| name | bio-crispr-screens-library-design |
|---|---|
| description | CRISPR library design for genetic screens. Covers sgRNA selection, library composition, control design, and oligo ordering. Use when designing custom sgRNA libraries for knockout, activation, or interference screens. |
| tool_type | python |
| primary_tool | crispor |
Reference examples tested with: BioPython 1.83+, MAGeCK 0.5+, numpy 1.26+, pandas 2.2+
Before using code patterns, verify installed versions match. If versions differ:
- Python:
pip show <package>thenhelp(module.function)to check signatures
If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.
"Design a custom CRISPR library for my screen" → Select optimal sgRNAs for knockout, CRISPRi/a, or base editing libraries with on-target scoring, off-target filtering, and control guide design.
- Python: CRISPOR-based scoring with
BioPythonfor sequence handling
Goal: Score and rank candidate sgRNAs for a target gene based on design quality metrics.
Approach: Scan the gene sequence for PAM sites, extract 20-nt protospacer sequences, score each on GC content, poly-T avoidance, 5' G preference, and length, then return the top-ranked candidates.
import pandas as pd
import numpy as np
from Bio import SeqIO
from Bio.Seq import Seq
def score_sgrna(sequence, pam='NGG'):
'''Score sgRNA based on multiple criteria.'''
scores = {}
gc_content = (sequence.count('G') + sequence.count('C')) / len(sequence)
scores['gc_content'] = 1 - abs(gc_content - 0.5) * 2
if len(sequence) >= 4:
has_poly_t = 'TTTT' in sequence
scores['poly_t'] = 0 if has_poly_t else 1
starts_with_g = sequence.startswith('G')
scores['start_g'] = 1 if starts_with_g else 0.5
scores['length'] = 1 if len(sequence) == 20 else 0.8
overall = np.mean(list(scores.values()))
return overall, scores
def design_sgrnas_for_gene(gene_sequence, n_guides=4, pam='NGG'):
'''Design sgRNAs targeting a gene.'''
candidates = []
pam_pattern = pam.replace('N', '[ACGT]')
import re
for strand in ['+', '-']:
seq = gene_sequence if strand == '+' else str(Seq(gene_sequence).reverse_complement())
for match in re.finditer(f'([ACGT]{{20}})({pam_pattern})', seq):
sgrna = match.group(1)
position = match.start()
if strand == '-':
position = len(seq) - position - 23
score, details = score_sgrna(sgrna)
candidates.append({
'sequence': sgrna,
'pam': match.group(2),
'strand': strand,
'position': position,
'score': score,
'gc_content': (sgrna.count('G') + sgrna.count('C')) / 20,
**details
})
candidates_df = pd.DataFrame(candidates)
candidates_df = candidates_df.sort_values('score', ascending=False)
return candidates_df.head(n_guides)
gene_seq = 'ATGCGATCGATCGATCGATCGAATCGATCGATCGAGGCGATCGATCGATCGATCGAATCGATCGATCGAGGCGATCGATCGATCGATCGAATCGATCGATCGAGG'
guides = design_sgrnas_for_gene(gene_seq, n_guides=5)
print(guides[['sequence', 'position', 'strand', 'score', 'gc_content']])Goal: Assemble a complete sgRNA library targeting a list of genes with appropriate controls.
Approach: Design top-scoring guides for each gene, append non-targeting, essential-control, and safe-harbor-control guides, and compile into an ordered library table.
def design_library(gene_list, guides_per_gene=4, include_controls=True):
'''Design complete library for gene list.'''
library = []
for gene in gene_list:
gene_data = get_gene_sequence(gene)
guides = design_sgrnas_for_gene(gene_data['sequence'], n_guides=guides_per_gene)
for idx, guide in guides.iterrows():
library.append({
'gene': gene,
'gene_id': gene_data.get('ensembl_id', ''),
'guide_number': idx + 1,
'sequence': guide['sequence'],
'pam': guide['pam'],
'position': guide['position'],
'strand': guide['strand'],
'score': guide['score'],
'type': 'targeting'
})
if include_controls:
controls = design_control_guides()
library.extend(controls)
return pd.DataFrame(library)
def get_gene_sequence(gene_name):
'''Fetch gene sequence (placeholder - use Ensembl API or local files).'''
return {
'sequence': 'ATGC' * 250,
'ensembl_id': f'ENSG_{hash(gene_name) % 100000:05d}'
}
genes = ['TP53', 'BRCA1', 'KRAS', 'MYC', 'CDK4']
library = design_library(genes, guides_per_gene=4)
print(f'Library size: {len(library)} guides')
print(f'Genes: {library["gene"].nunique()}')Goal: Design control guide sets for normalization and quality assessment in CRISPR screens.
Approach: Generate random non-targeting sequences with acceptable GC content, add validated guides against known essential genes (positive controls) and safe-harbor loci (negative controls).
def design_control_guides(n_nontargeting=100, n_essential=20, n_nonessential=20):
'''Design control guides for library.'''
controls = []
for i in range(n_nontargeting):
sequence = generate_nontargeting_sequence()
controls.append({
'gene': f'NonTargeting_{i+1}',
'gene_id': '',
'guide_number': 1,
'sequence': sequence,
'pam': 'NGG',
'position': -1,
'strand': '',
'score': 0,
'type': 'non-targeting'
})
essential_genes = ['RPS3', 'RPL11', 'EIF3A', 'POLR2A', 'CDK1']
for gene in essential_genes[:n_essential]:
controls.append({
'gene': gene,
'gene_id': '',
'guide_number': 1,
'sequence': get_validated_guide(gene),
'pam': 'NGG',
'position': 0,
'strand': '+',
'score': 1,
'type': 'essential-control'
})
nonessential_genes = ['AAVS1', 'ROSA26']
for gene in nonessential_genes[:n_nonessential]:
controls.append({
'gene': gene,
'gene_id': '',
'guide_number': 1,
'sequence': get_validated_guide(gene),
'pam': 'NGG',
'position': 0,
'strand': '+',
'score': 1,
'type': 'safe-harbor-control'
})
return controls
def generate_nontargeting_sequence(length=20):
'''Generate random non-targeting sequence.'''
while True:
seq = ''.join(np.random.choice(['A', 'C', 'G', 'T'], length))
gc = (seq.count('G') + seq.count('C')) / length
if 0.4 <= gc <= 0.6 and 'TTTT' not in seq:
return seq
def get_validated_guide(gene):
'''Get validated guide sequence for control gene.'''
validated = {
'RPS3': 'GAGCTTCTTCAGCAGCATGG',
'RPL11': 'GAAACAGGGCATCATCTACG',
'EIF3A': 'GTGCAAGAGGATGATGACAA',
'AAVS1': 'GGGGCCACTAGGGACAGGAT',
'ROSA26': 'GAAGATGGGCGGGAGTCTTC'
}
return validated.get(gene, generate_nontargeting_sequence())Goal: Filter library guides to remove those with excessive off-target genomic matches.
Approach: Align each guide sequence against the genome with Bowtie allowing mismatches, count off-target hits within a mismatch threshold, and remove guides exceeding the maximum.
def check_offtargets(guide_sequence, genome_index, max_mismatches=3):
'''Check for potential off-target sites.'''
from subprocess import run
import tempfile
with tempfile.NamedTemporaryFile(mode='w', suffix='.fa', delete=False) as f:
f.write(f'>guide\n{guide_sequence}\n')
query_file = f.name
result = run(
['bowtie', '-a', '-n', str(max_mismatches), '-l', '20', genome_index, '-f', query_file],
capture_output=True, text=True
)
offtargets = []
for line in result.stdout.strip().split('\n'):
if line:
fields = line.split('\t')
offtargets.append({
'chromosome': fields[2],
'position': int(fields[3]),
'strand': fields[1],
'mismatches': int(fields[7]) if len(fields) > 7 else 0
})
return offtargets
def filter_by_offtargets(library_df, genome_index, max_offtargets=10):
'''Filter library to remove guides with too many off-targets.'''
filtered = []
for _, guide in library_df.iterrows():
offtargets = check_offtargets(guide['sequence'], genome_index)
n_offtargets = len([ot for ot in offtargets if ot['mismatches'] <= 2])
if n_offtargets <= max_offtargets:
guide_dict = guide.to_dict()
guide_dict['n_offtargets'] = n_offtargets
filtered.append(guide_dict)
return pd.DataFrame(filtered)Goal: Generate forward and reverse oligo sequences ready for ordering and cloning into a lentiviral vector.
Approach: Add vector-specific adapter sequences (overhangs for BsmBI or BbsI restriction sites) to each guide and its reverse complement, formatted for the target vector backbone.
def design_oligos(library_df, vector='lentiGuide-Puro'):
'''Design oligos for library cloning.'''
vector_specs = {
'lentiGuide-Puro': {
'forward_prefix': 'CACCG',
'forward_suffix': '',
'reverse_prefix': 'AAAC',
'reverse_suffix': 'C'
},
'pLKO': {
'forward_prefix': 'CCGG',
'forward_suffix': 'CTCGAG',
'reverse_prefix': 'AATTCTCGAG',
'reverse_suffix': ''
}
}
spec = vector_specs.get(vector, vector_specs['lentiGuide-Puro'])
oligos = []
for _, guide in library_df.iterrows():
seq = guide['sequence']
forward = spec['forward_prefix'] + seq + spec['forward_suffix']
reverse = spec['reverse_prefix'] + str(Seq(seq).reverse_complement()) + spec['reverse_suffix']
oligos.append({
'guide_id': f"{guide['gene']}_{guide['guide_number']}",
'gene': guide['gene'],
'guide_sequence': seq,
'forward_oligo': forward,
'reverse_oligo': reverse,
'type': guide.get('type', 'targeting')
})
return pd.DataFrame(oligos)
oligos = design_oligos(library)
oligos.to_csv('library_oligos.csv', index=False)
print(f'Designed {len(oligos)} oligo pairs')def design_array_oligos(library_df, array_format='12K'):
'''Design array oligos for pooled synthesis.'''
formats = {
'12K': {'capacity': 12000, 'length': 200},
'92K': {'capacity': 92000, 'length': 150},
'244K': {'capacity': 244000, 'length': 60}
}
spec = formats[array_format]
primer_5 = 'AGGCTTGGATTTCTATAACTTCGTATAGCATACATTATACGAAGTTAT'
primer_3 = 'ATAACTTCGTATAATGTATGCTATACGAAGTTATCTTGGATTTCTAGA'
scaffold = 'GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC'
array_oligos = []
for _, guide in library_df.iterrows():
full_oligo = primer_5 + guide['sequence'] + scaffold + primer_3
if len(full_oligo) > spec['length']:
print(f"Warning: {guide['gene']} oligo too long for {array_format}")
continue
array_oligos.append({
'id': f"{guide['gene']}_{guide['guide_number']}",
'sequence': full_oligo,
'length': len(full_oligo)
})
if len(array_oligos) > spec['capacity']:
print(f"Warning: Library ({len(array_oligos)}) exceeds {array_format} capacity ({spec['capacity']})")
return pd.DataFrame(array_oligos)
array_oligos = design_array_oligos(library, '92K')
array_oligos.to_csv('array_synthesis.csv', index=False)def qc_library(library_df):
'''Quality control checks for library design.'''
qc = {}
qc['total_guides'] = len(library_df)
qc['unique_genes'] = library_df[library_df['type'] == 'targeting']['gene'].nunique()
qc['guides_per_gene'] = library_df[library_df['type'] == 'targeting'].groupby('gene').size().describe()
gc_contents = library_df['sequence'].apply(lambda x: (x.count('G') + x.count('C')) / len(x))
qc['gc_mean'] = gc_contents.mean()
qc['gc_std'] = gc_contents.std()
qc['gc_range'] = (gc_contents.min(), gc_contents.max())
has_poly_t = library_df['sequence'].apply(lambda x: 'TTTT' in x)
qc['poly_t_count'] = has_poly_t.sum()
type_counts = library_df['type'].value_counts()
qc['control_ratio'] = type_counts.get('non-targeting', 0) / len(library_df)
return qc
qc = qc_library(library)
print('Library QC:')
for key, value in qc.items():
print(f' {key}: {value}')The examples above use SpCas9 with NGG PAM. Alternative systems expand targeting range:
| System | PAM | Use Case |
|---|---|---|
| SpCas9 | NGG | Standard, most validated |
| SpCas9-NG | NG | Relaxed PAM requirement |
| SpRY | NRN/NYN | Near-PAMless, broadest targeting |
| Cas12a (Cpf1) | TTTV | AT-rich regions, staggered cuts |
| SaCas9 | NNGRRT | AAV delivery (smaller gene) |
For alternative PAMs, modify the design_sgrnas_for_gene() function:
# Cas12a example (TTTV PAM, 23nt guide)
def design_cas12a_guides(gene_sequence, n_guides=4):
pam_pattern = 'TTT[ACG]' # TTTV
guide_length = 23
for match in re.finditer(f'({pam_pattern})([ACGT]{{{guide_length}}})', gene_sequence):
pam = match.group(1)
guide = match.group(2)
# Cas12a cuts downstream of guide
# ...- mageck-analysis - Analyze screen results
- crispresso-editing - Validate editing efficiency
- screen-qc - QC sequencing data
- hit-calling - Identify screen hits