Skip to content

Latest commit

 

History

History
143 lines (118 loc) · 10.9 KB

File metadata and controls

143 lines (118 loc) · 10.9 KB

Bioinformatics-Toolbox

Bioinformatics-Toolbox - is a tool which allows the performing diffrent procedures with DNA/RNA, protein and filter fastq-libraries.

Usage

The tool works by calling the functions run_dna_rna_tools,run_protein_tools which takes arbitrary number of arguments with nucleic acids and protein sequencies (str) and the name of the procedure to be performed (always the last argument, str, see the usage examples below). The output is the result of the procedure as string or tuple if one sequence is submitted or list if several. Tool includefilter_fastq, which takes fastq-dict and three characteristics to filtration (dict, tuple, tuple, int) .The output is the result of the dictionary filtration as dict. Also tool include convert_multiline_fasta_to_oneline and select_genes_from_gbk_to_fasta, these functions able to work with fasta and gbk (first function takes multiline fasta file, name of output file and returns oneline fasta file; second function takes GBK file, genes, and amount of genes before and after, output file name and returns fasta file with flanking genes groups).

NOTE: For the procedure check_mutations in run_protein_tools a fixed number of string arguments are used: one RNA sequence, one protein sequence and the name of procedure itself.

Modules

dna_rna_tools

  • reverse_complement - perform reverse complementary complementary sequence of RNA or DNA
  • complement_seq - perform complementary complementary sequence of RNA or DNA.
  • reverse_seq - perform reverse DNA or RNA sequence
  • transcribe_dna - perform the transcribtion of DNA into mRNA

protein_tools

  • compute_molecular_weight — computes molecular weight of protein sequence in g/mol
  • compute_length — computes the number of amino acids in protein sequence
  • compute_hydrophobicity — computes the percentage of gydrophobic aminoacids in protein sequence
  • check_mutations — checks missense mutations in the protein sequence after translation
  • protein_to_dna- returns possible variants of DNAs for a given protein sequence
  • count_amino_acids - calculates the number of each aminoacid in protein sequence

fastq_filtration

  • filter_by_quality - filters fastq-sequence by quality and decoding quality sequence into q-score list and calculate quality

  • filtre_by_length - filters fastq-sequence by length

  • filter_by_gc_level - filters sequence by gc-level

  • save_filtered_fastq - Saves filtered fastq-sequencies and their characteristics in directory, which called fastq_filtrator_resuls

  • read_fastq_file - reads lines in fastq-file

    NOTE: This five functions use together to filter fastq-library and write it in file.

bio_files_processor

  • convert_multiline_fasta_to_oneline - converts multiline fasta to oneline and writes in fasta file

  • read_lines_from_gbk - reads lines in GBK and find lines with common pattern and creates a list with strings, which start with this pattern

  • find_translation_in_gbk - find translation-seq for one gene and return it

  • find_flanking_genes - find translation-seq for each of flanking gene and return a list of translation-seqs

  • select_flanking_genes - select flanking genes for one specific gene and return list of these genes

    NOTE: read_lines_from_gbk, find_translation_in_gbk, find_flanking_genes, select_flanking_genes supporting functions for select_genes_from_gbk_to_fasta

Examples

dna_rna_tools

run_dna_rna_tools("ATCATAGA","CAGatAGC","transcribe_dna")
# ['AUCAUAGA', 'CAGauAGC']
run_dna_rna_tools("UAVGCGCGC","transcribe_dna")
# ValueError: UAVGCGCGC isn't RNA or DNA.
run_dna_rna_tools("UAGCGCGC","transcribe_dna")
# ValueError: UAVGCGCGC isn't RNA or DNA.

run_dna_rna_tools("ATCATAGA","CAGatAGC","UUUAUAUA", "reverse")
# # ['AGATACTA', 'CGAtaGAC', 'AUAUAUUU']
run_dna_rna_tools("ACACARRR", "reverse")
# ValueError: ACACARRR isn't RNA or DNA.

run_dna_rna_tools("ATCATAGA","CAGatAGC","UUUAUAUA", "complement")
# # ['TAGTATCT', 'GTCtaTCG', 'AAAUAUAU']
run_dna_rna_tools("ACACARRR", "complement")
# # ValueError: ACACARRR isn't RNA or DNA.

run_dna_rna_tools("ATCATAGA","CAGatAGC","UUuAUAUA", 'reverse_complement')
# # ['TCTATGAT', 'GCTatCTG', 'UAUAUaAA']
run_dna_rna_tools("ACACARRR", "reverse_complement")
# #  ValueError: ACACARRR isn't RNA or DNA.

protein_tools

run_protein_tools('MAEGEITNLP', 'tGQYLAMDTSgLLYGSQT', 'compute_length')
#[('MAEGEITNLP', 10), ('tGQYLAMDTSgLLYGSQT', 18)]

run_protein_tools('MAEGEITNLP', 'tGQYLAMDTSgLLYGSQT', 'compute_molecular_weight')
#[('MAEGEITNLP', 1055.496), ('tGQYLAMDTSgLLYGSQT', 1886.872)]

run_protein_tools('MAEGEITNLP', 'tGQYLAMDTSgLLYGSQT', 'compute_hydrophobicity')
#[('MAEGEITNLP', 50.0), ('tGQYLAMDTSgLLYGSQT', 27.778)]

run_protein_tools('AUGGAUCAUcAAUAA', 'MDKL*', 'check_mutations')
#'Mutations: K3, L4.'

run_protein_tools('MAEGLP', 'LYGSQT','protein_to_dna')
#['ATG GCT/GCC/GCA/GCG GAA/GAG GGT/GGC/GGA/GGG TTA/TTG/CTT/CTC/CTA/CTG CCT/CCC/CCA/CCG',
#'TTA/TTG/CTT/CTC/CTA/CTG TAT/TAC GGT/GGC/GGA/GGG TCT/TCC/TCA/TCG/AGT/AGC CAA/CAG ACT/ACC/ACA/ACG']

run_protein_tools('MAEGLP', 'LYGSQT','count_amino_acids')
#[{'M': 1, 'A': 1, 'E': 1, 'G': 1, 'L': 1, 'P': 1},
#{'L': 1, 'Y': 1, 'G': 1, 'S': 1, 'Q': 1, 'T': 1}]

fastq_filtration

EXAMPLE_FASTQ = {
    '@SRX079804:1:SRR292678:1:1101:21885:21885': ('ACAGCAACATAAACATGATGGGATGGCGTAAGCCCCCGAGATATCAGTTTACCCAGGATAAGAGATTAAATTATGAGCAACATTATTAA', 'FGGGFGGGFGGGFGDFGCEBB@CCDFDDFFFFBFFGFGEFDFFFF;D@DD>C@DDGGGDFGDGG?GFGFEGFGGEF@FDGGGFGFBGGD'),
    '@SRX079804:1:SRR292678:1:1101:24563:24563': ('ATTAGCGAGGAGGAGTGCTGAGAAGATGTCGCCTACGCCGTTGAAATTCCCTTCAATCAGGGGGTACTGGAGGATACGAGTTTGTGTG', 'BFFFFFFFB@B@A<@D>BDDACDDDEBEDEFFFBFFFEFFDFFF=CC@DDFD8FFFFFFF8/+.2,@7<<:?B/:<><-><@.A*C>D'),
    '@SRX079804:1:SRR292678:1:1101:30161:30161': ('GAACGACAGCAGCTCCTGCATAACCGCGTCCTTCTTCTTTAGCGTTGTGCAAAGCATGTTTTGTATTACGGGCATCTCGAGCGAATC', 'DFFFEGDGGGGFGGEDCCDCEFFFFCCCCCB>CEBFGFBGGG?DE=:6@=>A<A>D?D8DCEE:>EEABE5D@5:DDCA;EEE-DCD'),
    '@SRX079804:1:SRR292678:1:1101:47176:47176': ('TGAAGCGTCGATAGAAGTTAGCAAACCCGCGGAACTTCCGTACATCAGACACATTCCGGGGGGTGGGCCAATCCATGATGCCTTTG', 'FF@FFBEEEEFFEFFD@EDEFFB=DFEEFFFE8FFE8EEDBFDFEEBE+E<C<C@FFFFF;;338<??D:@=DD:8DDDD@EE?EB'),
    '@SRX079804:1:SRR292678:1:1101:149302:149302': ('TAGGGTTGTATTTGCAGATCCATGGCATGCCAAAAAGAACATCGTCCCGTCCAATATCTGCAACATACCAGTTGGTTGGTA', '@;CBA=:@;@DBDCDEEE/EEEEEEF@>FBEEB=EFA>EEBD=DAEEEEB9)99>B99BC)@,@<9CDD=C,5;B::?@;A'),
    '@SRX079804:1:SRR292678:1:1101:170868:170868': ('CTGCCGAGACTGTTCTCAGACATGGAAAGCTCGATTCGCATACACTCGCTGAGTAAGAGAGTCACACCAAATCACAGATT', 'E;FFFEGFGIGGFBG;C6D<@C7CDGFEFGFHDFEHHHBBHHFDFEFBAEEEEDE@A2=DA:??C3<BCA7@DCDEG*EB'),
    '@SRX079804:1:SRR292678:1:1101:171075:171075': ('CATTATAGTAATACGGAAGATGACTTGCTGTTATCATTACAGCTCCATCGCATGAATAATTCTCTAATATAGTTGTCAT', 'HGHHHHGFHHHHFHHEHHHHFGEHFGFGGGHHEEGHHEEHBHHFGDDECEGGGEFGF<FGGIIGEBGDFFFGFFGGFGF'),
    '@SRX079804:1:SRR292678:1:1101:175500:175500': ('GACGCCGTGGCTGCACTATTTGAGGCACCTGTCCTCGAAGGGAAGTTCATCTCGACGCGTGTCACTATGACATGAATG', 'GGGGGFFCFEEEFFDGFBGGGA5DG@5DDCBDDE=GFADDFF5BE49<<<BDD?CE<A<8:59;@C.C9CECBAC=DE'),
    '@SRX079804:1:SRR292678:1:1101:190136:190136': ('GAACCTTCTTTAATTTATCTAGAGCCCAAATTTTAGTCAATCTATCAACTAAAATACCTACTGCTACTACAAGTATT', 'DACD@BEECEDE.BEDDDDD,>:@>EEBEEHEFEHHFFHH?FGBGFBBD77B;;C?FFFFGGFED.BBABBG@DBBE'),
    '@SRX079804:1:SRR292678:1:1101:190845:190845': ('CCTCAGCGTGGATTGCCGCTCATGCAGGAGCAGATAATCCCTTCGCCATCCCATTAAGCGCCGTTGTCGGTATTCC', 'FF@FFCFEECEBEC@@BBBBDFBBFFDFFEFFEB8FFFFFFFFEFCEB/>BBA@AFFFEEEEECE;ACD@DBBEEE'),
    '@SRX079804:1:SRR292678:1:1101:198993:198993': ('AGTTATTTATGCATCATTCTCATGTATGAGCCAACAAGATAGTACAAGTTTTATTGCTATGAGTTCAGTACAACA', '<<<=;@B??@<>@><48876EADEG6B<A@*;398@.=BB<7:>.BB@.?+98204<:<>@?A=@EFEFFFEEFB'),
    '@SRX079804:1:SRR292678:1:1101:204480:204480': ('AGTGAGACACCCCTGAACATTCCTAGTAAGACATCTTTGAATATTACTAGTTAGCCACACTTTAAAATGACCCG', '<98;<@@@:@CD@BCCDD=DBBCEBBAAA@9???@BCDBCGF=GEGDFGDBEEEEEFFFF=EDEE=DCD@@BBC')
    }
d = filter_fastq(EXAMPLE_FASTQ, (20, 80), (0, 80), 30)
print(d)

#{'@SRX079804:1:SRR292678:1:1101:170868:170868': ('CTGCCGAGACTGTTCTCAGACATGGAAAGCTCGATTCGCATACACTCGCTGAGTAAGAGAGTCACACCAAATCACAGATT', #'E;FFFEGFGIGGFBG;C6D<@C7CDGFEFGFHDFEHHHBBHHFDFEFBAEEEEDE@A2=DA:??C3<BCA7@DCDEG*EB'),
#'@SRX079804:1:SRR292678:1:1101:171075:171075': ('CATTATAGTAATACGGAAGATGACTTGCTGTTATCATTACAGCTCCATCGCATGAATAATTCTCTAATATAGTTGTCAT', #'HGHHHHGFHHHHFHHEHHHHFGEHFGFGGGHHEEGHHEEHBHHFGDDECEGGGEFGF<FGGIIGEBGDFFFGFFGGFGF'),
#'@SRX079804:1:SRR292678:1:1101:175500:175500': ('GACGCCGTGGCTGCACTATTTGAGGCACCTGTCCTCGAAGGGAAGTTCATCTCGACGCGTGTCACTATGACATGAATG', #'GGGGGFFCFEEEFFDGFBGGGA5DG@5DDCBDDE=GFADDFF5BE49<<<BDD?CE<A<8:59;@C.C9CECBAC=DE'),
#'@SRX079804:1:SRR292678:1:1101:190136:190136': ('GAACCTTCTTTAATTTATCTAGAGCCCAAATTTTAGTCAATCTATCAACTAAAATACCTACTGCTACTACAAGTATT', #'DACD@BEECEDE.BEDDDDD,>:@>EEBEEHEFEHHFFHH?FGBGFBBD77B;;C?FFFFGGFED.BBABBG@DBBE'),
#'@SRX079804:1:SRR292678:1:1101:190845:190845': ('CCTCAGCGTGGATTGCCGCTCATGCAGGAGCAGATAATCCCTTCGCCATCCCATTAAGCGCCGTTGTCGGTATTCC', #'FF@FFCFEECEBEC@@BBBBDFBBFFDFFEFFEB8FFFFFFFFEFCEB/>BBA@AFFFEEEEECE;ACD@DBBEEE'),
#'@SRX079804:1:SRR292678:1:1101:204480:204480': ('AGTGAGACACCCCTGAACATTCCTAGTAAGACATCTTTGAATATTACTAGTTAGCCACACTTTAAAATGACCCG','<98;<@@@:@CD@BCCDD=DBBCEBBAAA@9???@BCDBCGF=GEGDFGDBEEEEEFFFF=EDEE=DCD@@BBC')}

convert_multiline_fasta_to_oneline

  convert_multiline_fasta_to_oneline('example_multiline_fasta.fasta', "fasta1")

(example_fasta.fasta) -> (fasta1.fasta)

select_genes_from_gbk_to_fasta

   select_genes_from_gbk_to_fasta('example_gbk.gbk', 'uvrB', 2, 2, 'gbk1')

(example_gbk.gbk) -> (gbk1.fasta)

NOTE: Structure of result fasta file:

  • every line in upper case is flanking genes of one gene, which write in lower case
  • between groups of flanking genes used empty line

Additional information

  • The dna_rna_tools works only with DNA and RNA sequences. If any of the entered sequences contains inappropriate characters or cannot exist, the program prints message "It isn't RNA or DNA".
  • The protein_tools works only with protein and RNA sequences. If any of the entered sequences contain inappropriate characters or cannot exist, the program will display an error. Sequences can contain characters of any case.
  • For the procedure check_mutations there are extra requirements for RNA and protein sequences: mRNA sequences must contain start-codon and one of the stop-codons, protein sequnces must start with "M" and ends with "*" (stop-codon).
run_protein_tools("AUGGUAGGGAAAUUUUGA", "MGGKF", 'check_mutations') #ValueError: Stop (*) is absent
run_protein_tools("AUGGUAGGGAAAUUUUGA", "GGKF*", 'check_mutations') #ValueError: Start (M) is absent