mag_help.txt

$ NXF_SYNTAX_PARSER=v2 nextflow run . --help


 N E X T F L O W   ~  version 26.02.0-edge

Launching `./main.nf` [awesome_ride] revision: 1762f92e8d

WARN: Unrecognized config option 'validation.defaultIgnoreParams'
WARN: Unrecognized config option 'validation.monochromeLogs'

------------------------------------------------------
                                        ,--./,-.
        ___     __   __   __   ___     /,-._.--~'
  |\ | |__  __ /  ` /  \ |__) |__         }  {
  | \| |       \__, \__/ |  \ |___     \`-._,-`-,
                                        `._,._,'
  nf-core/mag 5.5.0dev
------------------------------------------------------
Typical pipeline command:

  nextflow run nf-core/mag -profile <docker/singularity/.../institute> --input samplesheet.csv --outdir <OUTDIR>

help message of that parameter will be printed.  
or `--helpFull`.  

Input/output options
  --input                                [string]  CSV samplesheet file containing information about the samples in the experiment. 
  --single_end                           [boolean] Specifies that the input is single-end reads. 
  --assembly_input                       [string]  Additional input CSV samplesheet containing information about pre-computed assemblies. When set, 
both read pre-processing and assembly are skipped and the pipeline begins at the binning stage. 
 
  --outdir                               [string]  The output directory where the results will be saved. You have to use absolute paths to storage on 
Cloud infrastructure.  
  --email                                [string]  Email address for completion summary. 
  --multiqc_title                        [string]  MultiQC report title. Printed as page header, used for filename if not otherwise specified. 

Generic options
  --multiqc_methods_description          [string]          Custom MultiQC yaml file containing HTML including a methods description. 
  --help                                 [boolean, string] Display the help message. 
  --help_full                            [boolean]         Display the full detailed help message. 
  --show_hidden                          [boolean]         Display hidden parameters in the help message (only works when --help or --help_full are provided). 
 

Reproducibility options
  --megahit_fix_cpu_1                    [boolean] Fix number of CPUs for MEGAHIT to 1. Not increased with retries. 
  --spades_fix_cpus                      [integer] Fix number of CPUs used by SPAdes. Not increased with retries. [default: -1] 
  --spadeshybrid_fix_cpus                [integer] Fix number of CPUs used by SPAdes hybrid. Not increased with retries. [default: -1] 
  --metabat_rng_seed                     [integer] RNG seed for MetaBAT2. [default: 1] 

Quality control for short reads options
  --clip_tool                            [string]  Specify which adapter clipping tool to use.  (accepted: fastp, adapterremoval, trimmomatic) 
[default: fastp]  
  --save_clipped_reads                   [boolean] Specify to save the resulting clipped FASTQ files to --outdir. 
  --reads_minlength                      [integer] The minimum length of reads must have to be retained for downstream analysis. [default: 15] 
  --fastp_qualified_quality              [integer] Minimum phred quality value of a base to be qualified in fastp. [default: 15] 
  --fastp_cut_mean_quality               [integer] The mean quality requirement used for per read sliding window cutting by fastp. [default: 15] 
 
  --fastp_save_trimmed_fail              [boolean] Save reads that fail fastp filtering in a separate file. Not used downstream. 
  --fastp_trim_polyg                     [boolean] Turn on detecting and trimming of poly-G tails 
  --adapterremoval_minquality            [integer] The minimum base quality for low-quality base trimming by AdapterRemoval. [default: 2] 
  --adapterremoval_trim_quality_stretch  [boolean] Turn on quality trimming by consecutive stretch of low quality bases, rather than by window. 
 
  --adapterremoval_adapter1              [string]  Forward read adapter to be trimmed by AdapterRemoval. [default: 
AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG]  
  --adapterremoval_adapter2              [string]  Reverse read adapter to be trimmed by AdapterRemoval for paired end data. [default: 
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT]  
  --host_genome                          [string]  Name of iGenomes reference for host contamination removal. 
  --host_fasta                           [string]  Fasta reference file for host contamination removal. 
  --host_fasta_bowtie2index              [string]  Bowtie2 index directory corresponding to `--host_fasta` reference file for host contamination 
removal.  
  --host_removal_verysensitive           [boolean] Use the `--very-sensitive` instead of the`--sensitive`setting for Bowtie 2 to map reads against the 
host genome.  
  --host_removal_save_ids                [boolean] Save the read IDs of removed host reads. 
  --save_hostremoved_reads               [boolean] Specify to save input FASTQ files with host reads removed to --outdir. 
  --keep_phix                            [boolean] Keep reads similar to the Illumina internal standard PhiX genome. 
  --phix_reference                       [string]  Genome reference used to remove Illumina PhiX contaminant reads. 
  --skip_clipping                        [boolean] Skip read preprocessing using fastp or adapterremoval. 
  --skip_shortread_qc                    [boolean] Skip all default QC steps for short reads (adapter trimming, phiX removal). 
  --save_phixremoved_reads               [boolean] Specify to save input FASTQ files with phiX reads removed to --outdir. 
  --bbnorm                               [boolean] Run BBnorm to normalize sequence depth. 
  --bbnorm_target                        [integer] Set BBnorm target maximum depth to this number. [default: 100] 
  --bbnorm_min                           [integer] Set BBnorm minimum depth to this number. [default: 5] 
  --save_bbnorm_reads                    [boolean] Save normalized read files to output directory. 

Quality control for long reads options
  --skip_adapter_trimming                [boolean] Skip removing adapter sequences from long reads. 
  --skip_longread_filtering              [boolean] Skip filtering long reads. 
  --skip_longread_qc                     [boolean] Skip all default QC steps for long reads (adapter trimming, filtering, removal of lambda sequences). 
 
  --longreads_min_length                 [integer] Discard any read which is shorter than this value. [default: 1000] 
  --longreads_min_quality                [integer] Discard any read which has a mean quality score lower than this value. 
  --longreads_keep_percent               [integer] Keep this percent of bases. [default: 90] 
  --longreads_length_weight              [integer] The higher the more important is read length when choosing the best reads. [default: 10] 
  --keep_lambda                          [boolean] Keep reads similar to the ONT internal standard Escherichia virus Lambda genome. 
  --lambda_reference                     [string]  Genome reference used to remove ONT Lambda contaminant reads. 
  --save_lambdaremoved_reads             [boolean] Specify to save input FASTQ files with lamba reads removed  to --outdir. 
  --save_porechop_reads                  [boolean] Specify to save the resulting clipped FASTQ files to --outdir. 
  --save_filtered_longreads              [boolean] Specify to save the resulting length filtered long read FASTQ files to --outdir. 
  --longread_adaptertrimming_tool        [string]  Specify which long read adapter trimming tool to use.  (accepted: porechop, porechop_abi) 
[default: porechop_abi]  
  --longread_filtering_tool              [string]  Specify which long read filtering tool to use.  (accepted: filtlong, nanoq, chopper) [default: 
filtlong]  

Taxonomic profiling options
  --cat_db                               [string]  Database for taxonomic classification of metagenome assembled genomes. Can be either a zipped file 
or a directory containing the extracted output of such.  
  --cat_db_generate                      [boolean] Generate CAT database. 
  --save_cat_db                          [boolean] Save the CAT database generated when specified by `--cat_db_generate`. 
  --cat_allow_unofficial_lineages        [boolean] Allow unofficial lineages in CAT classification. 
  --cat_classify_unbinned                [boolean] Classify unbinned contigs with CAT (contig mode). 
  --cat_no_suggestive_asterisks          [boolean] Specify to turn off CAT marking in output files most probable hits (when multiple) with an asterix. 
 
  --skip_gtdbtk                          [boolean] Skip the running of GTDB, as well as the automatic download of the database 
  --gtdb_db                              [string]  Specify the location of a GTDBTK database. Can be either an uncompressed directory or a `.tar.gz` 
archive. If not specified will be downloaded for you when GTDBTK or binning QC is not skipped. 
[default: 
https://data.gtdb.aau.ecogenomic.org/releases/release226/226.0/auxillary_files/gtdbtk_package/full_package/gtdbtk_r226_data.tar.gz] 
 
  --gtdbtk_min_completeness              [number]  Min. bin completeness (in %) required to apply GTDB-tk classification. [default: 50] 
  --gtdbtk_max_contamination             [number]  Max. bin contamination (in %) allowed to apply GTDB-tk classification. [default: 10] 
  --gtdbtk_min_perc_aa                   [number]  Min. fraction of AA (in %) in the MSA for bins to be kept. [default: 10] 
  --gtdbtk_min_af                        [number]  Min. alignment fraction to consider closest genome. [default: 0.65] 
  --gtdbtk_pplacer_cpus                  [integer] Number of CPUs used for the by GTDB-Tk run tool pplacer. [default: 1] 
  --gtdbtk_pplacer_useram                [boolean] Speed up pplacer step of GTDB-Tk by loading to memory. 
  --gtdbtk_use_full_tree                 [boolean] Specify to have GTDBTk to use the full bacterial tree rather than the split tree (requires more 
memory!)  
  --gtdbtk_skip_aniscreen                [boolean] Specify to disable fast classification of genomes by ANI using skani in GTDB-Tk. 

Assembly options
  --coassemble_group                     [boolean] Co-assemble samples within one group, instead of assembling each sample separately. 
  --spades_options                       [string]  Additional custom options for SPAdes and SPAdesHybrid. Do not specify `--meta` as this will be added 
for you!  
  --spades_downstreaminput               [string]  Specify whether to use contigs or scaffolds assembled by SPAdes  (accepted: scaffolds, contigs) 
[default: scaffolds]  
  --megahit_options                      [string]  Additional custom options for MEGAHIT. 
  --skip_spades                          [boolean] Skip Illumina-only SPAdes assembly. 
  --skip_spadeshybrid                    [boolean] Skip SPAdes hybrid assembly. 
  --skip_megahit                         [boolean] Skip MEGAHIT assembly. 
  --skip_ale                             [boolean] Skip ALE 
  --skip_quast                           [boolean] Skip metaQUAST. 
  --skip_metamdbg                        [boolean] Skip MetaDBG assembly. 
  --skip_flye                            [boolean] Skip Flye assembly. 

Gene prediction and annotation options
  --skip_prodigal                        [boolean] Skip Prodigal gene prediction 
  --prokka_with_compliance               [boolean] Turn on Prokka complicance mode for truncating contig names for NCBI/ENA compatibility. 
  --prokka_compliance_centre             [string]  Specify sequencing centre name required for Prokka's compliance mode. 
  --skip_prokka                          [boolean] Skip Prokka genome annotation. 
  --prokka_fast_mode                     [boolean] Specify to skip CDS/product searching in Prokka runs 
  --skip_metaeuk                         [boolean] Skip MetaEuk gene prediction and annotation 
  --metaeuk_mmseqs_db                    [string]  A string containing the name of one of the databases listed in the [mmseqs2 
documentation](https://github.com/soedinglab/MMseqs2/wiki#downloading-databases). This database will 
be downloaded and formatted for eukaryotic genome annotation. Incompatible with --metaeuk_db.  
(accepted: UniRef100, UniRef90, UniRef50, UniProtKB, UniProtKB/TrEMBL, UniProtKB/Swiss-Prot, NR, NT, 
GTDB, PDB, ...)  
  --metaeuk_db                           [string]  Path to either a local fasta file of protein sequences, or to a directory containing an 
MMseqs2-formatted database, for annotation of eukaryotic genomes.  
  --save_mmseqs_db                       [boolean] Save the downloaded mmseqs2 database specified in `--metaeuk_mmseqs_db`. 

Virus identification options
  --run_virus_identification             [boolean] Run virus identification. 
  --genomad_db                           [string]  Database for virus classification with geNomad 
  --genomad_min_score                    [number]  Minimum geNomad score for a sequence to be considered viral [default: 0.7] 
  --genomad_splits                       [integer] Number of groups that geNomad's MMSeqs2 databse should be split into (reduced memory requirements) 
[default: 1]  

Binning options
  --binning_map_mode                     [string]  Defines mapping strategy to compute co-abundances for binning, i.e. which samples will be mapped 
against the assembly.  (accepted: all, group, own) [default: group]  
  --skip_binning                         [boolean] Skip metagenome binning entirely 
  --skip_metabat2                        [boolean] Skip MetaBAT2 Binning 
  --skip_maxbin2                         [boolean] Skip MaxBin2 Binning 
  --skip_concoct                         [boolean] Skip CONCOCT Binning 
  --skip_comebin                         [boolean] Skip COMEBin Binning 
  --skip_metabinner                      [boolean] Skip MetaBinner Binning 
  --bin_metabinner_scale                 [string]  Dataset scale for MetaBinner  (accepted: small, large, huge) [default: large] 
  --skip_semibin                         [boolean] Skip SemiBin2 Binning 
  --semibin_rng_seed                     [integer] RNG seed for SemiBin2. [default: 1] 
  --semibin_environment                  [string]  Pre-trained model for SemiBin2 for single sample assemblies  (accepted: human_gut, dog_gut, 
ocean, soil, cat_gut, human_oral, mouse_gut, pig_gut, built_environment, ...) [default: global]  
  --min_contig_size                      [integer] Minimum contig size to be considered for binning and for bin quality check. [default: 1500] 
  --min_length_unbinned_contigs          [integer] Minimal length of contigs that are not part of any bin but treated as individual genome. 
[default: 1000000]  
  --max_unbinned_contigs                 [integer] Maximal number of contigs that are not part of any bin but treated as individual genome. 
[default: 100]  
  --bin_min_size                         [integer] Specify the shortest length a bin should be to retain for downstream processing (in base pairs) 
[default: 0]  
  --bin_max_size                         [integer] Specify the longest length a bin should be to retain for downstream processing (in base pairs). By 
default no limit.  
  --bin_concoct_chunksize                [integer] Specify length of sub-contigs cut up prior CONCOCT binning [default: 10000] 
  --bin_concoct_overlap                  [integer] Specify the overlap between each sub-contig prior CONCOCT binning [default: 0] 
  --bin_concoct_donotconcatlast          [boolean] Specify to not append the last contig less than sub-contig length to the last correct length contig 
 
  --bowtie2_mode                         [string]  Specify alternative Bowtie2 settings for aligning reads back against the assembly. 
  --save_assembly_mapped_reads           [boolean] Save the output of mapping raw reads back to assembled contigs 
  --bin_domain_classification            [boolean] Enable domain-level (prokaryote or eukaryote) classification of bins using Tiara. Processes which 
are domain-specific will then only receive bins matching the domain requirement.  
  --tiara_min_length                     [integer] Minimum contig length for Tiara to use for domain classification. For accurate classification, 
should be longer than 3000 bp. [default: 3000]  
  --exclude_unbins_from_postbinning      [boolean] Exclude unbinned contigs in the post-binning steps (bin QC, taxonomic classification, and annotation 
steps).  
  --longread_percentidentity             [number]  Specify a minimum percent identity filter for long reads mapping back to assembled contigs. 
  --shortread_percentidentity            [number]  Specify a minimum percent identity filter for short reads mapping back to assembled contigs. 
 

Bin quality check options
  --skip_binqc                           [boolean] Disable bin QC with BUSCO, CheckM or CheckM2. 
  --run_busco                            [boolean] Enable running BUSCO during bin QC. 
  --run_checkm                           [boolean] Enable running CheckM during bin QC. 
  --run_checkm2                          [boolean] Enable running CheckM2 during bin QC. 
  --busco_db                             [string]  Download URL, local tar.gz archive, or local uncompressed directory for an *_odb10 or *_odb12 BUSCO 
lineage dataset.  
  --busco_db_lineage                     [string]  Name of the BUSCO *_odb10 or *_odb12 lineage to check against. Additionally supports 'auto', 
'auto_prok' and 'auto_euk' for automatic lineage selection mode. [default: auto]  
  --save_busco_db                        [boolean] Save the used BUSCO lineage datasets provided via `--busco_db`. 
  --busco_clean                          [boolean] Enable clean-up of temporary files created during BUSCO runs. 
  --checkm_db                            [string]  Path to local folder containing already downloaded and uncompressed CheckM database. 
  --save_checkm_data                     [boolean] Save the used CheckM reference files downloaded when not using --checkm_db parameter. 
  --checkm2_db                           [string]  Path to local file of an already downloaded and uncompressed CheckM2 database file (.dmnd file). 
 
  --checkm2_db_version                   [integer] CheckM2 database version number to download (Zenodo record ID, for reference check the canonical 
reference https://zenodo.org/records/5571251, and pick the Zenodo ID of the database version of your 
choice). [default: 14897628]  
  --save_checkm2_data                    [boolean] Save the used CheckM2 reference files downloaded when not using --checkm2_db parameter. 
  --refine_bins_dastool                  [boolean] Turn on bin refinement using DAS Tool. 
  --refine_bins_dastool_threshold        [number]  Specify single-copy gene score threshold for bin refinement. [default: 0.5] 
  --refine_bins_dastool_savecontig2bin   [boolean] Specify to save contig to bin maps used for bin refinement 
  --postbinning_input                    [string]  Specify which binning output is sent for downstream annotation, taxonomic classification, bin 
quality control etc.  (accepted: raw_bins_only, refined_bins_only, both) [default: 
raw_bins_only]  
  --run_gunc                             [boolean] Turn on GUNC genome chimerism checks 
  --gunc_db                              [string]  Specify a path to a pre-downloaded GUNC dmnd database file 
  --gunc_database_type                   [string]  Specify which database to auto-download if not supplying own  (accepted: progenomes, gtdb, 
test_data) [default: progenomes]  
  --gunc_save_db                         [boolean] Save the used GUNC reference files downloaded when not using --gunc_db parameter. 
  --generate_bigmag_file                 [boolean] Make a BIgMAG input file including GUNC results. 

Ancient DNA assembly
  --ancient_dna                          [boolean] Turn on/off the ancient DNA subworkflow 
  --pydamage_accuracy                    [number]  PyDamage accuracy threshold [default: 0.5] 
  --skip_ancient_damagecorrection        [boolean] deactivate damage correction of ancient contigs using variant and consensus calling 
  --freebayes_ploidy                     [integer] Ploidy for variant calling [default: 1] 
  --freebayes_min_basequality            [integer] minimum base quality required for variant calling [default: 20] 
  --freebayes_minallelefreq              [number]  minimum minor allele frequency for considering variants [default: 0.33] 
  --bcftools_view_high_variant_quality   [integer] minimum genotype quality for considering a variant high quality [default: 30] 
  --bcftools_view_medium_variant_quality [integer] minimum genotype quality for considering a variant medium quality [default: 20] 
  --bcftools_view_minimal_allelesupport  [integer] minimum number of bases supporting the alternative allele [default: 3] 
 !! Hiding 22 param(s), use the `--showHidden` parameter to show them !!
------------------------------------------------------

* The pipeline
    https://doi.org/10.1093/nargab/lqac007

* The nf-core framework
    https://doi.org/10.1038/s41587-020-0439-x

* Software dependencies
    https://github.com/nf-core/mag/blob/main/CITATIONS.md