seqera.io/library/star_samtools_htslib_gawk:10c6e8c834460019' }" input: - path fasta - path gtf + tuple val(meta), path(fasta) + tuple val(meta2), path(gtf) output: - path "star" , emit: index - path "versions.yml", emit: versions + tuple val(meta), path("star") , emit: index + path "versions.yml" , emit: versions when: task.ext.when == null || task.ext.when script: - def args = task.ext.args ?: '' - def args_list = args.tokenize() - def memory = task.memory ? "--limitGenomeGenerateRAM ${task.memory.toBytes() - 100000000}" : '' + def args = task.ext.args ?: '' + def args_list = args.tokenize() + def memory = task.memory ? "--limitGenomeGenerateRAM ${task.memory.toBytes() - 100000000}" : '' + def include_gtf = gtf ? "--sjdbGTFfile $gtf" : '' if (args_list.contains('--genomeSAindexNbases')) { """ mkdir star @@ -29,7 +30,7 @@ process STAR_GENOMEGENERATE { --runMode genomeGenerate \\ --genomeDir star/ \\ --genomeFastaFiles $fasta \\ - --sjdbGTFfile $gtf \\ + $include_gtf \\ --runThreadN $task.cpus \\ $memory \\ $args @@ -51,7 +52,7 @@ process STAR_GENOMEGENERATE { --runMode genomeGenerate \\ --genomeDir star/ \\ --genomeFastaFiles $fasta \\ - --sjdbGTFfile $gtf \\ + $include_gtf \\ --runThreadN $task.cpus \\ --genomeSAindexNbases \$NUM_BASES \\ $memory \\ @@ -67,30 +68,52 @@ process STAR_GENOMEGENERATE { } stub: - """ - mkdir star - touch star/Genome - touch star/Log.out - touch star/SA - touch star/SAindex - touch star/chrLength.txt - touch star/chrName.txt - touch star/chrNameLength.txt - touch star/chrStart.txt - touch star/exonGeTrInfo.tab - touch star/exonInfo.tab - touch star/geneInfo.tab - touch star/genomeParameters.txt - touch star/sjdbInfo.txt - touch star/sjdbList.fromGTF.out.tab - touch star/sjdbList.out.tab - touch star/transcriptInfo.tab + if (gtf) { + """ + mkdir star + touch star/Genome + touch star/Log.out + touch star/SA + touch star/SAindex + touch star/chrLength.txt + touch star/chrName.txt + touch star/chrNameLength.txt + touch star/chrStart.txt + touch star/exonGeTrInfo.tab + touch star/exonInfo.tab + touch star/geneInfo.tab + touch star/genomeParameters.txt + touch star/sjdbInfo.txt + touch star/sjdbList.fromGTF.out.tab + touch star/sjdbList.out.tab + touch star/transcriptInfo.tab - cat <<-END_VERSIONS > versions.yml - "${task.process}": - star: \$(STAR --version | sed -e "s/STAR_//g") - samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') - gawk: \$(echo \$(gawk --version 2>&1) | sed 's/^.*GNU Awk //; s/, .*\$//') - END_VERSIONS - """ + cat <<-END_VERSIONS > versions.yml + "${task.process}": + star: \$(STAR --version | sed -e "s/STAR_//g") + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + gawk: \$(echo \$(gawk --version 2>&1) | sed 's/^.*GNU Awk //; s/, .*\$//') + END_VERSIONS + """ + } else { + """ + mkdir star + touch star/Genome + touch star/Log.out + touch star/SA + touch star/SAindex + touch star/chrLength.txt + touch star/chrName.txt + touch star/chrNameLength.txt + touch star/chrStart.txt + touch star/genomeParameters.txt + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + star: \$(STAR --version | sed -e "s/STAR_//g") + samtools: \$(echo \$(samtools --version 2>&1) | sed 's/^.*samtools //; s/Using.*\$//') + gawk: \$(echo \$(gawk --version 2>&1) | sed 's/^.*GNU Awk //; s/, .*\$//') + END_VERSIONS + """ + } } diff --git a/modules/nf-core/star/genomegenerate/meta.yml b/modules/nf-core/star/genomegenerate/meta.yml index 8181157..33c1f65 100644 --- a/modules/nf-core/star/genomegenerate/meta.yml +++ b/modules/nf-core/star/genomegenerate/meta.yml @@ -14,24 +14,43 @@ tools: manual: https://github.com/alexdobin/STAR/blob/master/doc/STARmanual.pdf doi: 10.1093/bioinformatics/bts635 licence: ["MIT"] + identifier: biotools:star input: - - fasta: - type: file - description: Fasta file of the reference genome - - gtf: - type: file - description: GTF file of the reference genome - + - - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - fasta: + type: file + description: Fasta file of the reference genome + - - meta2: + type: map + description: | + Groovy Map containing reference information + e.g. [ id:'test' ] + - gtf: + type: file + description: GTF file of the reference genome output: - index: - type: directory - description: Folder containing the star index files - pattern: "star" + - meta: + type: map + description: | + Groovy Map containing sample information + e.g. [ id:'test', single_end:false ] + - star: + type: directory + description: Folder containing the star index files + pattern: "star" - versions: - type: file - description: File containing software versions - pattern: "versions.yml" - + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" authors: - "@kevinmenden" - "@drpatelh" +maintainers: + - "@kevinmenden" + - "@drpatelh" diff --git a/modules/nf-core/star/genomegenerate/tests/main.nf.test b/modules/nf-core/star/genomegenerate/tests/main.nf.test new file mode 100644 index 0000000..4d619c4 --- /dev/null +++ b/modules/nf-core/star/genomegenerate/tests/main.nf.test @@ -0,0 +1,114 @@ +nextflow_process { + + name "Test Process STAR_GENOMEGENERATE" + script "../main.nf" + process "STAR_GENOMEGENERATE" + tag "modules" + tag "modules_nfcore" + tag "star" + tag "star/genomegenerate" + + test("fasta_gtf") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString(), + process.out.versions) + .match() } + ) + } + } + + test("fasta") { + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ [], [] ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + file(process.out.index[0][1]).listFiles().collect { it.getName() }.sort().toString(), + process.out.versions + ).match() } + ) + } + } + + test("fasta_gtf_stub") { + + options '-stub' + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("fasta_stub") { + + options '-stub' + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ [], [] ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } +} diff --git a/modules/nf-core/star/genomegenerate/tests/main.nf.test.snap b/modules/nf-core/star/genomegenerate/tests/main.nf.test.snap new file mode 100644 index 0000000..3db2567 --- /dev/null +++ b/modules/nf-core/star/genomegenerate/tests/main.nf.test.snap @@ -0,0 +1,148 @@ +{ + "fasta_gtf": { + "content": [ + "[Genome, Log.out, SA, SAindex, chrLength.txt, chrName.txt, chrNameLength.txt, chrStart.txt, exonGeTrInfo.tab, exonInfo.tab, geneInfo.tab, genomeParameters.txt, sjdbInfo.txt, sjdbList.fromGTF.out.tab, sjdbList.out.tab, transcriptInfo.tab]", + [ + "versions.yml:md5,14b05d04c9eca568e9ed4888aaf26fa6" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-19T20:37:47.410432728" + }, + "fasta_gtf_stub": { + "content": [ + { + "0": [ + [ + { + "id": "test_fasta" + }, + [ + "Genome:md5,d41d8cd98f00b204e9800998ecf8427e", + "Log.out:md5,d41d8cd98f00b204e9800998ecf8427e", + "SA:md5,d41d8cd98f00b204e9800998ecf8427e", + "SAindex:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrName.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrNameLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrStart.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "exonGeTrInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "exonInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "geneInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "genomeParameters.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sjdbInfo.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sjdbList.fromGTF.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "sjdbList.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "transcriptInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "1": [ + "versions.yml:md5,14b05d04c9eca568e9ed4888aaf26fa6" + ], + "index": [ + [ + { + "id": "test_fasta" + }, + [ + "Genome:md5,d41d8cd98f00b204e9800998ecf8427e", + "Log.out:md5,d41d8cd98f00b204e9800998ecf8427e", + "SA:md5,d41d8cd98f00b204e9800998ecf8427e", + "SAindex:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrName.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrNameLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrStart.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "exonGeTrInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "exonInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "geneInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "genomeParameters.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sjdbInfo.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "sjdbList.fromGTF.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "sjdbList.out.tab:md5,d41d8cd98f00b204e9800998ecf8427e", + "transcriptInfo.tab:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "versions": [ + "versions.yml:md5,14b05d04c9eca568e9ed4888aaf26fa6" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-19T20:38:09.165234795" + }, + "fasta_stub": { + "content": [ + { + "0": [ + [ + { + "id": "test_fasta" + }, + [ + "Genome:md5,d41d8cd98f00b204e9800998ecf8427e", + "Log.out:md5,d41d8cd98f00b204e9800998ecf8427e", + "SA:md5,d41d8cd98f00b204e9800998ecf8427e", + "SAindex:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrName.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrNameLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrStart.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "genomeParameters.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "1": [ + "versions.yml:md5,14b05d04c9eca568e9ed4888aaf26fa6" + ], + "index": [ + [ + { + "id": "test_fasta" + }, + [ + "Genome:md5,d41d8cd98f00b204e9800998ecf8427e", + "Log.out:md5,d41d8cd98f00b204e9800998ecf8427e", + "SA:md5,d41d8cd98f00b204e9800998ecf8427e", + "SAindex:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrName.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrNameLength.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "chrStart.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "genomeParameters.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "versions": [ + "versions.yml:md5,14b05d04c9eca568e9ed4888aaf26fa6" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-19T20:38:19.530862664" + }, + "fasta": { + "content": [ + "[Genome, Log.out, SA, SAindex, chrLength.txt, chrName.txt, chrNameLength.txt, chrStart.txt, genomeParameters.txt]", + [ + "versions.yml:md5,14b05d04c9eca568e9ed4888aaf26fa6" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-19T20:37:58.667436398" + } +} \ No newline at end of file diff --git a/modules/nf-core/star/genomegenerate/tests/tags.yml b/modules/nf-core/star/genomegenerate/tests/tags.yml new file mode 100644 index 0000000..79f619b --- /dev/null +++ b/modules/nf-core/star/genomegenerate/tests/tags.yml @@ -0,0 +1,2 @@ +star/genomegenerate: + - modules/nf-core/star/genomegenerate/** diff --git a/modules/nf-core/star/starsolo/environment.yml b/modules/nf-core/star/starsolo/environment.yml new file mode 100644 index 0000000..7967c6a --- /dev/null +++ b/modules/nf-core/star/starsolo/environment.yml @@ -0,0 +1,5 @@ +channels: + - conda-forge + - bioconda +dependencies: + - bioconda::star=2.7.11b diff --git a/modules/nf-core/star/starsolo/main.nf b/modules/nf-core/star/starsolo/main.nf new file mode 100644 index 0000000..94a9e2d --- /dev/null +++ b/modules/nf-core/star/starsolo/main.nf @@ -0,0 +1,95 @@ +process STARSOLO { + tag "$meta.id" + label 'process_high' + + conda "${moduleDir}/environment.yml" + container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? + 'https://depot.galaxyproject.org/singularity/star:2.7.11b--h43eeafb_2': + 'biocontainers/star:2.7.11b--h43eeafb_2' }" + + input: + tuple val(meta), val(solotype), path(reads) + path(opt_whitelist) + tuple val(meta2), path(index) + + output: + tuple val(meta), path('*.Solo.out') , emit: counts + tuple val(meta), path('*Log.final.out') , emit: log_final + tuple val(meta), path('*Log.out') , emit: log_out + tuple val(meta), path('*Log.progress.out') , emit: log_progress + tuple val(meta), path('*/Gene/Summary.csv') , emit: summary + path "versions.yml" , emit: versions + when: + task.ext.when == null || task.ext.when + + script: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + def (forward, reverse) = reads.collate(2).transpose() + def zcat = reads[0].getExtension() == "gz" ? "--readFilesCommand zcat": "" + + // Handle solotype argument logic + switch(solotype) { + case "CB_UMI_Simple": + solotype_args = meta.umi_len ? "--soloUMIlen ${meta.umi_len} " : ""; + solotype_args = solotype_args + (opt_whitelist.name != 'NO_FILE' ? "--soloCBwhitelist ${opt_whitelist} " : "--soloCBwhitelist None "); + solotype_args = solotype_args + (meta.umi_start ? "--soloUMIstart ${meta.umi_start} " : ""); + solotype_args = solotype_args + (meta.cb_len ? "--soloCBlen ${meta.cb_len} " : ""); + solotype_args = solotype_args + (meta.cb_start ? "--soloCBstart ${meta.cb_start} " : ""); + solotype_args = solotype_args + (meta.barcode_len ? "--soloBarcodeReadLength ${meta.barcode_len} " : ""); + solotype_args = solotype_args + (meta.barcode_mate ? "--soloBarcodeMate ${meta.barcode_mate} " : ""); + break + case "CB_UMI_Complex": + solotype_args = meta.cb_position ? "--soloCBposition ${meta.cb_position}" : ""; + solotype_args = solotype_args + (opt_whitelist.name != 'NO_FILE' ? "--soloCBwhitelist ${opt_whitelist} " : "--soloCBwhitelist None "); + solotype_args = solotype_args + (meta.umi_position ? "--soloUMIposition ${meta.umi_position} " : ""); + solotype_args = solotype_args + (meta.adapter_seq ? "--soloAdapterSequence ${meta.adapter_seq} " : ""); + solotype_args = solotype_args + (meta.max_mismatch_adapter ? "--soloAdapterMismatchesNmax ${meta.max_mismatch_adapter} " : ""); + break + case "SmartSeq": + solotype_args = "--soloUMIdedup Exact "; + solotype_args = solotype_args + (meta.strandedness ? "--soloStrand ${meta.strandedness} " : ""); + solotype_args = solotype_args + "--outSAMattrRGline ID:${prefix} "; + break + default: + log.warn("Unknown output solotype (${solotype})"); + break + } + + """ + STAR \\ + --genomeDir $index \\ + --readFilesIn ${reverse.join( "," )} ${forward.join( "," )} \\ + --runThreadN $task.cpus \\ + --outFileNamePrefix $prefix. \\ + --soloType $solotype \\ + $zcat \\ + $solotype_args \\ + $args + + if [ -d ${prefix}.Solo.out ]; then + find ${prefix}.Solo.out \\( -name "*.tsv" -o -name "*.mtx" \\) -exec gzip {} \\; + fi + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + star: \$(STAR --version | sed -e "s/STAR_//g") + END_VERSIONS + """ + + stub: + def args = task.ext.args ?: '' + def prefix = task.ext.prefix ?: "${meta.id}" + """ + mkdir -p ${prefix}.Solo.out/Gene + touch ${prefix}.Log.final.out + touch ${prefix}.Log.out + touch ${prefix}.Log.progress.out + touch ${prefix}.Solo.out/Gene/Summary.csv + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + star: \$(STAR --version | sed -e "s/STAR_//g") + END_VERSIONS + """ +} diff --git a/modules/nf-core/star/starsolo/meta.yml b/modules/nf-core/star/starsolo/meta.yml new file mode 100644 index 0000000..d9297f0 --- /dev/null +++ b/modules/nf-core/star/starsolo/meta.yml @@ -0,0 +1,131 @@ +name: "starsolo" +description: Create a counts matrix for single-cell data using STARSolo, handling + cell barcodes and UMI information. +keywords: + - align + - count + - genome + - reference +tools: + - "starsolo": + description: "Mapping, demultiplexing and quantification for single cell RNA-seq." + homepage: "https://github.com/alexdobin/STAR/" + documentation: "https://github.com/alexdobin/STAR/blob/master/docs/STARsolo.md" + doi: "10.1101/2021.05.05.442755" + licence: ["MIT"] + identifier: biotools:star +input: + - - meta: + type: map + description: | + Groovy Map containing sample information. + Here, you should add all the specific barcode/umi + information for each sample. + e.g. `[ id:'test_starsolo', umi_len:'12', cb_start:1 ]` + - solotype: + type: string + description: | + Type of single-cell library. + It can be CB_UMI_Simple for most common ones such as 10xv2 and 10xv3, + CB_UMI_Complex for method such as inDrop and SmartSeq for SMART-Seq. + - reads: + type: file + description: | + List of input FastQ files of size 1 and 2 for single-end and paired-end data, + respectively. + - - opt_whitelist: + type: file + description: Optional whitelist file + - - meta2: + type: map + description: Groovy Map containing the STAR index information. + - index: + type: directory + description: STAR genome index + pattern: "star" +output: + - counts: + - meta: + type: map + description: | + Groovy Map containing sample information. + Here, you should add all the specific barcode/umi + information for each sample. + e.g. `[ id:'test_starsolo', umi_len:'12', cb_start:1 ]` + - "*.Solo.out": + type: file + description: STARSolo counts matrix + pattern: "*.Solo.out" + - log_final: + - meta: + type: map + description: | + Groovy Map containing sample information. + Here, you should add all the specific barcode/umi + information for each sample. + e.g. `[ id:'test_starsolo', umi_len:'12', cb_start:1 ]` + - "*Log.final.out": + type: file + description: STAR final log file + pattern: "*Log.final.out" + - log_out: + - meta: + type: map + description: | + Groovy Map containing sample information. + Here, you should add all the specific barcode/umi + information for each sample. + e.g. `[ id:'test_starsolo', umi_len:'12', cb_start:1 ]` + - "*Log.out": + type: file + description: STAR lot out file + pattern: "*Log.out" + - log_progress: + - meta: + type: map + description: | + Groovy Map containing sample information. + Here, you should add all the specific barcode/umi + information for each sample. + e.g. `[ id:'test_starsolo', umi_len:'12', cb_start:1 ]` + - "*Log.progress.out": + type: file + description: STAR log progress file + pattern: "*Log.progress.out" + - summary: + - meta: + type: map + description: | + Groovy Map containing sample information. + Here, you should add all the specific barcode/umi + information for each sample. + e.g. `[ id:'test_starsolo', umi_len:'12', cb_start:1 ]` + - "*/Gene/Summary.csv": + type: file + description: STARSolo metrics summary CSV file. + pattern: "*/Gene/Summary.csv" + - versions: + - versions.yml: + type: file + description: File containing software versions + pattern: "versions.yml" +authors: + - "@kevinmenden" + - "@ggabernet" + - "@grst" + - "@fmalmeida" + - "@rhreynolds" + - "@apeltzer" + - "@vivian-chen16" + - "@maxulysse" + - "@joaodemeirelles" +maintainers: + - "@kevinmenden" + - "@ggabernet" + - "@grst" + - "@fmalmeida" + - "@rhreynolds" + - "@apeltzer" + - "@vivian-chen16" + - "@maxulysse" + - "@joaodemeirelles" diff --git a/modules/nf-core/star/starsolo/tests/NO_FILE b/modules/nf-core/star/starsolo/tests/NO_FILE new file mode 100644 index 0000000..e69de29 diff --git a/modules/nf-core/star/starsolo/tests/main.nf.test b/modules/nf-core/star/starsolo/tests/main.nf.test new file mode 100644 index 0000000..e10107d --- /dev/null +++ b/modules/nf-core/star/starsolo/tests/main.nf.test @@ -0,0 +1,114 @@ +nextflow_process { + + name "Test Process STAR_STARSOLO" + script "../main.nf" + process "STARSOLO" + + tag "modules" + tag "modules_nfcore" + tag "star" + tag "star/starsolo" + tag "star/genomegenerate" + + test("homo_sapiens - CB_UMI_Simple") { + + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', umi_len:'12' ], + 'CB_UMI_Simple', + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/10xgenomics/cellranger/5k_cmvpos_tcells/fastqs/gex_1/subsampled_5k_human_antiCMV_T_TBNK_connect_GEX_1_S1_L001_R1_001.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/10xgenomics/cellranger/5k_cmvpos_tcells/fastqs/gex_1/subsampled_5k_human_antiCMV_T_TBNK_connect_GEX_1_S1_L001_R2_001.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = file('./NO_FILE') + input[2] = STAR_GENOMEGENERATE.out.index + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot( + process.out.counts, + file(process.out.log_final[0][1]).name, + file(process.out.log_out[0][1]).name, + file(process.out.log_progress[0][1]).name, + process.out.summary, + process.out.versions + ).match() } + ) + } + + } + + test("homo_sapiens - CB_UMI_Simple - stub") { + + options "-stub" + + setup { + run("STAR_GENOMEGENERATE") { + script "../../../star/genomegenerate/main.nf" + process { + """ + input[0] = Channel.of([ + [ id:'test_fasta' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ] + ]) + input[1] = Channel.of([ + [ id:'test_gtf' ], + [ file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.gtf', checkIfExists: true) ] + ]) + """ + } + } + } + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', umi_len:'12' ], + 'CB_UMI_Simple', + [ + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/10xgenomics/cellranger/5k_cmvpos_tcells/fastqs/gex_1/subsampled_5k_human_antiCMV_T_TBNK_connect_GEX_1_S1_L001_R1_001.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/10xgenomics/cellranger/5k_cmvpos_tcells/fastqs/gex_1/subsampled_5k_human_antiCMV_T_TBNK_connect_GEX_1_S1_L001_R2_001.fastq.gz', checkIfExists: true) + ] + ]) + input[1] = file('./NO_FILE') + input[2] = STAR_GENOMEGENERATE.out.index + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/star/starsolo/tests/main.nf.test.snap b/modules/nf-core/star/starsolo/tests/main.nf.test.snap new file mode 100644 index 0000000..f2d99d9 --- /dev/null +++ b/modules/nf-core/star/starsolo/tests/main.nf.test.snap @@ -0,0 +1,167 @@ +{ + "homo_sapiens - CB_UMI_Simple - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "umi_len": "12" + }, + [ + [ + "Summary.csv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ] + ], + "1": [ + [ + { + "id": "test", + "umi_len": "12" + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "umi_len": "12" + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + [ + { + "id": "test", + "umi_len": "12" + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + [ + { + "id": "test", + "umi_len": "12" + }, + "Summary.csv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "5": [ + "versions.yml:md5,7c881aece4a5a4755000cd4d37c78c3d" + ], + "counts": [ + [ + { + "id": "test", + "umi_len": "12" + }, + [ + [ + "Summary.csv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ] + ], + "log_final": [ + [ + { + "id": "test", + "umi_len": "12" + }, + "test.Log.final.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_out": [ + [ + { + "id": "test", + "umi_len": "12" + }, + "test.Log.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "log_progress": [ + [ + { + "id": "test", + "umi_len": "12" + }, + "test.Log.progress.out:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "summary": [ + [ + { + "id": "test", + "umi_len": "12" + }, + "Summary.csv:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,7c881aece4a5a4755000cd4d37c78c3d" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-19T20:53:24.370452855" + }, + "homo_sapiens - CB_UMI_Simple": { + "content": [ + [ + [ + { + "id": "test", + "umi_len": "12" + }, + [ + "Barcodes.stats:md5,4c9c5e67e4f55e6eebd040eba4c9224b", + [ + "Features.stats:md5,7accf6498d4d910523ae66056a1c7e06", + "Summary.csv:md5,84d031c3083ae44cfa1984733b4875b7", + "UMIperCellSorted.txt:md5,65eab5a93b8411094193a643f5d2ab37", + [ + "barcodes.tsv.gz:md5,285d09e1edce3b03c3304d72ec40d71b", + "features.tsv.gz:md5,7f05863a60b0ef33073ca1833f27c497", + "matrix.mtx.gz:md5,83aab899e08867dda0dac194a37dd6bf" + ], + [ + "barcodes.tsv.gz:md5,285d09e1edce3b03c3304d72ec40d71b", + "features.tsv.gz:md5,7f05863a60b0ef33073ca1833f27c497", + "matrix.mtx.gz:md5,83aab899e08867dda0dac194a37dd6bf" + ] + ] + ] + ] + ], + "test.Log.final.out", + "test.Log.out", + "test.Log.progress.out", + [ + [ + { + "id": "test", + "umi_len": "12" + }, + "Summary.csv:md5,84d031c3083ae44cfa1984733b4875b7" + ] + ], + [ + "versions.yml:md5,7c881aece4a5a4755000cd4d37c78c3d" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.4" + }, + "timestamp": "2024-10-19T20:53:11.226367859" + } +} \ No newline at end of file diff --git a/modules/nf-core/star/starsolo/tests/tags.yml b/modules/nf-core/star/starsolo/tests/tags.yml new file mode 100644 index 0000000..2ca29a1 --- /dev/null +++ b/modules/nf-core/star/starsolo/tests/tags.yml @@ -0,0 +1,2 @@ +star/starsolo: + - "modules/nf-core/star/starsolo/**" diff --git a/nextflow.config b/nextflow.config index 71c406b..32427b7 100644 --- a/nextflow.config +++ b/nextflow.config @@ -10,18 +10,24 @@ params { // Input options + fasta = null + gtf = null input = null + bowtie2_index = null + star_index = null + aligner = 'bowtie2_star' // References - genome = 'mm10' - genomes = [:] - genomes_base = "${params.outdir}/references" - build_references = false - velocity = false + genome = null + igenomes_base = 's3://ngi-igenomes/igenomes/' + igenomes_ignore = true + + // Other read_length = 75 // QC skip_qc = false + skip_fastqc = false // MultiQC options multiqc_config = null @@ -31,168 +37,152 @@ params { multiqc_methods_description = null // Boilerplate options - outdir = null - publish_dir_mode = 'copy' - email = null - email_on_fail = null - plaintext_email = false - monochrome_logs = false - hook_url = null - help = false - version = false + outdir = null + publish_dir_mode = 'copy' + email = null + email_on_fail = null + plaintext_email = false + monochrome_logs = false + hook_url = null + help = false + help_full = false + show_hidden = false + version = false + pipelines_testdata_base_path = 'https://raw.githubusercontent.com/nf-core/test-datasets/' // Config options config_profile_name = null config_profile_description = null + custom_config_version = 'master' custom_config_base = "https://raw.githubusercontent.com/nf-core/configs/${params.custom_config_version}" config_profile_contact = null config_profile_url = null - - // Max resource options - // Defaults only, expecting to be overwritten - max_memory = '128.GB' - max_cpus = 16 - max_time = '240.h' - // Schema validation default options - validationFailUnrecognisedParams = false - validationLenientMode = false - validationSchemaIgnoreParams = 'genomes' - validationShowHiddenParams = false - validate_params = true - + validate_params = true } // Load base.config by default for all pipelines includeConfig 'conf/base.config' -// Load modules.config for DSL2 module specific options -includeConfig 'conf/modules.config' - -// Load genomes.config -includeConfig 'conf/genomes.config' - -// Load nf-core custom profiles from different Institutions -try { - includeConfig "${params.custom_config_base}/nfcore_custom.config" -} catch (Exception e) { - System.err.println("WARNING: Could not load nf-core/config profiles: ${params.custom_config_base}/nfcore_custom.config") -} - -// Load nf-core/marsseq custom profiles from different institutions. -// Warning: Uncomment only if a pipeline-specific instititutional config already exists on nf-core/configs! -// try { -// includeConfig "${params.custom_config_base}/pipeline/marsseq.config" -// } catch (Exception e) { -// System.err.println("WARNING: Could not load nf-core/config/marsseq profiles: ${params.custom_config_base}/pipeline/marsseq.config") -// } profiles { debug { - dumpHashes = true - process.beforeScript = 'echo $HOSTNAME' - cleanup = false + dumpHashes = true + process.beforeScript = 'echo $HOSTNAME' + cleanup = false + nextflow.enable.configProcessNamesValidation = true } conda { - conda.enabled = true - docker.enabled = false - singularity.enabled = false - podman.enabled = false - shifter.enabled = false - charliecloud.enabled = false - apptainer.enabled = false + conda.enabled = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + conda.channels = ['conda-forge', 'bioconda'] + apptainer.enabled = false } mamba { - conda.enabled = true - conda.useMamba = true - docker.enabled = false - singularity.enabled = false - podman.enabled = false - shifter.enabled = false - charliecloud.enabled = false - apptainer.enabled = false + conda.enabled = true + conda.useMamba = true + docker.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + apptainer.enabled = false } docker { - docker.enabled = true - docker.userEmulation = true - conda.enabled = false - singularity.enabled = false - podman.enabled = false - shifter.enabled = false - charliecloud.enabled = false - apptainer.enabled = false + docker.enabled = true + conda.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + apptainer.enabled = false + docker.runOptions = '-u $(id -u):$(id -g)' } arm { - docker.runOptions = '-u $(id -u):$(id -g) --platform=linux/amd64' + docker.runOptions = '-u $(id -u):$(id -g) --platform=linux/amd64' } singularity { - singularity.enabled = true - singularity.autoMounts = true - conda.enabled = false - docker.enabled = false - podman.enabled = false - shifter.enabled = false - charliecloud.enabled = false - apptainer.enabled = false + singularity.enabled = true + singularity.autoMounts = true + conda.enabled = false + docker.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + apptainer.enabled = false } podman { - podman.enabled = true - conda.enabled = false - docker.enabled = false - singularity.enabled = false - shifter.enabled = false - charliecloud.enabled = false - apptainer.enabled = false + podman.enabled = true + conda.enabled = false + docker.enabled = false + singularity.enabled = false + shifter.enabled = false + charliecloud.enabled = false + apptainer.enabled = false } shifter { - shifter.enabled = true - conda.enabled = false - docker.enabled = false - singularity.enabled = false - podman.enabled = false - charliecloud.enabled = false - apptainer.enabled = false + shifter.enabled = true + conda.enabled = false + docker.enabled = false + singularity.enabled = false + podman.enabled = false + charliecloud.enabled = false + apptainer.enabled = false } charliecloud { - charliecloud.enabled = true - conda.enabled = false - docker.enabled = false - singularity.enabled = false - podman.enabled = false - shifter.enabled = false - apptainer.enabled = false + charliecloud.enabled = true + conda.enabled = false + docker.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + apptainer.enabled = false } apptainer { - apptainer.enabled = true - conda.enabled = false - docker.enabled = false - singularity.enabled = false - podman.enabled = false - shifter.enabled = false - charliecloud.enabled = false + apptainer.enabled = true + apptainer.autoMounts = true + conda.enabled = false + docker.enabled = false + singularity.enabled = false + podman.enabled = false + shifter.enabled = false + charliecloud.enabled = false + } + wave { + apptainer.ociAutoPull = true + singularity.ociAutoPull = true + wave.enabled = true + wave.freeze = true + wave.strategy = 'conda,container' } gitpod { - executor.name = 'local' - executor.cpus = 16 - executor.memory = 60.GB + executor.name = 'local' + executor.cpus = 4 + executor.memory = 8.GB } test { includeConfig 'conf/test.config' } test_full { includeConfig 'conf/test_full.config' } } -// Set default registry for Apptainer, Docker, Podman and Singularity independent of -profile -// Will not be used unless Apptainer / Docker / Podman / Singularity are enabled +// Load nf-core custom profiles from different Institutions +includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${params.custom_config_base}/nfcore_custom.config" : "/dev/null" + +// Set default registry for Apptainer, Docker, Podman, Charliecloud and Singularity independent of -profile +// Will not be used unless Apptainer / Docker / Podman / Charliecloud / Singularity are enabled // Set to your registry if you have a mirror of containers -apptainer.registry = 'quay.io' -docker.registry = 'quay.io' -podman.registry = 'quay.io' -singularity.registry = 'quay.io' +apptainer.registry = 'quay.io' +docker.registry = 'quay.io' +podman.registry = 'quay.io' +singularity.registry = 'quay.io' +charliecloud.registry = 'quay.io' -// Nextflow plugins -plugins { - id 'nf-validation' // Validation of pipeline parameters and creation of an input channel from a sample sheet -} +// Load igenomes.config if required +includeConfig !params.igenomes_ignore ? 'conf/igenomes.config' : 'conf/igenomes_ignored.config' // Export these variables to prevent local Python/R libraries from conflicting with those in the container // The JULIA depot path has been adjusted to a fixed path `/usr/local/share/julia` that needs to be used for packages in the container. @@ -205,8 +195,18 @@ env { JULIA_DEPOT_PATH = "/usr/local/share/julia" } -// Capture exit codes from upstream processes when piping -process.shell = ['/bin/bash', '-euo', 'pipefail'] +// Set bash options +process.shell = """\ +bash + +set -e # Exit if a tool returns a non-zero status/exit code +set -u # Treat unset variables and parameters as an error +set -o pipefail # Returns the status of the last command to exit with a non-zero status or zero if all successfully execute +set -C # No clobber - prevent output redirection from overwriting files. +""" + +// Disable process selector warnings by default. Use debug profile to enable warnings. +nextflow.enable.configProcessNamesValidation = false def trace_timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss') timeline { @@ -232,43 +232,46 @@ manifest { homePage = 'https://github.com/nf-core/marsseq' description = """MARS-seq v2 preprocessing pipeline""" mainScript = 'main.nf' - nextflowVersion = '!>=23.04.0' - version = '1.0.3' - doi = '10.1101/2023.06.28.546862, 10.5281/zenodo.8081210' + nextflowVersion = '!>=24.04.2' + version = '1.1.0' + doi = '10.1093/bioadv/vbaf089, 10.5281/zenodo.8081210' } -// Load modules.config for DSL2 module specific options -includeConfig 'conf/modules.config' +// Nextflow plugins +plugins { + id 'nf-schema@2.1.1' // Validation of pipeline parameters and creation of an input channel from a sample sheet +} -// Function to ensure that resource requirements don't go beyond -// a maximum limit -def check_max(obj, type) { - if (type == 'memory') { - try { - if (obj.compareTo(params.max_memory as nextflow.util.MemoryUnit) == 1) - return params.max_memory as nextflow.util.MemoryUnit - else - return obj - } catch (all) { - println " ### ERROR ### Max memory '${params.max_memory}' is not valid! Using default value: $obj" - return obj - } - } else if (type == 'time') { - try { - if (obj.compareTo(params.max_time as nextflow.util.Duration) == 1) - return params.max_time as nextflow.util.Duration - else - return obj - } catch (all) { - println " ### ERROR ### Max time '${params.max_time}' is not valid! Using default value: $obj" - return obj - } - } else if (type == 'cpus') { - try { - return Math.min( obj, params.max_cpus as int ) - } catch (all) { - println " ### ERROR ### Max cpus '${params.max_cpus}' is not valid! Using default value: $obj" - return obj - } +validation { + defaultIgnoreParams = ["genomes"] + help { + enabled = true + command = "nextflow run $manifest.name -profile --input samplesheet.csv --outdir " + fullParameter = "help_full" + showHiddenParameter = "show_hidden" + beforeText = """ +-\033[2m----------------------------------------------------\033[0m- + \033[0;32m,--.\033[0;30m/\033[0;32m,-.\033[0m +\033[0;34m ___ __ __ __ ___ \033[0;32m/,-._.--~\'\033[0m +\033[0;34m |\\ | |__ __ / ` / \\ |__) |__ \033[0;33m} {\033[0m +\033[0;34m | \\| | \\__, \\__/ | \\ |___ \033[0;32m\\`-._,-`-,\033[0m + \033[0;32m`._,._,\'\033[0m +\033[0;35m ${manifest.name} ${manifest.version}\033[0m +-\033[2m----------------------------------------------------\033[0m- +""" + afterText = """${manifest.doi ? "* The pipeline\n" : ""}${manifest.doi.tokenize(",").collect { " https://doi.org/${it.trim().replace('https://doi.org/','')}"}.join("\n")}${manifest.doi ? "\n" : ""} +* The nf-core framework + https://doi.org/10.1038/s41587-020-0439-x + +* Software dependencies + https://github.com/${manifest.name}/blob/master/CITATIONS.md +""" + } + summary { + beforeText = validation.help.beforeText + afterText = validation.help.afterText } } + +// Load modules.config for DSL2 module specific options +includeConfig 'conf/modules.config' diff --git a/nextflow_schema.json b/nextflow_schema.json index 5dc3ef2..cd36323 100644 --- a/nextflow_schema.json +++ b/nextflow_schema.json @@ -1,23 +1,10 @@ { - "$schema": "http://json-schema.org/draft-07/schema", + "$schema": "https://json-schema.org/draft/2020-12/schema", "$id": "https://raw.githubusercontent.com/nf-core/marsseq/master/nextflow_schema.json", "title": "nf-core/marsseq pipeline parameters", "description": "MARS-seq v2 preprocessing pipeline", "type": "object", - "definitions": { - "skip_steps": { - "title": "Skip steps", - "type": "object", - "description": "Skip analysis steps", - "default": "", - "properties": { - "skip_qc": { - "type": "boolean", - "description": "Skip QC steps" - } - }, - "fa_icon": "fas fa-fast-forward" - }, + "$defs": { "input_output_options": { "title": "Input/output options", "type": "object", @@ -29,6 +16,7 @@ "type": "string", "format": "file-path", "exists": true, + "schema": "assets/schema_input.json", "mimetype": "text/csv", "pattern": "^\\S+\\.csv$", "description": "Path to comma-separated file containing information about the samples in the experiment.", @@ -52,18 +40,6 @@ "type": "string", "description": "MultiQC report title. Printed as page header, used for filename if not otherwise specified.", "fa_icon": "fas fa-file-signature" - }, - "build_references": { - "type": "boolean", - "fa_icon": "far fa-file-code", - "description": "Specifies which analysis type for the pipeline - either build references or analyse data" - }, - "genomes_base": { - "type": "string", - "format": "directory-path", - "description": "Directory for Genomes references.", - "fa_icon": "fas fa-cloud-download-alt", - "hidden": true } } }, @@ -76,7 +52,6 @@ "genome": { "type": "string", "description": "Name of Genomes reference.", - "default": "mm10", "fa_icon": "fas fa-book", "help_text": "Currently supported mouse: `mm9`, `mm10` and human `GRCh38_v43`. The references are downloaded from [GENCODE](https://www.gencodegenes.org) database." }, @@ -93,6 +68,7 @@ "gtf": { "type": "string", "format": "file-path", + "exists": true, "mimetype": "text/plain", "pattern": "^\\S+\\.gtf(\\.gz)?$", "description": "Path to GTF annotation file.", @@ -107,29 +83,65 @@ "help_text": "This parameter is *mandatory* if `--genome` is not specified." }, "star_index": { + "type": "string", + "format": "path", + "exists": true, + "fa_icon": "fas fa-bezier-curve", + "description": "Path to directory or tar.gz archive for pre-built STAR index." + }, + "igenomes_ignore": { + "type": "boolean", + "description": "Do not load the iGenomes reference config.", + "fa_icon": "fas fa-ban", + "hidden": true, + "help_text": "Do not load `igenomes.config` when running the pipeline. You may choose this option if you observe clashes between custom parameters and those supplied in `igenomes.config`." + }, + "igenomes_base": { "type": "string", "format": "directory-path", - "description": "Path to STAR index.", - "fa_icon": "fas fa-code-branch", - "help_text": "This parameter is *mandatory* if `--genome` is not specified." + "description": "The base path to the igenomes reference files", + "fa_icon": "fas fa-ban", + "hidden": true, + "default": "s3://ngi-igenomes/igenomes/" } } }, - "rna_velocity": { - "title": "RNA velocity", + "alignment_options": { + "title": "Alignment options", "type": "object", - "description": "Convert original reads to 10X format in order to execute RNA velocity", - "default": "", + "fa_icon": "fas fa-map-signs", + "description": "Options to adjust parameters and filtering criteria for read alignments.", "properties": { - "velocity": { - "type": "boolean", - "default": false, - "description": "Run RNA velocity" + "aligner": { + "type": "string", + "default": "bowtie2_star", + "description": "Specifies the alignment algorithm to use - available options are 'bowtie2_star', 'bowtie2' and 'star'.", + "fa_icon": "fas fa-map-signs", + "enum": ["bowtie2_star", "bowtie2", "star"] }, "read_length": { "type": "integer", - "fa_icon": "fas fa-ruler", - "description": "Read length required for STAR aligner" + "default": 75, + "description": "Raw read length", + "fa_icon": "fas fa-ruler-horizontal" + } + } + }, + "process_skipping_options": { + "title": "Process skipping options", + "type": "object", + "fa_icon": "fas fa-fast-forward", + "description": "Options to skip various steps within the workflow.", + "properties": { + "skip_fastqc": { + "type": "boolean", + "description": "Skip FastQC.", + "fa_icon": "fas fa-fast-forward" + }, + "skip_qc": { + "type": "boolean", + "description": "Skip QC from original workflow.", + "fa_icon": "fas fa-fast-forward" } } }, @@ -181,41 +193,6 @@ } } }, - "max_job_request_options": { - "title": "Max job request options", - "type": "object", - "fa_icon": "fab fa-acquisitions-incorporated", - "description": "Set the top limit for requested resources for any single job.", - "help_text": "If you are running on a smaller system, a pipeline step requesting more resources than are available may cause the Nextflow to stop the run with an error. These options allow you to cap the maximum resources requested by any single job so that the pipeline will run on your system.\n\nNote that you can not _increase_ the resources requested by any job using these options. For that you will need your own configuration file. See [the nf-core website](https://nf-co.re/usage/configuration) for details.", - "properties": { - "max_cpus": { - "type": "integer", - "description": "Maximum number of CPUs that can be requested for any single job.", - "default": 16, - "fa_icon": "fas fa-microchip", - "hidden": true, - "help_text": "Use to set an upper-limit for the CPU requirement for each process. Should be an integer e.g. `--max_cpus 1`" - }, - "max_memory": { - "type": "string", - "description": "Maximum amount of memory that can be requested for any single job.", - "default": "128.GB", - "fa_icon": "fas fa-memory", - "pattern": "^\\d+(\\.\\d+)?\\.?\\s*(K|M|G|T)?B$", - "hidden": true, - "help_text": "Use to set an upper-limit for the memory requirement for each process. Should be a string in the format integer-unit e.g. `--max_memory '8.GB'`" - }, - "max_time": { - "type": "string", - "description": "Maximum amount of time that can be requested for any single job.", - "default": "240.h", - "fa_icon": "far fa-clock", - "pattern": "^(\\d+\\.?\\s*(s|m|h|d|day)\\s*)+$", - "hidden": true, - "help_text": "Use to set an upper-limit for the time requirement for each process. Should be a string in the format integer-unit e.g. `--max_time '2.h'`" - } - } - }, "generic_options": { "title": "Generic options", "type": "object", @@ -223,18 +200,10 @@ "description": "Less common options for the pipeline, typically set in a config file.", "help_text": "These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.", "properties": { - "help": { - "type": "boolean", - "description": "Display help text.", - "fa_icon": "fas fa-question-circle", - "default": false, - "hidden": true - }, "version": { "type": "boolean", "description": "Display version and exit.", "fa_icon": "fas fa-question-circle", - "default": false, "hidden": true }, "publish_dir_mode": { @@ -258,7 +227,6 @@ "type": "boolean", "description": "Send plain-text email instead of HTML.", "fa_icon": "fas fa-remove-format", - "default": false, "hidden": true }, "max_multiqc_email_size": { @@ -273,7 +241,6 @@ "type": "boolean", "description": "Do not use coloured log outputs.", "fa_icon": "fas fa-palette", - "default": false, "hidden": true }, "hook_url": { @@ -308,54 +275,34 @@ "fa_icon": "fas fa-check-square", "hidden": true }, - "validationShowHiddenParams": { - "type": "boolean", - "fa_icon": "far fa-eye-slash", - "description": "Show all params when using `--help`", - "default": false, - "hidden": true, - "help_text": "By default, parameters set as _hidden_ in the schema are not shown on the command line when a user runs with `--help`. Specifying this option will tell the pipeline to show all parameters." - }, - "validationFailUnrecognisedParams": { - "type": "boolean", - "fa_icon": "far fa-check-circle", - "description": "Validation of parameters fails when an unrecognised parameter is found.", - "default": false, - "hidden": true, - "help_text": "By default, when an unrecognised parameter is found, it returns a warinig." - }, - "validationLenientMode": { - "type": "boolean", + "pipelines_testdata_base_path": { + "type": "string", "fa_icon": "far fa-check-circle", - "description": "Validation of parameters in lenient more.", - "default": false, - "hidden": true, - "help_text": "Allows string values that are parseable as numbers or booleans. For further information see [JSONSchema docs](https://github.com/everit-org/json-schema#lenient-mode)." + "description": "Base URL or local path to location of pipeline test dataset files", + "default": "https://raw.githubusercontent.com/nf-core/test-datasets/", + "hidden": true } } } }, "allOf": [ { - "$ref": "#/definitions/skip_steps" - }, - { - "$ref": "#/definitions/input_output_options" + "$ref": "#/$defs/input_output_options" }, { - "$ref": "#/definitions/reference_genome_options" + "$ref": "#/$defs/reference_genome_options" }, { - "$ref": "#/definitions/rna_velocity" + "$ref": "#/$defs/institutional_config_options" }, { - "$ref": "#/definitions/institutional_config_options" + "$ref": "#/$defs/alignment_options" }, { - "$ref": "#/definitions/max_job_request_options" + "$ref": "#/$defs/process_skipping_options" }, { - "$ref": "#/definitions/generic_options" + "$ref": "#/$defs/generic_options" } ] } diff --git a/pyproject.toml b/pyproject.toml deleted file mode 100644 index 0d62beb..0000000 --- a/pyproject.toml +++ /dev/null @@ -1,10 +0,0 @@ -# Config file for Python. Mostly used to configure linting of bin/check_samplesheet.py with Black. -# Should be kept the same as nf-core/tools to avoid fighting with template synchronisation. -[tool.black] -line-length = 120 -target_version = ["py37", "py38", "py39", "py310"] - -[tool.isort] -profile = "black" -known_first_party = ["nf_core"] -multi_line_output = 3 diff --git a/subworkflows/local/align_reads.nf b/subworkflows/local/align_reads.nf index dc5f0ae..41a07b6 100644 --- a/subworkflows/local/align_reads.nf +++ b/subworkflows/local/align_reads.nf @@ -8,24 +8,23 @@ include { QC_ALIGNED } from '../../modules/local/qc/align/main' workflow ALIGN_READS { take: - reads // channel [ meta, reads ] - index // channel file(bowtie2 index) - qc // channel file(*.txt) + reads // channel: [ meta, reads ] + index // channel: [ index ] + fasta // channel: [ meta, fasta ] + qc // channel: [ file(*.txt) ] main: ch_versions = Channel.empty() ch_reads = reads .map { meta, reads -> [ [ "id": meta.id, "single_end": true, "filename": reads.baseName ], reads ]} - ch_index = ch_reads - .map { meta, reads -> [ meta, index ] } - BOWTIE2_ALIGN ( ch_reads, ch_index, false, false ) + BOWTIE2_ALIGN ( ch_reads, index, fasta, false, false ) ch_versions = ch_versions.mix(BOWTIE2_ALIGN.out.versions) - QC_ALIGNED ( BOWTIE2_ALIGN.out.aligned, qc ) + QC_ALIGNED ( BOWTIE2_ALIGN.out.sam, qc ) ch_versions = ch_versions.mix(QC_ALIGNED.out.versions) - CUT_SAM ( BOWTIE2_ALIGN.out.aligned ) + CUT_SAM ( BOWTIE2_ALIGN.out.sam ) ch_versions = ch_versions.mix(CUT_SAM.out.versions) emit: diff --git a/subworkflows/local/build_references.nf b/subworkflows/local/build_references.nf deleted file mode 100644 index a308109..0000000 --- a/subworkflows/local/build_references.nf +++ /dev/null @@ -1,70 +0,0 @@ -// -// Subworkflow for downloading all -// required references -// - -include { WGET as DOWNLOAD_FASTA } from '../../modules/local/wget/main' -include { WGET as DOWNLOAD_GTF } from '../../modules/local/wget/main' -include { GUNZIP as GUNZIP_FASTA } from '../../modules/nf-core/gunzip/main' -include { GUNZIP as GUNZIP_GTF } from '../../modules/nf-core/gunzip/main' -include { ERCC_CREATE } from '../../modules/local/ercc/main' -include { CAT_CAT as CAT_FASTA } from '../../modules/nf-core/cat/cat/main' -include { BOWTIE2_BUILD } from '../../modules/nf-core/bowtie2/build/main' -include { STAR_GENOMEGENERATE } from '../../modules/nf-core/star/genomegenerate/main' - -workflow BUILD_REFERENCES { - - main: - ch_star_index = Channel.empty() - ch_versions = Channel.empty() - params.genomes_base = params.genomes_base ? "${params.outdir}/references/" : params.genomes_base - - // download references - fasta = params.genomes[params.genome].fasta.split('/')[-1] - DOWNLOAD_FASTA ( - params.genomes[params.genome].fasta_url, - "_" + fasta - ) - ch_versions = ch_versions.mix(DOWNLOAD_FASTA.out.versions) - - DOWNLOAD_GTF ( - params.genomes[params.genome].gtf_url, - params.genomes[params.genome].gtf.split('/')[-1] - ) - ch_versions = ch_versions.mix(DOWNLOAD_GTF.out.versions) - - // uncompress - ch_fasta = GUNZIP_FASTA ( DOWNLOAD_FASTA.out.file ).gunzip.map { it[1] } - ch_versions = ch_versions.mix(GUNZIP_FASTA.out.versions) - - ch_gtf = GUNZIP_GTF ( DOWNLOAD_GTF.out.file ).gunzip.map { it[1] } - ch_versions = ch_versions.mix(GUNZIP_GTF.out.versions) - - // create ERCC FASTA - ERCC_CREATE( Channel.from("$projectDir/data/spike-seq.txt") ) - ch_versions = ch_versions.mix(ERCC_CREATE.out.versions) - - ch_fastas = ch_fasta.merge(ERCC_CREATE.out.fasta) - .map{ it -> [ ["id": "${fasta - '.fa'}"], it ] } - - ch_genome = CAT_FASTA ( ch_fastas ).file_out - ch_versions = ch_versions.mix(CAT_FASTA.out.versions) - - // build bowtie2 index - BOWTIE2_BUILD( ch_genome ) - ch_versions = ch_versions.mix(BOWTIE2_BUILD.out.versions) - - // build STAR index for velocity - if (params.velocity) { - ch_star_index = STAR_GENOMEGENERATE( ch_genome.map{ meta, fasta -> fasta }, ch_gtf.map{ meta, gtf -> gtf } ).index - ch_versions = ch_versions.mix(STAR_GENOMEGENERATE.out.versions) - } - - emit: - fasta = ch_fasta - gtf = ch_gtf - bowtie2_index = BOWTIE2_BUILD.out.index - star_index = ch_star_index - versions = ch_versions - -} diff --git a/subworkflows/local/input_check.nf b/subworkflows/local/input_check.nf deleted file mode 100644 index 8244b67..0000000 --- a/subworkflows/local/input_check.nf +++ /dev/null @@ -1,56 +0,0 @@ -// -// Check input samplesheet and get read channels -// - -include { SAMPLESHEET_CHECK } from '../../modules/local/samplesheet_check' - -workflow INPUT_CHECK { - take: - samplesheet // file: /path/to/samplesheet.csv - - main: - SAMPLESHEET_CHECK ( samplesheet ) - .csv - .splitCsv ( header:true, sep:',' ) - .map { create_fastq_channel(it) } - .set { reads } - - emit: - reads // channel: [ val(meta), [ reads ] ] - versions = SAMPLESHEET_CHECK.out.versions // channel: [ versions.yml ] -} - -// Function to get list of [ meta, [ fastq_1, fastq_2 ] ] -def create_fastq_channel(LinkedHashMap row) { - // create meta map - def meta = [:] - meta.id = row.batch - meta.single_end = false - - // add path(s) of the fastq file(s) to the meta map - if (!file(row.fastq_1).exists()) { - exit 1, "ERROR: Please check input samplesheet -> Read 1 FastQ file does not exist!\n${row.fastq_1}" - } - - if (!file(row.fastq_2).exists()) { - exit 1, "ERROR: Please check input samplesheet -> Read 2 FastQ file does not exist!\n${row.fastq_2}" - } - - if (!file(row.amp_batches).exists()) { - exit 1, "ERROR: amp_batch file does not exist!" - } - - if (!file(row.seq_batches).exists()) { - exit 1, "ERROR: seq_batches file does not exist!" - } - - if (!file(row.well_cells).exists()) { - exit 1, "ERROR: well_cells file does not exist!" - } - - meta.amp_batches = file(row.amp_batches) - meta.seq_batches = file(row.seq_batches) - meta.well_cells = file(row.well_cells) - - return [ meta, [ file(row.fastq_1), file(row.fastq_2) ] ] -} diff --git a/subworkflows/local/label_reads.nf b/subworkflows/local/label_reads.nf index f01de0c..1220a90 100644 --- a/subworkflows/local/label_reads.nf +++ b/subworkflows/local/label_reads.nf @@ -6,12 +6,13 @@ include { EXTRACT_LABELS } from '../../modules/local/extract/main' workflow LABEL_READS { take: - oligos // channel oligos.txt - amp_batches // channel amp_batches.txt - seq_batches // channel seq_batches.txt + oligos // channel: oligos.txt + amp_batches // channel: amp_batches.txt + seq_batches // channel: seq_batches.txt fastp_reads // channel: [ val(meta), [ reads ] ] main: + ch_reads = fastp_reads .map { meta, reads -> return [ meta, reads.sort().collate(2) ] } .transpose() diff --git a/subworkflows/local/prepare_genome.nf b/subworkflows/local/prepare_genome.nf new file mode 100644 index 0000000..8caddf6 --- /dev/null +++ b/subworkflows/local/prepare_genome.nf @@ -0,0 +1,93 @@ +// +// Prepare reference genome files +// + +include { BOWTIE2_BUILD } from '../../modules/nf-core/bowtie2/build/main' +include { CAT_CAT as CAT_FASTA } from '../../modules/nf-core/cat/cat/main' +include { ERCC_CREATE } from '../../modules/local/ercc/main' +include { GUNZIP as GUNZIP_FASTA } from '../../modules/nf-core/gunzip/main' +include { GUNZIP as GUNZIP_GTF } from '../../modules/nf-core/gunzip/main' +include { STAR_GENOMEGENERATE } from '../../modules/nf-core/star/genomegenerate/main' + +workflow PREPARE_GENOME { + + take: + aligner // string: Specifies the alignment algorithm + fasta // file: /path/to/genome.fasta + gtf // file: /path/to/genome.gtf + bowtie2_index // string: /path/to/bowtie2/index + star_index // string: /path/to/star/index + + main: + + ch_versions = Channel.empty() + ch_fasta = Channel.empty() + ch_gtf = Channel.empty() + ch_bowtie2_index = Channel.empty() + ch_star_index = Channel.empty() + + // + // Uncompress genome fasta file if required + // + if (fasta.endsWith('.gz')) { + ch_fasta = GUNZIP_FASTA ( [ [:], file(fasta, checkIfExists: true) ] ).gunzip.map { it[1] } + ch_versions = ch_versions.mix(GUNZIP_FASTA.out.versions) + } else { + ch_fasta = Channel.value(file(fasta, checkIfExists: true)) + } + ch_fasta = ch_fasta.map { fasta -> [ [id: fasta.baseName], fasta ] } + + // + // Uncompress annotation gtf file if required + // + if (fasta.endsWith('.gz')) { + ch_gtf = GUNZIP_GTF ( [ [:], file(gtf, checkIfExists: true) ] ).gunzip.map { it[1] } + ch_versions = ch_versions.mix(GUNZIP_GTF.out.versions) + } else { + ch_gtf = Channel.value(file(gtf, checkIfExists: true)) + } + ch_gtf = ch_gtf.map { gtf -> [ [id: gtf.baseName], gtf ] } + + // + // Prepare genome by appending ERCC spike-ins + // + if (!bowtie2_index || !star_index) { + + // Append ERCC (spike-ins) to the reference genome + spike_seq = file("$projectDir/data/spike-seq.txt") + ERCC_CREATE(spike_seq) + ch_versions = ch_versions.mix(ERCC_CREATE.out.versions) + + CAT_FASTA( + ch_fasta + .merge(ERCC_CREATE.out.fasta) + .map{ meta, fasta, ercc -> [ [id:"${meta.id}_ercc"], [fasta, ercc] ] } + ) + ch_versions = ch_versions.mix(CAT_FASTA.out.versions) + } + + if (aligner.contains('bowtie2')) { + if (bowtie2_index) { + ch_bowtie2_index = Channel.fromPath(bowtie2_index, checkIfExists: true).map { index -> [ [id:"target_index"], index ] } + } else { + ch_bowtie2_index = BOWTIE2_BUILD(CAT_FASTA.out.file_out).index + ch_versions = ch_versions.mix(BOWTIE2_BUILD.out.versions) + } + } + + if (aligner.contains('star')) { + if (star_index) { + ch_star_index = Channel.fromPath(star_index, checkIfExists: true).map { index -> [ [id:"target_index"], index ] } + } else { + ch_star_index = STAR_GENOMEGENERATE( CAT_FASTA.out.file_out, ch_gtf ).index + ch_versions = ch_versions.mix(STAR_GENOMEGENERATE.out.versions) + } + } + + emit: + fasta = ch_fasta + gtf = ch_gtf + bowtie2_index = ch_bowtie2_index + star_index = ch_star_index + versions = ch_versions +} diff --git a/subworkflows/local/prepare_pipeline.nf b/subworkflows/local/prepare_pipeline.nf index bec92b6..9084d15 100644 --- a/subworkflows/local/prepare_pipeline.nf +++ b/subworkflows/local/prepare_pipeline.nf @@ -11,7 +11,7 @@ workflow PREPARE_PIPELINE { amp_batches // channel: amp_batch seq_batches // channel: seq_batch well_cells // channel: well_cells - gtf // channel: gtf + gtf // channel: [ meta, file(gtf) ] ercc_regions // channel: ercc_regions reads // channel: [ val(meta), [ reads ] ] @@ -24,7 +24,7 @@ workflow PREPARE_PIPELINE { amp_batches, seq_batches, well_cells, - gtf, + gtf.map { it[1] }, ercc_regions, reads ) diff --git a/subworkflows/local/utils_nfcore_marsseq_pipeline/main.nf b/subworkflows/local/utils_nfcore_marsseq_pipeline/main.nf new file mode 100644 index 0000000..4933bf2 --- /dev/null +++ b/subworkflows/local/utils_nfcore_marsseq_pipeline/main.nf @@ -0,0 +1,263 @@ +// +// Subworkflow with functionality specific to the nf-core/marsseq pipeline +// + +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + IMPORT FUNCTIONS / MODULES / SUBWORKFLOWS +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/ + +include { UTILS_NFSCHEMA_PLUGIN } from '../../nf-core/utils_nfschema_plugin' +include { paramsSummaryMap } from 'plugin/nf-schema' +include { samplesheetToList } from 'plugin/nf-schema' +include { completionEmail } from '../../nf-core/utils_nfcore_pipeline' +include { completionSummary } from '../../nf-core/utils_nfcore_pipeline' +include { imNotification } from '../../nf-core/utils_nfcore_pipeline' +include { UTILS_NFCORE_PIPELINE } from '../../nf-core/utils_nfcore_pipeline' +include { UTILS_NEXTFLOW_PIPELINE } from '../../nf-core/utils_nextflow_pipeline' + +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + SUBWORKFLOW TO INITIALISE PIPELINE +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/ + +workflow PIPELINE_INITIALISATION { + + take: + version // boolean: Display version and exit + validate_params // boolean: Boolean whether to validate parameters against the schema at runtime + monochrome_logs // boolean: Do not use coloured log outputs + nextflow_cli_args // array: List of positional nextflow CLI args + outdir // string: The output directory where the results will be saved + input // string: Path to input samplesheet + + main: + + ch_versions = Channel.empty() + + // + // Print version and exit if required and dump pipeline parameters to JSON file + // + UTILS_NEXTFLOW_PIPELINE ( + version, + true, + outdir, + workflow.profile.tokenize(',').intersect(['conda', 'mamba']).size() >= 1 + ) + + // + // Validate parameters and generate parameter summary to stdout + // + UTILS_NFSCHEMA_PLUGIN ( + workflow, + validate_params, + null + ) + + // + // Check config provided to the pipeline + // + UTILS_NFCORE_PIPELINE ( + nextflow_cli_args + ) + + // + // Custom validation for pipeline parameters + // + validateInputParameters() + + // + // Create channel from input file provided through params.input + // + + Channel + .fromList(samplesheetToList(params.input, "${projectDir}/assets/schema_input.json")) + .map { + meta, fastq_1, fastq_2 -> + if (!fastq_2) { + return [ meta.id, meta + [ single_end:true ], [ fastq_1 ] ] + } else { + return [ meta.id, meta + [ single_end:false ], [ fastq_1, fastq_2 ] ] + } + } + .groupTuple() + .map { samplesheet -> + validateInputSamplesheet(samplesheet) + } + .map { + meta, fastqs -> + return [ meta, fastqs.flatten() ] + } + .set { ch_samplesheet } + + emit: + samplesheet = ch_samplesheet + versions = ch_versions +} + +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + SUBWORKFLOW FOR PIPELINE COMPLETION +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/ + +workflow PIPELINE_COMPLETION { + + take: + email // string: email address + email_on_fail // string: email address sent on pipeline failure + plaintext_email // boolean: Send plain-text email instead of HTML + outdir // path: Path to output directory where results will be published + monochrome_logs // boolean: Disable ANSI colour codes in log output + hook_url // string: hook URL for notifications + multiqc_report // string: Path to MultiQC report + + main: + summary_params = paramsSummaryMap(workflow, parameters_schema: "nextflow_schema.json") + + // + // Completion email and summary + // + workflow.onComplete { + if (email || email_on_fail) { + completionEmail( + summary_params, + email, + email_on_fail, + plaintext_email, + outdir, + monochrome_logs, + multiqc_report.toList() + ) + } + + completionSummary(monochrome_logs) + if (hook_url) { + imNotification(summary_params, hook_url) + } + } + + workflow.onError { + log.error "Pipeline failed. Please refer to troubleshooting docs: https://nf-co.re/docs/usage/troubleshooting" + } +} + +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + FUNCTIONS +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/ +// +// Check and validate pipeline parameters +// +def validateInputParameters() { + genomeExistsError() +} + +// +// Validate channels from input samplesheet +// +def validateInputSamplesheet(input) { + def (metas, fastqs) = input[1..2] + + // Check that multiple runs of the same sample are of the same datatype i.e. single-end / paired-end + def endedness_ok = metas.collect{ meta -> meta.single_end }.unique().size == 1 + if (!endedness_ok) { + error("Please check input samplesheet -> Multiple runs of a sample must be of the same datatype i.e. single-end or paired-end: ${metas[0].id}") + } + + return [ metas[0], fastqs ] +} +// +// Get attribute from genome config file e.g. fasta +// +def getGenomeAttribute(attribute) { + if (params.genomes && params.genome && params.genomes.containsKey(params.genome)) { + if (params.genomes[ params.genome ].containsKey(attribute)) { + return params.genomes[ params.genome ][ attribute ] + } + } + return null +} + +// +// Exit pipeline if incorrect --genome key provided +// +def genomeExistsError() { + if (params.genomes && params.genome && !params.genomes.containsKey(params.genome)) { + def error_string = "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~\n" + + " Genome '${params.genome}' not found in any config files provided to the pipeline.\n" + + " Currently, the available genome keys are:\n" + + " ${params.genomes.keySet().join(", ")}\n" + + "~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" + error(error_string) + } +} +// +// Generate methods description for MultiQC +// +def toolCitationText() { + // TODO nf-core: Optionally add in-text citation tools to this list. + // Can use ternary operators to dynamically construct based conditions, e.g. params["run_xyz"] ? "Tool (Foo et al. 2023)" : "", + // Uncomment function in methodsDescriptionText to render in MultiQC report + def citation_text = [ + "Tools used in the workflow included:", + "FastQC (Andrews 2010),", + "MultiQC (Ewels et al. 2016)", + "." + ].join(' ').trim() + + return citation_text +} + +def toolBibliographyText() { + // TODO nf-core: Optionally add bibliographic entries to this list. + // Can use ternary operators to dynamically construct based conditions, e.g. params["run_xyz"] ? "
  • Author (2023) Pub name, Journal, DOI
  • " : "", + // Uncomment function in methodsDescriptionText to render in MultiQC report + def reference_text = [ + "
  • Andrews S, (2010) FastQC, URL: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/).
  • ", + "
  • Ewels, P., Magnusson, M., Lundin, S., & Käller, M. (2016). MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics , 32(19), 3047–3048. doi: /10.1093/bioinformatics/btw354
  • " + ].join(' ').trim() + + return reference_text +} + +def methodsDescriptionText(mqc_methods_yaml) { + // Convert to a named map so can be used as with familar NXF ${workflow} variable syntax in the MultiQC YML file + def meta = [:] + meta.workflow = workflow.toMap() + meta["manifest_map"] = workflow.manifest.toMap() + + // Pipeline DOI + if (meta.manifest_map.doi) { + // Using a loop to handle multiple DOIs + // Removing `https://doi.org/` to handle pipelines using DOIs vs DOI resolvers + // Removing ` ` since the manifest.doi is a string and not a proper list + def temp_doi_ref = "" + def manifest_doi = meta.manifest_map.doi.tokenize(",") + manifest_doi.each { doi_ref -> + temp_doi_ref += "(doi: ${doi_ref.replace("https://doi.org/", "").replace(" ", "")}), " + } + meta["doi_text"] = temp_doi_ref.substring(0, temp_doi_ref.length() - 2) + } else meta["doi_text"] = "" + meta["nodoi_text"] = meta.manifest_map.doi ? "" : "
  • If available, make sure to update the text to include the Zenodo DOI of version of the pipeline used.
  • " + + // Tool references + meta["tool_citations"] = "" + meta["tool_bibliography"] = "" + + // TODO nf-core: Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled! + // meta["tool_citations"] = toolCitationText().replaceAll(", \\.", ".").replaceAll("\\. \\.", ".").replaceAll(", \\.", ".") + // meta["tool_bibliography"] = toolBibliographyText() + + + def methods_text = mqc_methods_yaml.text + + def engine = new groovy.text.SimpleTemplateEngine() + def description_html = engine.createTemplate(methods_text).make(meta) + + return description_html.toString() +} + diff --git a/subworkflows/local/velocity.nf b/subworkflows/local/velocity.nf index 7c4655b..711e25a 100644 --- a/subworkflows/local/velocity.nf +++ b/subworkflows/local/velocity.nf @@ -2,52 +2,61 @@ // Subworkflow for setting up all necessary files // before running the pipeline // +include { CAT_FASTQ } from '../../modules/nf-core/cat/fastq/main' +include { CUTADAPT as VELOCITY_TRIM } from '../../modules/nf-core/cutadapt/main' include { VELOCITY_CONVERT } from '../../modules/local/velocity/convert/main' include { VELOCITY_WHITELIST } from '../../modules/local/velocity/whitelist/main' -include { CUTADAPT as VELOCITY_TRIM } from '../../modules/nf-core/cutadapt/main' -include { STAR_ALIGN as VELOCITY_STARSOLO } from '../../modules/nf-core/star/align/main' +include { STARSOLO } from '../../modules/nf-core/star/starsolo/main' workflow VELOCITY { take: amp_batches // channel: amp_batch well_cells // channel: well_cells - reads // channel [ meta, reads ] - index // channel file(star index) - gtf // channel file(gtf) + reads // channel: [ meta, reads ] + index // channel: [ meta, index ] main: ch_versions = Channel.empty() - ch_folder = reads.map { meta, reads -> [ meta, reads.first().Parent ] } - ch_index = reads.map { meta, reads -> [ meta, index ] } - // convert fastq files into 10X format - VELOCITY_CONVERT ( ch_folder ) + ch_reads = reads + .map { meta, reads -> return [ meta, reads.sort().collate(2) ] } + .transpose() + + VELOCITY_CONVERT ( ch_reads ) ch_versions = ch_versions.mix(VELOCITY_CONVERT.out.versions) + // merge fastq files into one sample + CAT_FASTQ ( VELOCITY_CONVERT.out.reads.groupTuple().map { meta, reads -> [ meta, reads.flatten() ] } ) + ch_versions = ch_versions.mix(CAT_FASTQ.out.versions) + // build whitelist.txt VELOCITY_WHITELIST ( amp_batches, well_cells, reads ) ch_versions = ch_versions.mix(VELOCITY_WHITELIST.out.versions) // trim poly-T and low quality reads - VELOCITY_TRIM ( VELOCITY_CONVERT.out.reads ) + VELOCITY_TRIM ( CAT_FASTQ.out.reads ) ch_versions = ch_versions.mix(VELOCITY_TRIM.out.versions) // alignment using StarSolo - VELOCITY_STARSOLO ( - VELOCITY_TRIM.out.reads, // reads - index, // star index - gtf, // gtf annotation - VELOCITY_WHITELIST.out.whitelist, // whitelist - true, // star_ignore_sjdbgtf - false, // seq_platform - false // seq_center - ) - ch_versions = ch_versions.mix(VELOCITY_STARSOLO.out.versions) + ch_reads = VELOCITY_TRIM.out.reads.map { + meta, reads -> [ + [ + id: meta.id, + cb_start: 1, + cb_len: 11, + umi_start: 12, + umi_len: 8, + ], "CB_UMI_Simple", reads + ] + } + + STARSOLO ( ch_reads, VELOCITY_WHITELIST.out.whitelist, index ) + ch_versions = ch_versions.mix(STARSOLO.out.versions) emit: catadapt_multiqc = VELOCITY_TRIM.out.log - star_multiqc = VELOCITY_STARSOLO.out.log_final + star_multiqc = STARSOLO.out.log_final versions = ch_versions } diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/main.nf b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf new file mode 100644 index 0000000..0fcbf7b --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/main.nf @@ -0,0 +1,124 @@ +// +// Subworkflow with functionality that may be useful for any Nextflow pipeline +// + +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + SUBWORKFLOW DEFINITION +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/ + +workflow UTILS_NEXTFLOW_PIPELINE { + take: + print_version // boolean: print version + dump_parameters // boolean: dump parameters + outdir // path: base directory used to publish pipeline results + check_conda_channels // boolean: check conda channels + + main: + + // + // Print workflow version and exit on --version + // + if (print_version) { + log.info("${workflow.manifest.name} ${getWorkflowVersion()}") + System.exit(0) + } + + // + // Dump pipeline parameters to a JSON file + // + if (dump_parameters && outdir) { + dumpParametersToJSON(outdir) + } + + // + // When running with Conda, warn if channels have not been set-up appropriately + // + if (check_conda_channels) { + checkCondaChannels() + } + + emit: + dummy_emit = true +} + +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + FUNCTIONS +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/ + +// +// Generate version string +// +def getWorkflowVersion() { + def version_string = "" as String + if (workflow.manifest.version) { + def prefix_v = workflow.manifest.version[0] != 'v' ? 'v' : '' + version_string += "${prefix_v}${workflow.manifest.version}" + } + + if (workflow.commitId) { + def git_shortsha = workflow.commitId.substring(0, 7) + version_string += "-g${git_shortsha}" + } + + return version_string +} + +// +// Dump pipeline parameters to a JSON file +// +def dumpParametersToJSON(outdir) { + def timestamp = new java.util.Date().format('yyyy-MM-dd_HH-mm-ss') + def filename = "params_${timestamp}.json" + def temp_pf = new File(workflow.launchDir.toString(), ".${filename}") + def jsonStr = groovy.json.JsonOutput.toJson(params) + temp_pf.text = groovy.json.JsonOutput.prettyPrint(jsonStr) + + nextflow.extension.FilesEx.copyTo(temp_pf.toPath(), "${outdir}/pipeline_info/params_${timestamp}.json") + temp_pf.delete() +} + +// +// When running with -profile conda, warn if channels have not been set-up appropriately +// +def checkCondaChannels() { + def parser = new org.yaml.snakeyaml.Yaml() + def channels = [] + try { + def config = parser.load("conda config --show channels".execute().text) + channels = config.channels + } + catch (NullPointerException e) { + log.warn("Could not verify conda channel configuration.") + return null + } + catch (IOException e) { + log.warn("Could not verify conda channel configuration.") + return null + } + + // Check that all channels are present + // This channel list is ordered by required channel priority. + def required_channels_in_order = ['conda-forge', 'bioconda'] + def channels_missing = ((required_channels_in_order as Set) - (channels as Set)) as Boolean + + // Check that they are in the right order + def channel_priority_violation = required_channels_in_order != channels.findAll { ch -> ch in required_channels_in_order } + + if (channels_missing | channel_priority_violation) { + log.warn """\ + ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + There is a problem with your Conda configuration! + You will need to set-up the conda-forge and bioconda channels correctly. + Please refer to https://bioconda.github.io/ + The observed channel order is + ${channels} + but the following channel order is required: + ${required_channels_in_order} + ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~" + """.stripIndent(true) + } +} diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/meta.yml b/subworkflows/nf-core/utils_nextflow_pipeline/meta.yml new file mode 100644 index 0000000..e5c3a0a --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/meta.yml @@ -0,0 +1,38 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json +name: "UTILS_NEXTFLOW_PIPELINE" +description: Subworkflow with functionality that may be useful for any Nextflow pipeline +keywords: + - utility + - pipeline + - initialise + - version +components: [] +input: + - print_version: + type: boolean + description: | + Print the version of the pipeline and exit + - dump_parameters: + type: boolean + description: | + Dump the parameters of the pipeline to a JSON file + - output_directory: + type: directory + description: Path to output dir to write JSON file to. + pattern: "results/" + - check_conda_channel: + type: boolean + description: | + Check if the conda channel priority is correct. +output: + - dummy_emit: + type: boolean + description: | + Dummy emit to make nf-core subworkflows lint happy +authors: + - "@adamrtalbot" + - "@drpatelh" +maintainers: + - "@adamrtalbot" + - "@drpatelh" + - "@maxulysse" diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test new file mode 100644 index 0000000..68718e4 --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test @@ -0,0 +1,54 @@ + +nextflow_function { + + name "Test Functions" + script "subworkflows/nf-core/utils_nextflow_pipeline/main.nf" + config "subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config" + tag 'subworkflows' + tag 'utils_nextflow_pipeline' + tag 'subworkflows/utils_nextflow_pipeline' + + test("Test Function getWorkflowVersion") { + + function "getWorkflowVersion" + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function dumpParametersToJSON") { + + function "dumpParametersToJSON" + + when { + function { + """ + // define inputs of the function here. Example: + input[0] = "$outputDir" + """.stripIndent() + } + } + + then { + assertAll( + { assert function.success } + ) + } + } + + test("Test Function checkCondaChannels") { + + function "checkCondaChannels" + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } +} diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test.snap b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test.snap new file mode 100644 index 0000000..e3f0baf --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.function.nf.test.snap @@ -0,0 +1,20 @@ +{ + "Test Function getWorkflowVersion": { + "content": [ + "v9.9.9" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:02:05.308243" + }, + "Test Function checkCondaChannels": { + "content": null, + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:02:12.425833" + } +} \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.workflow.nf.test b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.workflow.nf.test new file mode 100644 index 0000000..ca964ce --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/tests/main.workflow.nf.test @@ -0,0 +1,111 @@ +nextflow_workflow { + + name "Test Workflow UTILS_NEXTFLOW_PIPELINE" + script "../main.nf" + config "subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config" + workflow "UTILS_NEXTFLOW_PIPELINE" + tag 'subworkflows' + tag 'utils_nextflow_pipeline' + tag 'subworkflows/utils_nextflow_pipeline' + + test("Should run no inputs") { + + when { + workflow { + """ + print_version = false + dump_parameters = false + outdir = null + check_conda_channels = false + + input[0] = print_version + input[1] = dump_parameters + input[2] = outdir + input[3] = check_conda_channels + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } + + test("Should print version") { + + when { + workflow { + """ + print_version = true + dump_parameters = false + outdir = null + check_conda_channels = false + + input[0] = print_version + input[1] = dump_parameters + input[2] = outdir + input[3] = check_conda_channels + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert workflow.stdout.contains("nextflow_workflow v9.9.9") } + ) + } + } + + test("Should dump params") { + + when { + workflow { + """ + print_version = false + dump_parameters = true + outdir = 'results' + check_conda_channels = false + + input[0] = false + input[1] = true + input[2] = outdir + input[3] = false + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } + + test("Should not create params JSON if no output directory") { + + when { + workflow { + """ + print_version = false + dump_parameters = true + outdir = null + check_conda_channels = false + + input[0] = false + input[1] = true + input[2] = outdir + input[3] = false + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } +} diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config b/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config new file mode 100644 index 0000000..a09572e --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/tests/nextflow.config @@ -0,0 +1,9 @@ +manifest { + name = 'nextflow_workflow' + author = """nf-core""" + homePage = 'https://127.0.0.1' + description = """Dummy pipeline""" + nextflowVersion = '!>=23.04.0' + version = '9.9.9' + doi = 'https://doi.org/10.5281/zenodo.5070524' +} diff --git a/subworkflows/nf-core/utils_nextflow_pipeline/tests/tags.yml b/subworkflows/nf-core/utils_nextflow_pipeline/tests/tags.yml new file mode 100644 index 0000000..f847611 --- /dev/null +++ b/subworkflows/nf-core/utils_nextflow_pipeline/tests/tags.yml @@ -0,0 +1,2 @@ +subworkflows/utils_nextflow_pipeline: + - subworkflows/nf-core/utils_nextflow_pipeline/** diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/main.nf b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf new file mode 100644 index 0000000..5cb7baf --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/main.nf @@ -0,0 +1,462 @@ +// +// Subworkflow with utility functions specific to the nf-core pipeline template +// + +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + SUBWORKFLOW DEFINITION +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/ + +workflow UTILS_NFCORE_PIPELINE { + take: + nextflow_cli_args + + main: + valid_config = checkConfigProvided() + checkProfileProvided(nextflow_cli_args) + + emit: + valid_config +} + +/* +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ + FUNCTIONS +~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ +*/ + +// +// Warn if a -profile or Nextflow config has not been provided to run the pipeline +// +def checkConfigProvided() { + def valid_config = true as Boolean + if (workflow.profile == 'standard' && workflow.configFiles.size() <= 1) { + log.warn( + "[${workflow.manifest.name}] You are attempting to run the pipeline without any custom configuration!\n\n" + "This will be dependent on your local compute environment but can be achieved via one or more of the following:\n" + " (1) Using an existing pipeline profile e.g. `-profile docker` or `-profile singularity`\n" + " (2) Using an existing nf-core/configs for your Institution e.g. `-profile crick` or `-profile uppmax`\n" + " (3) Using your own local custom config e.g. `-c /path/to/your/custom.config`\n\n" + "Please refer to the quick start section and usage docs for the pipeline.\n " + ) + valid_config = false + } + return valid_config +} + +// +// Exit pipeline if --profile contains spaces +// +def checkProfileProvided(nextflow_cli_args) { + if (workflow.profile.endsWith(',')) { + error( + "The `-profile` option cannot end with a trailing comma, please remove it and re-run the pipeline!\n" + "HINT: A common mistake is to provide multiple values separated by spaces e.g. `-profile test, docker`.\n" + ) + } + if (nextflow_cli_args[0]) { + log.warn( + "nf-core pipelines do not accept positional arguments. The positional argument `${nextflow_cli_args[0]}` has been detected.\n" + "HINT: A common mistake is to provide multiple values separated by spaces e.g. `-profile test, docker`.\n" + ) + } +} + +// +// Citation string for pipeline +// +def workflowCitation() { + def temp_doi_ref = "" + def manifest_doi = workflow.manifest.doi.tokenize(",") + // Handling multiple DOIs + // Removing `https://doi.org/` to handle pipelines using DOIs vs DOI resolvers + // Removing ` ` since the manifest.doi is a string and not a proper list + manifest_doi.each { doi_ref -> + temp_doi_ref += " https://doi.org/${doi_ref.replace('https://doi.org/', '').replace(' ', '')}\n" + } + return "If you use ${workflow.manifest.name} for your analysis please cite:\n\n" + "* The pipeline\n" + temp_doi_ref + "\n" + "* The nf-core framework\n" + " https://doi.org/10.1038/s41587-020-0439-x\n\n" + "* Software dependencies\n" + " https://github.com/${workflow.manifest.name}/blob/master/CITATIONS.md" +} + +// +// Generate workflow version string +// +def getWorkflowVersion() { + def version_string = "" as String + if (workflow.manifest.version) { + def prefix_v = workflow.manifest.version[0] != 'v' ? 'v' : '' + version_string += "${prefix_v}${workflow.manifest.version}" + } + + if (workflow.commitId) { + def git_shortsha = workflow.commitId.substring(0, 7) + version_string += "-g${git_shortsha}" + } + + return version_string +} + +// +// Get software versions for pipeline +// +def processVersionsFromYAML(yaml_file) { + def yaml = new org.yaml.snakeyaml.Yaml() + def versions = yaml.load(yaml_file).collectEntries { k, v -> [k.tokenize(':')[-1], v] } + return yaml.dumpAsMap(versions).trim() +} + +// +// Get workflow version for pipeline +// +def workflowVersionToYAML() { + return """ + Workflow: + ${workflow.manifest.name}: ${getWorkflowVersion()} + Nextflow: ${workflow.nextflow.version} + """.stripIndent().trim() +} + +// +// Get channel of software versions used in pipeline in YAML format +// +def softwareVersionsToYAML(ch_versions) { + return ch_versions.unique().map { version -> processVersionsFromYAML(version) }.unique().mix(Channel.of(workflowVersionToYAML())) +} + +// +// Get workflow summary for MultiQC +// +def paramsSummaryMultiqc(summary_params) { + def summary_section = '' + summary_params + .keySet() + .each { group -> + def group_params = summary_params.get(group) + // This gets the parameters of that particular group + if (group_params) { + summary_section += "

    ${group}

    \n" + summary_section += "
    \n" + group_params + .keySet() + .sort() + .each { param -> + summary_section += "
    ${param}
    ${group_params.get(param) ?: 'N/A'}
    \n" + } + summary_section += "
    \n" + } + } + + def yaml_file_text = "id: '${workflow.manifest.name.replace('/', '-')}-summary'\n" as String + yaml_file_text += "description: ' - this information is collected when the pipeline is started.'\n" + yaml_file_text += "section_name: '${workflow.manifest.name} Workflow Summary'\n" + yaml_file_text += "section_href: 'https://github.com/${workflow.manifest.name}'\n" + yaml_file_text += "plot_type: 'html'\n" + yaml_file_text += "data: |\n" + yaml_file_text += "${summary_section}" + + return yaml_file_text +} + +// +// nf-core logo +// +def nfCoreLogo(monochrome_logs=true) { + def colors = logColours(monochrome_logs) as Map + String.format( + """\n + ${dashedLine(monochrome_logs)} + ${colors.green},--.${colors.black}/${colors.green},-.${colors.reset} + ${colors.blue} ___ __ __ __ ___ ${colors.green}/,-._.--~\'${colors.reset} + ${colors.blue} |\\ | |__ __ / ` / \\ |__) |__ ${colors.yellow}} {${colors.reset} + ${colors.blue} | \\| | \\__, \\__/ | \\ |___ ${colors.green}\\`-._,-`-,${colors.reset} + ${colors.green}`._,._,\'${colors.reset} + ${colors.purple} ${workflow.manifest.name} ${getWorkflowVersion()}${colors.reset} + ${dashedLine(monochrome_logs)} + """.stripIndent() + ) +} + +// +// Return dashed line +// +def dashedLine(monochrome_logs=true) { + def colors = logColours(monochrome_logs) as Map + return "-${colors.dim}----------------------------------------------------${colors.reset}-" +} + +// +// ANSII colours used for terminal logging +// +def logColours(monochrome_logs=true) { + def colorcodes = [:] as Map + + // Reset / Meta + colorcodes['reset'] = monochrome_logs ? '' : "\033[0m" + colorcodes['bold'] = monochrome_logs ? '' : "\033[1m" + colorcodes['dim'] = monochrome_logs ? '' : "\033[2m" + colorcodes['underlined'] = monochrome_logs ? '' : "\033[4m" + colorcodes['blink'] = monochrome_logs ? '' : "\033[5m" + colorcodes['reverse'] = monochrome_logs ? '' : "\033[7m" + colorcodes['hidden'] = monochrome_logs ? '' : "\033[8m" + + // Regular Colors + colorcodes['black'] = monochrome_logs ? '' : "\033[0;30m" + colorcodes['red'] = monochrome_logs ? '' : "\033[0;31m" + colorcodes['green'] = monochrome_logs ? '' : "\033[0;32m" + colorcodes['yellow'] = monochrome_logs ? '' : "\033[0;33m" + colorcodes['blue'] = monochrome_logs ? '' : "\033[0;34m" + colorcodes['purple'] = monochrome_logs ? '' : "\033[0;35m" + colorcodes['cyan'] = monochrome_logs ? '' : "\033[0;36m" + colorcodes['white'] = monochrome_logs ? '' : "\033[0;37m" + + // Bold + colorcodes['bblack'] = monochrome_logs ? '' : "\033[1;30m" + colorcodes['bred'] = monochrome_logs ? '' : "\033[1;31m" + colorcodes['bgreen'] = monochrome_logs ? '' : "\033[1;32m" + colorcodes['byellow'] = monochrome_logs ? '' : "\033[1;33m" + colorcodes['bblue'] = monochrome_logs ? '' : "\033[1;34m" + colorcodes['bpurple'] = monochrome_logs ? '' : "\033[1;35m" + colorcodes['bcyan'] = monochrome_logs ? '' : "\033[1;36m" + colorcodes['bwhite'] = monochrome_logs ? '' : "\033[1;37m" + + // Underline + colorcodes['ublack'] = monochrome_logs ? '' : "\033[4;30m" + colorcodes['ured'] = monochrome_logs ? '' : "\033[4;31m" + colorcodes['ugreen'] = monochrome_logs ? '' : "\033[4;32m" + colorcodes['uyellow'] = monochrome_logs ? '' : "\033[4;33m" + colorcodes['ublue'] = monochrome_logs ? '' : "\033[4;34m" + colorcodes['upurple'] = monochrome_logs ? '' : "\033[4;35m" + colorcodes['ucyan'] = monochrome_logs ? '' : "\033[4;36m" + colorcodes['uwhite'] = monochrome_logs ? '' : "\033[4;37m" + + // High Intensity + colorcodes['iblack'] = monochrome_logs ? '' : "\033[0;90m" + colorcodes['ired'] = monochrome_logs ? '' : "\033[0;91m" + colorcodes['igreen'] = monochrome_logs ? '' : "\033[0;92m" + colorcodes['iyellow'] = monochrome_logs ? '' : "\033[0;93m" + colorcodes['iblue'] = monochrome_logs ? '' : "\033[0;94m" + colorcodes['ipurple'] = monochrome_logs ? '' : "\033[0;95m" + colorcodes['icyan'] = monochrome_logs ? '' : "\033[0;96m" + colorcodes['iwhite'] = monochrome_logs ? '' : "\033[0;97m" + + // Bold High Intensity + colorcodes['biblack'] = monochrome_logs ? '' : "\033[1;90m" + colorcodes['bired'] = monochrome_logs ? '' : "\033[1;91m" + colorcodes['bigreen'] = monochrome_logs ? '' : "\033[1;92m" + colorcodes['biyellow'] = monochrome_logs ? '' : "\033[1;93m" + colorcodes['biblue'] = monochrome_logs ? '' : "\033[1;94m" + colorcodes['bipurple'] = monochrome_logs ? '' : "\033[1;95m" + colorcodes['bicyan'] = monochrome_logs ? '' : "\033[1;96m" + colorcodes['biwhite'] = monochrome_logs ? '' : "\033[1;97m" + + return colorcodes +} + +// +// Attach the multiqc report to email +// +def attachMultiqcReport(multiqc_report) { + def mqc_report = null + try { + if (workflow.success) { + mqc_report = multiqc_report.getVal() + if (mqc_report.getClass() == ArrayList && mqc_report.size() >= 1) { + if (mqc_report.size() > 1) { + log.warn("[${workflow.manifest.name}] Found multiple reports from process 'MULTIQC', will use only one") + } + mqc_report = mqc_report[0] + } + } + } + catch (Exception all) { + if (multiqc_report) { + log.warn("[${workflow.manifest.name}] Could not attach MultiQC report to summary email") + } + } + return mqc_report +} + +// +// Construct and send completion email +// +def completionEmail(summary_params, email, email_on_fail, plaintext_email, outdir, monochrome_logs=true, multiqc_report=null) { + + // Set up the e-mail variables + def subject = "[${workflow.manifest.name}] Successful: ${workflow.runName}" + if (!workflow.success) { + subject = "[${workflow.manifest.name}] FAILED: ${workflow.runName}" + } + + def summary = [:] + summary_params + .keySet() + .sort() + .each { group -> + summary << summary_params[group] + } + + def misc_fields = [:] + misc_fields['Date Started'] = workflow.start + misc_fields['Date Completed'] = workflow.complete + misc_fields['Pipeline script file path'] = workflow.scriptFile + misc_fields['Pipeline script hash ID'] = workflow.scriptId + if (workflow.repository) { + misc_fields['Pipeline repository Git URL'] = workflow.repository + } + if (workflow.commitId) { + misc_fields['Pipeline repository Git Commit'] = workflow.commitId + } + if (workflow.revision) { + misc_fields['Pipeline Git branch/tag'] = workflow.revision + } + misc_fields['Nextflow Version'] = workflow.nextflow.version + misc_fields['Nextflow Build'] = workflow.nextflow.build + misc_fields['Nextflow Compile Timestamp'] = workflow.nextflow.timestamp + + def email_fields = [:] + email_fields['version'] = getWorkflowVersion() + email_fields['runName'] = workflow.runName + email_fields['success'] = workflow.success + email_fields['dateComplete'] = workflow.complete + email_fields['duration'] = workflow.duration + email_fields['exitStatus'] = workflow.exitStatus + email_fields['errorMessage'] = (workflow.errorMessage ?: 'None') + email_fields['errorReport'] = (workflow.errorReport ?: 'None') + email_fields['commandLine'] = workflow.commandLine + email_fields['projectDir'] = workflow.projectDir + email_fields['summary'] = summary << misc_fields + + // On success try attach the multiqc report + def mqc_report = attachMultiqcReport(multiqc_report) + + // Check if we are only sending emails on failure + def email_address = email + if (!email && email_on_fail && !workflow.success) { + email_address = email_on_fail + } + + // Render the TXT template + def engine = new groovy.text.GStringTemplateEngine() + def tf = new File("${workflow.projectDir}/assets/email_template.txt") + def txt_template = engine.createTemplate(tf).make(email_fields) + def email_txt = txt_template.toString() + + // Render the HTML template + def hf = new File("${workflow.projectDir}/assets/email_template.html") + def html_template = engine.createTemplate(hf).make(email_fields) + def email_html = html_template.toString() + + // Render the sendmail template + def max_multiqc_email_size = (params.containsKey('max_multiqc_email_size') ? params.max_multiqc_email_size : 0) as nextflow.util.MemoryUnit + def smail_fields = [email: email_address, subject: subject, email_txt: email_txt, email_html: email_html, projectDir: "${workflow.projectDir}", mqcFile: mqc_report, mqcMaxSize: max_multiqc_email_size.toBytes()] + def sf = new File("${workflow.projectDir}/assets/sendmail_template.txt") + def sendmail_template = engine.createTemplate(sf).make(smail_fields) + def sendmail_html = sendmail_template.toString() + + // Send the HTML e-mail + def colors = logColours(monochrome_logs) as Map + if (email_address) { + try { + if (plaintext_email) { +new org.codehaus.groovy.GroovyException('Send plaintext e-mail, not HTML') } + // Try to send HTML e-mail using sendmail + def sendmail_tf = new File(workflow.launchDir.toString(), ".sendmail_tmp.html") + sendmail_tf.withWriter { w -> w << sendmail_html } + ['sendmail', '-t'].execute() << sendmail_html + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.green} Sent summary e-mail to ${email_address} (sendmail)-") + } + catch (Exception all) { + // Catch failures and try with plaintext + def mail_cmd = ['mail', '-s', subject, '--content-type=text/html', email_address] + mail_cmd.execute() << email_html + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.green} Sent summary e-mail to ${email_address} (mail)-") + } + } + + // Write summary e-mail HTML to a file + def output_hf = new File(workflow.launchDir.toString(), ".pipeline_report.html") + output_hf.withWriter { w -> w << email_html } + nextflow.extension.FilesEx.copyTo(output_hf.toPath(), "${outdir}/pipeline_info/pipeline_report.html") + output_hf.delete() + + // Write summary e-mail TXT to a file + def output_tf = new File(workflow.launchDir.toString(), ".pipeline_report.txt") + output_tf.withWriter { w -> w << email_txt } + nextflow.extension.FilesEx.copyTo(output_tf.toPath(), "${outdir}/pipeline_info/pipeline_report.txt") + output_tf.delete() +} + +// +// Print pipeline summary on completion +// +def completionSummary(monochrome_logs=true) { + def colors = logColours(monochrome_logs) as Map + if (workflow.success) { + if (workflow.stats.ignoredCount == 0) { + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.green} Pipeline completed successfully${colors.reset}-") + } + else { + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.yellow} Pipeline completed successfully, but with errored process(es) ${colors.reset}-") + } + } + else { + log.info("-${colors.purple}[${workflow.manifest.name}]${colors.red} Pipeline completed with errors${colors.reset}-") + } +} + +// +// Construct and send a notification to a web server as JSON e.g. Microsoft Teams and Slack +// +def imNotification(summary_params, hook_url) { + def summary = [:] + summary_params + .keySet() + .sort() + .each { group -> + summary << summary_params[group] + } + + def misc_fields = [:] + misc_fields['start'] = workflow.start + misc_fields['complete'] = workflow.complete + misc_fields['scriptfile'] = workflow.scriptFile + misc_fields['scriptid'] = workflow.scriptId + if (workflow.repository) { + misc_fields['repository'] = workflow.repository + } + if (workflow.commitId) { + misc_fields['commitid'] = workflow.commitId + } + if (workflow.revision) { + misc_fields['revision'] = workflow.revision + } + misc_fields['nxf_version'] = workflow.nextflow.version + misc_fields['nxf_build'] = workflow.nextflow.build + misc_fields['nxf_timestamp'] = workflow.nextflow.timestamp + + def msg_fields = [:] + msg_fields['version'] = getWorkflowVersion() + msg_fields['runName'] = workflow.runName + msg_fields['success'] = workflow.success + msg_fields['dateComplete'] = workflow.complete + msg_fields['duration'] = workflow.duration + msg_fields['exitStatus'] = workflow.exitStatus + msg_fields['errorMessage'] = (workflow.errorMessage ?: 'None') + msg_fields['errorReport'] = (workflow.errorReport ?: 'None') + msg_fields['commandLine'] = workflow.commandLine.replaceFirst(/ +--hook_url +[^ ]+/, "") + msg_fields['projectDir'] = workflow.projectDir + msg_fields['summary'] = summary << misc_fields + + // Render the JSON template + def engine = new groovy.text.GStringTemplateEngine() + // Different JSON depending on the service provider + // Defaults to "Adaptive Cards" (https://adaptivecards.io), except Slack which has its own format + def json_path = hook_url.contains("hooks.slack.com") ? "slackreport.json" : "adaptivecard.json" + def hf = new File("${workflow.projectDir}/assets/${json_path}") + def json_template = engine.createTemplate(hf).make(msg_fields) + def json_message = json_template.toString() + + // POST + def post = new URL(hook_url).openConnection() + post.setRequestMethod("POST") + post.setDoOutput(true) + post.setRequestProperty("Content-Type", "application/json") + post.getOutputStream().write(json_message.getBytes("UTF-8")) + def postRC = post.getResponseCode() + if (!postRC.equals(200)) { + log.warn(post.getErrorStream().getText()) + } +} diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/meta.yml b/subworkflows/nf-core/utils_nfcore_pipeline/meta.yml new file mode 100644 index 0000000..d08d243 --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/meta.yml @@ -0,0 +1,24 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json +name: "UTILS_NFCORE_PIPELINE" +description: Subworkflow with utility functions specific to the nf-core pipeline template +keywords: + - utility + - pipeline + - initialise + - version +components: [] +input: + - nextflow_cli_args: + type: list + description: | + Nextflow CLI positional arguments +output: + - success: + type: boolean + description: | + Dummy output to indicate success +authors: + - "@adamrtalbot" +maintainers: + - "@adamrtalbot" + - "@maxulysse" diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test new file mode 100644 index 0000000..1dc317f --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test @@ -0,0 +1,134 @@ + +nextflow_function { + + name "Test Functions" + script "../main.nf" + config "subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config" + tag "subworkflows" + tag "subworkflows_nfcore" + tag "utils_nfcore_pipeline" + tag "subworkflows/utils_nfcore_pipeline" + + test("Test Function checkConfigProvided") { + + function "checkConfigProvided" + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function checkProfileProvided") { + + function "checkProfileProvided" + + when { + function { + """ + input[0] = [] + """ + } + } + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function workflowCitation") { + + function "workflowCitation" + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function nfCoreLogo") { + + function "nfCoreLogo" + + when { + function { + """ + input[0] = false + """ + } + } + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function dashedLine") { + + function "dashedLine" + + when { + function { + """ + input[0] = false + """ + } + } + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function without logColours") { + + function "logColours" + + when { + function { + """ + input[0] = true + """ + } + } + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } + + test("Test Function with logColours") { + function "logColours" + + when { + function { + """ + input[0] = false + """ + } + } + + then { + assertAll( + { assert function.success }, + { assert snapshot(function.result).match() } + ) + } + } +} diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test.snap b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test.snap new file mode 100644 index 0000000..1037232 --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.function.nf.test.snap @@ -0,0 +1,166 @@ +{ + "Test Function checkProfileProvided": { + "content": null, + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:03:03.360873" + }, + "Test Function checkConfigProvided": { + "content": [ + true + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:02:59.729647" + }, + "Test Function nfCoreLogo": { + "content": [ + "\n\n-\u001b[2m----------------------------------------------------\u001b[0m-\n \u001b[0;32m,--.\u001b[0;30m/\u001b[0;32m,-.\u001b[0m\n\u001b[0;34m ___ __ __ __ ___ \u001b[0;32m/,-._.--~'\u001b[0m\n\u001b[0;34m |\\ | |__ __ / ` / \\ |__) |__ \u001b[0;33m} {\u001b[0m\n\u001b[0;34m | \\| | \\__, \\__/ | \\ |___ \u001b[0;32m\\`-._,-`-,\u001b[0m\n \u001b[0;32m`._,._,'\u001b[0m\n\u001b[0;35m nextflow_workflow v9.9.9\u001b[0m\n-\u001b[2m----------------------------------------------------\u001b[0m-\n" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:03:10.562934" + }, + "Test Function workflowCitation": { + "content": [ + "If you use nextflow_workflow for your analysis please cite:\n\n* The pipeline\n https://doi.org/10.5281/zenodo.5070524\n\n* The nf-core framework\n https://doi.org/10.1038/s41587-020-0439-x\n\n* Software dependencies\n https://github.com/nextflow_workflow/blob/master/CITATIONS.md" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:03:07.019761" + }, + "Test Function without logColours": { + "content": [ + { + "reset": "", + "bold": "", + "dim": "", + "underlined": "", + "blink": "", + "reverse": "", + "hidden": "", + "black": "", + "red": "", + "green": "", + "yellow": "", + "blue": "", + "purple": "", + "cyan": "", + "white": "", + "bblack": "", + "bred": "", + "bgreen": "", + "byellow": "", + "bblue": "", + "bpurple": "", + "bcyan": "", + "bwhite": "", + "ublack": "", + "ured": "", + "ugreen": "", + "uyellow": "", + "ublue": "", + "upurple": "", + "ucyan": "", + "uwhite": "", + "iblack": "", + "ired": "", + "igreen": "", + "iyellow": "", + "iblue": "", + "ipurple": "", + "icyan": "", + "iwhite": "", + "biblack": "", + "bired": "", + "bigreen": "", + "biyellow": "", + "biblue": "", + "bipurple": "", + "bicyan": "", + "biwhite": "" + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:03:17.969323" + }, + "Test Function dashedLine": { + "content": [ + "-\u001b[2m----------------------------------------------------\u001b[0m-" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:03:14.366181" + }, + "Test Function with logColours": { + "content": [ + { + "reset": "\u001b[0m", + "bold": "\u001b[1m", + "dim": "\u001b[2m", + "underlined": "\u001b[4m", + "blink": "\u001b[5m", + "reverse": "\u001b[7m", + "hidden": "\u001b[8m", + "black": "\u001b[0;30m", + "red": "\u001b[0;31m", + "green": "\u001b[0;32m", + "yellow": "\u001b[0;33m", + "blue": "\u001b[0;34m", + "purple": "\u001b[0;35m", + "cyan": "\u001b[0;36m", + "white": "\u001b[0;37m", + "bblack": "\u001b[1;30m", + "bred": "\u001b[1;31m", + "bgreen": "\u001b[1;32m", + "byellow": "\u001b[1;33m", + "bblue": "\u001b[1;34m", + "bpurple": "\u001b[1;35m", + "bcyan": "\u001b[1;36m", + "bwhite": "\u001b[1;37m", + "ublack": "\u001b[4;30m", + "ured": "\u001b[4;31m", + "ugreen": "\u001b[4;32m", + "uyellow": "\u001b[4;33m", + "ublue": "\u001b[4;34m", + "upurple": "\u001b[4;35m", + "ucyan": "\u001b[4;36m", + "uwhite": "\u001b[4;37m", + "iblack": "\u001b[0;90m", + "ired": "\u001b[0;91m", + "igreen": "\u001b[0;92m", + "iyellow": "\u001b[0;93m", + "iblue": "\u001b[0;94m", + "ipurple": "\u001b[0;95m", + "icyan": "\u001b[0;96m", + "iwhite": "\u001b[0;97m", + "biblack": "\u001b[1;90m", + "bired": "\u001b[1;91m", + "bigreen": "\u001b[1;92m", + "biyellow": "\u001b[1;93m", + "biblue": "\u001b[1;94m", + "bipurple": "\u001b[1;95m", + "bicyan": "\u001b[1;96m", + "biwhite": "\u001b[1;97m" + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:03:21.714424" + } +} \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test new file mode 100644 index 0000000..8940d32 --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test @@ -0,0 +1,29 @@ +nextflow_workflow { + + name "Test Workflow UTILS_NFCORE_PIPELINE" + script "../main.nf" + config "subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config" + workflow "UTILS_NFCORE_PIPELINE" + tag "subworkflows" + tag "subworkflows_nfcore" + tag "utils_nfcore_pipeline" + tag "subworkflows/utils_nfcore_pipeline" + + test("Should run without failures") { + + when { + workflow { + """ + input[0] = [] + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert snapshot(workflow.out).match() } + ) + } + } +} diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test.snap b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test.snap new file mode 100644 index 0000000..859d103 --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/main.workflow.nf.test.snap @@ -0,0 +1,19 @@ +{ + "Should run without failures": { + "content": [ + { + "0": [ + true + ], + "valid_config": [ + true + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "23.10.1" + }, + "timestamp": "2024-02-28T12:03:25.726491" + } +} \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config b/subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config new file mode 100644 index 0000000..d0a926b --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/nextflow.config @@ -0,0 +1,9 @@ +manifest { + name = 'nextflow_workflow' + author = """nf-core""" + homePage = 'https://127.0.0.1' + description = """Dummy pipeline""" + nextflowVersion = '!>=23.04.0' + version = '9.9.9' + doi = 'https://doi.org/10.5281/zenodo.5070524' +} diff --git a/subworkflows/nf-core/utils_nfcore_pipeline/tests/tags.yml b/subworkflows/nf-core/utils_nfcore_pipeline/tests/tags.yml new file mode 100644 index 0000000..ac8523c --- /dev/null +++ b/subworkflows/nf-core/utils_nfcore_pipeline/tests/tags.yml @@ -0,0 +1,2 @@ +subworkflows/utils_nfcore_pipeline: + - subworkflows/nf-core/utils_nfcore_pipeline/** diff --git a/subworkflows/nf-core/utils_nfschema_plugin/main.nf b/subworkflows/nf-core/utils_nfschema_plugin/main.nf new file mode 100644 index 0000000..4994303 --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/main.nf @@ -0,0 +1,46 @@ +// +// Subworkflow that uses the nf-schema plugin to validate parameters and render the parameter summary +// + +include { paramsSummaryLog } from 'plugin/nf-schema' +include { validateParameters } from 'plugin/nf-schema' + +workflow UTILS_NFSCHEMA_PLUGIN { + + take: + input_workflow // workflow: the workflow object used by nf-schema to get metadata from the workflow + validate_params // boolean: validate the parameters + parameters_schema // string: path to the parameters JSON schema. + // this has to be the same as the schema given to `validation.parametersSchema` + // when this input is empty it will automatically use the configured schema or + // "${projectDir}/nextflow_schema.json" as default. This input should not be empty + // for meta pipelines + + main: + + // + // Print parameter summary to stdout. This will display the parameters + // that differ from the default given in the JSON schema + // + if(parameters_schema) { + log.info paramsSummaryLog(input_workflow, parameters_schema:parameters_schema) + } else { + log.info paramsSummaryLog(input_workflow) + } + + // + // Validate the parameters using nextflow_schema.json or the schema + // given via the validation.parametersSchema configuration option + // + if(validate_params) { + if(parameters_schema) { + validateParameters(parameters_schema:parameters_schema) + } else { + validateParameters() + } + } + + emit: + dummy_emit = true +} + diff --git a/subworkflows/nf-core/utils_nfschema_plugin/meta.yml b/subworkflows/nf-core/utils_nfschema_plugin/meta.yml new file mode 100644 index 0000000..f7d9f02 --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/meta.yml @@ -0,0 +1,35 @@ +# yaml-language-server: $schema=https://raw.githubusercontent.com/nf-core/modules/master/subworkflows/yaml-schema.json +name: "utils_nfschema_plugin" +description: Run nf-schema to validate parameters and create a summary of changed parameters +keywords: + - validation + - JSON schema + - plugin + - parameters + - summary +components: [] +input: + - input_workflow: + type: object + description: | + The workflow object of the used pipeline. + This object contains meta data used to create the params summary log + - validate_params: + type: boolean + description: Validate the parameters and error if invalid. + - parameters_schema: + type: string + description: | + Path to the parameters JSON schema. + This has to be the same as the schema given to the `validation.parametersSchema` config + option. When this input is empty it will automatically use the configured schema or + "${projectDir}/nextflow_schema.json" as default. The schema should not be given in this way + for meta pipelines. +output: + - dummy_emit: + type: boolean + description: Dummy emit to make nf-core subworkflows lint happy +authors: + - "@nvnieuwk" +maintainers: + - "@nvnieuwk" diff --git a/subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test b/subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test new file mode 100644 index 0000000..842dc43 --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/tests/main.nf.test @@ -0,0 +1,117 @@ +nextflow_workflow { + + name "Test Subworkflow UTILS_NFSCHEMA_PLUGIN" + script "../main.nf" + workflow "UTILS_NFSCHEMA_PLUGIN" + + tag "subworkflows" + tag "subworkflows_nfcore" + tag "subworkflows/utils_nfschema_plugin" + tag "plugin/nf-schema" + + config "./nextflow.config" + + test("Should run nothing") { + + when { + + params { + test_data = '' + } + + workflow { + """ + validate_params = false + input[0] = workflow + input[1] = validate_params + input[2] = "" + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } + + test("Should validate params") { + + when { + + params { + test_data = '' + outdir = 1 + } + + workflow { + """ + validate_params = true + input[0] = workflow + input[1] = validate_params + input[2] = "" + """ + } + } + + then { + assertAll( + { assert workflow.failed }, + { assert workflow.stdout.any { it.contains('ERROR ~ Validation of pipeline parameters failed!') } } + ) + } + } + + test("Should run nothing - custom schema") { + + when { + + params { + test_data = '' + } + + workflow { + """ + validate_params = false + input[0] = workflow + input[1] = validate_params + input[2] = "${projectDir}/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json" + """ + } + } + + then { + assertAll( + { assert workflow.success } + ) + } + } + + test("Should validate params - custom schema") { + + when { + + params { + test_data = '' + outdir = 1 + } + + workflow { + """ + validate_params = true + input[0] = workflow + input[1] = validate_params + input[2] = "${projectDir}/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json" + """ + } + } + + then { + assertAll( + { assert workflow.failed }, + { assert workflow.stdout.any { it.contains('ERROR ~ Validation of pipeline parameters failed!') } } + ) + } + } +} diff --git a/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config new file mode 100644 index 0000000..0907ac5 --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow.config @@ -0,0 +1,8 @@ +plugins { + id "nf-schema@2.1.0" +} + +validation { + parametersSchema = "${projectDir}/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json" + monochromeLogs = true +} \ No newline at end of file diff --git a/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json new file mode 100644 index 0000000..331e0d2 --- /dev/null +++ b/subworkflows/nf-core/utils_nfschema_plugin/tests/nextflow_schema.json @@ -0,0 +1,96 @@ +{ + "$schema": "https://json-schema.org/draft/2020-12/schema", + "$id": "https://raw.githubusercontent.com/./master/nextflow_schema.json", + "title": ". pipeline parameters", + "description": "", + "type": "object", + "$defs": { + "input_output_options": { + "title": "Input/output options", + "type": "object", + "fa_icon": "fas fa-terminal", + "description": "Define where the pipeline should find input data and save output data.", + "required": ["outdir"], + "properties": { + "validate_params": { + "type": "boolean", + "description": "Validate parameters?", + "default": true, + "hidden": true + }, + "outdir": { + "type": "string", + "format": "directory-path", + "description": "The output directory where the results will be saved. You have to use absolute paths to storage on Cloud infrastructure.", + "fa_icon": "fas fa-folder-open" + }, + "test_data_base": { + "type": "string", + "default": "https://raw.githubusercontent.com/nf-core/test-datasets/modules", + "description": "Base for test data directory", + "hidden": true + }, + "test_data": { + "type": "string", + "description": "Fake test data param", + "hidden": true + } + } + }, + "generic_options": { + "title": "Generic options", + "type": "object", + "fa_icon": "fas fa-file-import", + "description": "Less common options for the pipeline, typically set in a config file.", + "help_text": "These options are common to all nf-core pipelines and allow you to customise some of the core preferences for how the pipeline runs.\n\nTypically these options would be set in a Nextflow config file loaded for all pipeline runs, such as `~/.nextflow/config`.", + "properties": { + "help": { + "type": "boolean", + "description": "Display help text.", + "fa_icon": "fas fa-question-circle", + "hidden": true + }, + "version": { + "type": "boolean", + "description": "Display version and exit.", + "fa_icon": "fas fa-question-circle", + "hidden": true + }, + "logo": { + "type": "boolean", + "default": true, + "description": "Display nf-core logo in console output.", + "fa_icon": "fas fa-image", + "hidden": true + }, + "singularity_pull_docker_container": { + "type": "boolean", + "description": "Pull Singularity container from Docker?", + "hidden": true + }, + "publish_dir_mode": { + "type": "string", + "default": "copy", + "description": "Method used to save pipeline results to output directory.", + "help_text": "The Nextflow `publishDir` option specifies which intermediate files should be saved to the output directory. This option tells the pipeline what method should be used to move these files. See [Nextflow docs](https://www.nextflow.io/docs/latest/process.html#publishdir) for details.", + "fa_icon": "fas fa-copy", + "enum": ["symlink", "rellink", "link", "copy", "copyNoFollow", "move"], + "hidden": true + }, + "monochrome_logs": { + "type": "boolean", + "description": "Use monochrome_logs", + "hidden": true + } + } + } + }, + "allOf": [ + { + "$ref": "#/$defs/input_output_options" + }, + { + "$ref": "#/$defs/generic_options" + } + ] +} diff --git a/workflows/build_references.nf b/workflows/build_references.nf deleted file mode 100644 index 9af407d..0000000 --- a/workflows/build_references.nf +++ /dev/null @@ -1,99 +0,0 @@ -/* -======================================================================================== - VALIDATE INPUTS -======================================================================================== -*/ - -/* -======================================================================================== - IMPORT LOCAL MODULES/SUBWORKFLOWS -======================================================================================== -*/ - -include { WGET as DOWNLOAD_FASTA } from '../modules/local/wget/main' -include { WGET as DOWNLOAD_GTF } from '../modules/local/wget/main' -include { GUNZIP as GUNZIP_FASTA } from '../modules/nf-core/gunzip/main' -include { GUNZIP as GUNZIP_GTF } from '../modules/nf-core/gunzip/main' -include { ERCC_CREATE } from '../modules/local/ercc/main' -include { CAT_CAT as CAT_FASTA } from '../modules/nf-core/cat/cat/main' -include { BOWTIE2_BUILD } from '../modules/nf-core/bowtie2/build/main' -include { STAR_GENOMEGENERATE } from '../modules/nf-core/star/genomegenerate/main' -include { CUSTOM_DUMPSOFTWAREVERSIONS } from '../modules/nf-core/custom/dumpsoftwareversions/main' - -/* -======================================================================================== - RUN MAIN WORKFLOW -======================================================================================== -*/ - -workflow BUILD_REFERENCES { - - ch_versions = Channel.empty() - - // download references - fasta = params.genomes[params.genome].fasta.split('/')[-1] - DOWNLOAD_FASTA ( - params.genomes[params.genome].fasta_url, - "_" + fasta - ) - DOWNLOAD_GTF ( - params.genomes[params.genome].gtf_url, - params.genomes[params.genome].gtf.split('/')[-1] - ) - - // uncompress - ch_fasta = GUNZIP_FASTA ( DOWNLOAD_FASTA.out.file ) - .gunzip - .map { meta, fasta -> fasta } - ch_gtf = GUNZIP_GTF ( DOWNLOAD_GTF.out.file ).gunzip - - // create ERCC FASTA - ch_ercc = ERCC_CREATE( Channel.from("$projectDir/data/spike-seq.txt") ).fasta - - ch_fastas = ch_fasta.merge(ch_ercc) - .map{ it -> [ ["id": "${fasta - '.fa'}"], it ] } - - ch_genome = CAT_FASTA ( ch_fastas ).file_out - - // build bowtie2 index - BOWTIE2_BUILD( ch_genome ) - - // build STAR index for velocity - if (params.velocity) { - STAR_GENOMEGENERATE( ch_genome.map{ meta, fasta -> fasta }, ch_gtf.map{ meta, gtf -> gtf } ) - ch_versions = ch_versions.mix(STAR_GENOMEGENERATE.out.versions) - } - - // gather versions - CUSTOM_DUMPSOFTWAREVERSIONS ( - ch_versions - .mix(DOWNLOAD_FASTA.out.versions) - .mix(GUNZIP_FASTA.out.versions) - .mix(GUNZIP_GTF.out.versions) - .mix(ERCC_CREATE.out.versions) - .mix(CAT_FASTA.out.versions) - .mix(BOWTIE2_BUILD.out.versions) - .unique() - .collectFile(name: 'collated_versions.yml') - ) - -} - -/* -======================================================================================== - COMPLETION EMAIL AND SUMMARY -======================================================================================== -*/ - -workflow.onComplete { - if (params.email || params.email_on_fail) { - NfcoreTemplate.email(workflow, params, summary_params, projectDir, log, multiqc_report) - } - NfcoreTemplate.summary(workflow, params, log) -} - -/* -======================================================================================== - THE END -======================================================================================== -*/ diff --git a/workflows/marsseq.nf b/workflows/marsseq.nf index 67375cf..25d1107 100644 --- a/workflows/marsseq.nf +++ b/workflows/marsseq.nf @@ -1,69 +1,23 @@ /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - PRINT PARAMS SUMMARY + IMPORT MODULES / SUBWORKFLOWS / FUNCTIONS ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ +include { FASTQC } from '../modules/nf-core/fastqc/main' +include { MULTIQC } from '../modules/nf-core/multiqc/main' +include { paramsSummaryMap } from 'plugin/nf-schema' +include { paramsSummaryMultiqc } from '../subworkflows/nf-core/utils_nfcore_pipeline' +include { softwareVersionsToYAML } from '../subworkflows/nf-core/utils_nfcore_pipeline' +include { methodsDescriptionText } from '../subworkflows/local/utils_nfcore_marsseq_pipeline' -include { paramsSummaryLog; paramsSummaryMap } from 'plugin/nf-validation' - -def logo = NfcoreTemplate.logo(workflow, params.monochrome_logs) -def citation = '\n' + WorkflowMain.citation(workflow) + '\n' -def summary_params = paramsSummaryMap(workflow) - -// Print parameter summary log to screen -log.info logo + paramsSummaryLog(workflow) + citation - -WorkflowMarsseq.initialise(params, log) - -// Check input path parameters to see if they exist -def checkPathParamList = [ params.input, params.multiqc_config, params.fasta, params.gtf ] -for (param in checkPathParamList) { if (param && !params.build_references) { file(param, checkIfExists: true) } } - -/* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - CONFIG FILES -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -*/ - -ch_multiqc_config = Channel.fromPath("$projectDir/assets/multiqc_config.yml", checkIfExists: true) -ch_multiqc_custom_config = params.multiqc_config ? Channel.fromPath( params.multiqc_config, checkIfExists: true ) : Channel.empty() -ch_multiqc_logo = params.multiqc_logo ? Channel.fromPath( params.multiqc_logo, checkIfExists: true ) : Channel.empty() -ch_multiqc_custom_methods_description = params.multiqc_methods_description ? file(params.multiqc_methods_description, checkIfExists: true) : file("$projectDir/assets/methods_description_template.yml", checkIfExists: true) - -/* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - IMPORT LOCAL MODULES/SUBWORKFLOWS -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -*/ - -// -// MODULE: Local to the pipeline -// include { CAT_CAT as MERGE_READS } from '../modules/nf-core/cat/cat/main' include { QC_REPORT } from '../modules/local/qc/report/main' -// -// SUBWORKFLOW: Consisting of a mix of local and nf-core/modules -// -include { INPUT_CHECK } from '../subworkflows/local/input_check' -include { PREPARE_PIPELINE } from '../subworkflows/local/prepare_pipeline' -include { LABEL_READS } from '../subworkflows/local/label_reads' -include { ALIGN_READS } from '../subworkflows/local/align_reads' -include { DEMULTIPLEX_READS } from '../subworkflows/local/demultiplex_reads' -include { VELOCITY } from '../subworkflows/local/velocity' - -/* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - IMPORT NF-CORE MODULES/SUBWORKFLOWS -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -*/ - -// -// MODULE: Installed directly from nf-core/modules -// -include { FASTQC } from '../modules/nf-core/fastqc/main' -include { MULTIQC } from '../modules/nf-core/multiqc/main' -include { CUSTOM_DUMPSOFTWAREVERSIONS } from '../modules/nf-core/custom/dumpsoftwareversions/main' +include { ALIGN_READS } from '../subworkflows/local/align_reads' +include { LABEL_READS } from '../subworkflows/local/label_reads' +include { PREPARE_PIPELINE } from '../subworkflows/local/prepare_pipeline' +include { DEMULTIPLEX_READS } from '../subworkflows/local/demultiplex_reads' +include { VELOCITY } from '../subworkflows/local/velocity' /* ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ @@ -71,153 +25,164 @@ include { CUSTOM_DUMPSOFTWAREVERSIONS } from '../modules/nf-core/custom/dumpsoft ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ */ -// Info required for completion email and summary -def multiqc_report = [] +// Required files for the pipeline +ercc_regions = file("$projectDir/data/ercc-regions.tsv") +ch_oligos = Channel.fromPath("$projectDir/data/oligos.txt", checkIfExists: true) +ch_spike_seq = Channel.fromPath("$projectDir/data/spike-seq.txt", checkIfExists: true) +ch_spike_concentrations = Channel.fromPath("$projectDir/data/spike-concentrations.txt", checkIfExists: true) workflow MARSSEQ { - ch_versions = Channel.empty() - ch_multiqc_files = Channel.empty() - ch_fasta = file(params.fasta, checkIfExists: true) - ch_gtf = file(params.gtf, checkIfExists: true) - ch_bowtie_index = file(params.bowtie2_index, checkIfExists: true) - ch_star_index = file(params.star_index, checkIfExists: true) - ch_ercc_regions = Channel.fromPath("$projectDir/data/ercc-regions.tsv") - ch_oligos = Channel.fromPath("$projectDir/data/oligos.txt") - ch_spike_seq = Channel.fromPath("$projectDir/data/spike-seq.txt") - ch_spike_concentrations = Channel.fromPath("$projectDir/data/spike-concentrations.txt") + take: + ch_samplesheet // channel: samplesheet read in from --input (ch_reads) + aligner // string + fasta // channel: [ meta, file(fasta) ] + gtf // channel: [ meta, file(gtf) ] + bowtie2_index // channel: [ meta, index ] + star_index // channel: [ meta, index ] + ch_versions // channel - // - // SUBWORKFLOW: Read in samplesheet, validate and stage input files - // - INPUT_CHECK ( - file(params.input) - ) - ch_versions = ch_versions.mix(INPUT_CHECK.out.versions) - // TODO: OPTIONAL, you can use nf-validation plugin to create an input channel from the samplesheet with Channel.fromSamplesheet("input") - // See the documentation https://nextflow-io.github.io/nf-validation/samplesheets/fromSamplesheet/ - // ! There is currently no tooling to help you write a sample sheet schema + main: + + ch_multiqc_files = Channel.empty() // // MODULE: Run FastQC // FASTQC ( - INPUT_CHECK.out.reads + ch_samplesheet ) - ch_versions = ch_versions.mix(FASTQC.out.versions) + ch_multiqc_files = ch_multiqc_files.mix(FASTQC.out.zip.collect{it[1]}) + ch_versions = ch_versions.mix(FASTQC.out.versions.first()) PREPARE_PIPELINE ( - INPUT_CHECK.out.reads.map { it[0].amp_batches }, - INPUT_CHECK.out.reads.map { it[0].seq_batches }, - INPUT_CHECK.out.reads.map { it[0].well_cells }, - ch_gtf, - ch_ercc_regions, - INPUT_CHECK.out.reads + ch_samplesheet.map { it[0].amp_batches }, + ch_samplesheet.map { it[0].seq_batches }, + ch_samplesheet.map { it[0].well_cells }, + gtf, + ercc_regions, + ch_samplesheet ) ch_versions = ch_versions.mix(PREPARE_PIPELINE.out.versions) - LABEL_READS ( - ch_oligos, - PREPARE_PIPELINE.out.amp_batches, - PREPARE_PIPELINE.out.seq_batches, - PREPARE_PIPELINE.out.reads - ) - ch_versions = ch_versions.mix(LABEL_READS.out.versions) - - ALIGN_READS ( LABEL_READS.out.read, ch_bowtie_index, LABEL_READS.out.qc ) - ch_versions = ch_versions.mix(ALIGN_READS.out.versions) - - // merge sam files into one file - ch_aligned_reads = ALIGN_READS.out.reads - .map { meta, sam -> [ meta.id, sam ] } - .groupTuple(by: [0], sort: { it.name }) - .map { batch, sams -> [ [ "id": batch ], sams ] } - - // merged aligned SAM files - MERGE_READS ( ch_aligned_reads ) - ch_versions = ch_versions.mix(MERGE_READS.out.versions) - - DEMULTIPLEX_READS ( - MERGE_READS.out.file_out, - PREPARE_PIPELINE.out.amp_batches, - PREPARE_PIPELINE.out.seq_batches, - PREPARE_PIPELINE.out.wells_cells, - PREPARE_PIPELINE.out.gene_intervals, - ch_spike_seq, - ch_spike_concentrations, - ch_oligos - ) - ch_versions = ch_versions.mix(DEMULTIPLEX_READS.out.versions) + if (aligner.contains('bowtie2')) { - QC_REPORT ( - DEMULTIPLEX_READS.out.qc_rd.map { meta, rds -> [ ["id": meta.id], rds ] }.groupTuple(), - DEMULTIPLEX_READS.out.qc_pdf.map { meta, pdf -> [ ["id": meta.id], pdf ] }.groupTuple(), - PREPARE_PIPELINE.out.amp_batches, - PREPARE_PIPELINE.out.wells_cells - ) - ch_versions = ch_versions.mix(QC_REPORT.out.versions) + LABEL_READS ( + ch_oligos, + PREPARE_PIPELINE.out.amp_batches, + PREPARE_PIPELINE.out.seq_batches, + PREPARE_PIPELINE.out.reads + ) + ch_versions = ch_versions.mix(LABEL_READS.out.versions) + + ALIGN_READS ( LABEL_READS.out.read, bowtie2_index, fasta, LABEL_READS.out.qc ) + ch_versions = ch_versions.mix(ALIGN_READS.out.versions) + + // merge sam files into one file + ch_aligned_reads = ALIGN_READS.out.reads + .map { meta, sam -> [ meta.id, sam ] } + .groupTuple(by: [0], sort: { it.name }) + .map { batch, sams -> [ [ "id": batch ], sams ] } + + // merged aligned SAM files + MERGE_READS ( ch_aligned_reads ) + ch_versions = ch_versions.mix(MERGE_READS.out.versions) + + DEMULTIPLEX_READS ( + MERGE_READS.out.file_out, + PREPARE_PIPELINE.out.amp_batches, + PREPARE_PIPELINE.out.seq_batches, + PREPARE_PIPELINE.out.wells_cells, + PREPARE_PIPELINE.out.gene_intervals, + ch_spike_seq, + ch_spike_concentrations, + ch_oligos + ) + ch_versions = ch_versions.mix(DEMULTIPLEX_READS.out.versions) + + QC_REPORT ( + DEMULTIPLEX_READS.out.qc_rd.map { meta, rds -> [ ["id": meta.id], rds ] }.groupTuple(), + DEMULTIPLEX_READS.out.qc_pdf.map { meta, pdf -> [ ["id": meta.id], pdf ] }.groupTuple(), + PREPARE_PIPELINE.out.amp_batches, + PREPARE_PIPELINE.out.wells_cells + ) + ch_versions = ch_versions.mix(QC_REPORT.out.versions) + + } // // MODULE: Velocity // - if (params.velocity) { + if (aligner.contains('star')) { + VELOCITY ( - INPUT_CHECK.out.reads.map { it[0].amp_batches }, - INPUT_CHECK.out.reads.map { it[0].well_cells }, + ch_samplesheet.map { it[0].amp_batches }, + ch_samplesheet.map { it[0].well_cells }, PREPARE_PIPELINE.out.reads, - ch_star_index, - ch_gtf + star_index ) ch_versions = ch_versions.mix(VELOCITY.out.versions) ch_multiqc_files = ch_multiqc_files.mix(VELOCITY.out.catadapt_multiqc.collect{it[1]}.ifEmpty([])) ch_multiqc_files = ch_multiqc_files.mix(VELOCITY.out.star_multiqc.collect{it[1]}.ifEmpty([])) + } - CUSTOM_DUMPSOFTWAREVERSIONS ( - ch_versions.unique().collectFile(name: 'collated_versions.yml') - ) + // + // Collate and save software versions + // + softwareVersionsToYAML(ch_versions) + .collectFile( + storeDir: "${params.outdir}/pipeline_info", + name: 'nf_core_' + 'pipeline_software_' + 'mqc_' + 'versions.yml', + sort: true, + newLine: true + ).set { ch_collated_versions } // // MODULE: MultiQC // - workflow_summary = WorkflowMarsseq.paramsSummaryMultiqc(workflow, summary_params) - ch_workflow_summary = Channel.value(workflow_summary) - - methods_description = WorkflowMarsseq.methodsDescriptionText(workflow, ch_multiqc_custom_methods_description, params) - ch_methods_description = Channel.value(methods_description) - - ch_multiqc_files = ch_multiqc_files - .mix(PREPARE_PIPELINE.out.fastp_multiqc.collect{it[1]}.ifEmpty([])) - .mix(ALIGN_READS.out.bowtie2_multiqc.collect{it[1]}.ifEmpty([])) - .mix(ch_workflow_summary.collectFile(name: 'workflow_summary_mqc.yaml')) - .mix(ch_methods_description.collectFile(name: 'methods_description_mqc.yaml')) - .mix(CUSTOM_DUMPSOFTWAREVERSIONS.out.mqc_yml.collect()) - .mix(FASTQC.out.zip.collect{it[1]}.ifEmpty([])) + ch_multiqc_config = Channel.fromPath( + "$projectDir/assets/multiqc_config.yml", checkIfExists: true) + ch_multiqc_custom_config = params.multiqc_config ? + Channel.fromPath(params.multiqc_config, checkIfExists: true) : + Channel.empty() + ch_multiqc_logo = params.multiqc_logo ? + Channel.fromPath(params.multiqc_logo, checkIfExists: true) : + Channel.empty() + + summary_params = paramsSummaryMap( + workflow, parameters_schema: "nextflow_schema.json") + ch_workflow_summary = Channel.value(paramsSummaryMultiqc(summary_params)) + ch_multiqc_files = ch_multiqc_files.mix( + ch_workflow_summary.collectFile(name: 'workflow_summary_mqc.yaml')) + ch_multiqc_custom_methods_description = params.multiqc_methods_description ? + file(params.multiqc_methods_description, checkIfExists: true) : + file("$projectDir/assets/methods_description_template.yml", checkIfExists: true) + ch_methods_description = Channel.value( + methodsDescriptionText(ch_multiqc_custom_methods_description)) + + ch_multiqc_files = ch_multiqc_files.mix(ch_collated_versions) + ch_multiqc_files = ch_multiqc_files.mix( + ch_methods_description.collectFile( + name: 'methods_description_mqc.yaml', + sort: true + ) + ) MULTIQC ( ch_multiqc_files.collect(), ch_multiqc_config.toList(), ch_multiqc_custom_config.toList(), - ch_multiqc_logo.toList() + ch_multiqc_logo.toList(), + [], + [] ) - multiqc_report = MULTIQC.out.report.toList() -} -/* -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ - COMPLETION EMAIL AND SUMMARY -~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ -*/ + emit: + multiqc_report = MULTIQC.out.report.toList() // channel: /path/to/multiqc_report.html + versions = ch_versions // channel: [ path(versions.yml) ] -workflow.onComplete { - if (params.email || params.email_on_fail) { - NfcoreTemplate.email(workflow, params, summary_params, projectDir, log, multiqc_report) - } - NfcoreTemplate.summary(workflow, params, log) - if (params.hook_url) { - NfcoreTemplate.IM_notification(workflow, params, summary_params, projectDir, log) - } } /*
    Process Name \\", + " \\ Software Version
    CUSTOM_DUMPSOFTWAREVERSIONSpython3.11.7
    yaml5.4.1
    TOOL1tool10.11.9
    TOOL2tool21.9
    WorkflowNextflow
    File typeConventional base calls
    File typeConventional base calls
    File typeConventional base calls
    File typeConventional base calls
    File typeConventional base calls
    File typeConventional base calls
    File typeConventional base calls
    File typeConventional base calls
    File typeConventional base calls
    File typeConventional base calls