name: bio-sequence-slicing description: Slice, extract, and concatenate biological sequences using Biopython. Use when extracting subsequences, joining sequences, or manipulating sequence regions by position. tool_type: python primary_tool: Bio.Seq measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes. allowed-tools:
- read_file
- run_shell_command
Extract, slice, and concatenate sequences using Biopython's Seq objects.
from Bio.Seq import Seqseq = Seq('ATGCGATCG')
seq[0] # 'A' - first base (0-indexed)
seq[-1] # 'G' - last base
seq[3] # 'C' - fourth baseseq = Seq('ATGCGATCGATCG')
seq[0:3] # Seq('ATG') - first 3 bases
seq[3:6] # Seq('CGA') - positions 3-5
seq[:5] # Seq('ATGCG') - first 5
seq[-5:] # Seq('GATCG') - last 5
seq[::2] # Seq('AGGTGTG') - every 2nd base
seq[::-1] # Seq('GCTAGCTAGCGTA') - reversedNote: Slicing returns a Seq object, not a string.
seq1 = Seq('ATGC')
seq2 = Seq('GGGG')
combined = seq1 + seq2 # Seq('ATGCGGGG')Can also concatenate with strings:
seq = Seq('ATGC')
extended = seq + 'NNNN' # Seq('ATGCNNNN')genome = Seq('NNNNATGCGATCGATCGTAANNN')
cds_start, cds_end = 4, 21
cds = genome[cds_start:cds_end]Biology often uses 1-based coordinates. Convert to 0-based:
def extract_1based(seq, start, end):
'''Extract using 1-based inclusive coordinates'''
return seq[start - 1:end]
genome = Seq('ATGCGATCGATCG')
region = extract_1based(genome, 1, 3) # Seq('ATG')def split_codons(seq):
return [seq[i:i+3] for i in range(0, len(seq) - len(seq) % 3, 3)]
seq = Seq('ATGCGATCGATCG')
codons = split_codons(seq) # [Seq('ATG'), Seq('CGA'), ...]def chunk_sequence(seq, size):
return [seq[i:i+size] for i in range(0, len(seq), size)]
seq = Seq('ATGCGATCGATCGATCGATCG')
chunks = chunk_sequence(seq, 10)seqs = [Seq('ATGC'), Seq('GGGG'), Seq('TTTT')]
linker = Seq('NNN')
joined = linker.join(seqs) # Seq('ATGCNNNGGGGNNTTTT')Or manually:
linker = 'NNN'
joined = Seq(linker.join(str(s) for s in seqs))def extract_regions(seq, regions):
'''Extract and concatenate multiple regions'''
return sum((seq[start:end] for start, end in regions), Seq(''))
exon_coords = [(0, 50), (100, 150), (200, 250)]
mrna = extract_regions(genomic_seq, exon_coords)def get_flanking(seq, position, flank_size):
'''Get sequence around a position'''
start = max(0, position - flank_size)
end = min(len(seq), position + flank_size + 1)
return seq[start:end]
seq = Seq('ATGCGATCGATCGATCGATCG')
flanking = get_flanking(seq, 10, 5) # 5 bp on each side of position 10def sliding_windows(seq, window_size, step=1):
for i in range(0, len(seq) - window_size + 1, step):
yield seq[i:i + window_size]
seq = Seq('ATGCGATCGATCG')
for window in sliding_windows(seq, 5, 2):
print(window)from Bio import SeqIO
for record in SeqIO.parse('sequence.gb', 'genbank'):
for feature in record.features:
if feature.type == 'CDS':
cds_seq = feature.extract(record.seq)
print(f'{feature.qualifiers.get("gene", ["?"])[0]}: {cds_seq[:30]}...')from Bio.SeqRecord import SeqRecord
original = SeqRecord(Seq('ATGCGATCGATCGATCG'), id='full', description='Full sequence')
subset = SeqRecord(original.seq[5:15], id='subset', description=f'Positions 5-15 of {original.id}')| System | Position 1 | Example |
|---|---|---|
| 0-based (Python) | Index 0 | seq[0:3] gets positions 0, 1, 2 |
| 1-based (Biology) | Index 1 | Position 1-3 = seq[0:3] |
| 0-based half-open | Start inclusive, end exclusive | Standard Python slicing |
| Error | Cause | Solution |
|---|---|---|
IndexError |
Index out of range | Check sequence length first |
| Unexpected length | Off-by-one error | Remember end index is exclusive |
| Empty result | Start >= end | Check coordinate order |
| Wrong positions | 1-based vs 0-based confusion | Convert coordinates explicitly |
Need to extract or combine sequences?
├── Single position?
│ └── Use indexing: seq[i]
├── Contiguous region?
│ └── Use slicing: seq[start:end]
├── Multiple non-contiguous regions?
│ └── Extract each, concatenate with +
├── Join sequences?
│ ├── No linker: seq1 + seq2
│ └── With linker: linker.join(seqs)
├── Split into parts?
│ └── List comprehension with slicing
└── From GenBank features?
└── Use feature.extract(record.seq)
- seq-objects - Create Seq and SeqRecord objects
- sequence-io/read-sequences - Parse GenBank files with features to extract
- transcription-translation - Translate extracted CDS regions
- alignment-files - Extract sequences from BAM using samtools fasta/fastq