Skip to content
This repository was archived by the owner on Apr 23, 2022. It is now read-only.

Latest commit

 

History

History
366 lines (284 loc) · 10.8 KB

introduction-to-programming-with-python.md

File metadata and controls

366 lines (284 loc) · 10.8 KB

Introduction to programming with Python

{% hint style='info' %} You can find the Software Carpentry lesson at: https://swcarpentry.github.io/python-novice-inflammation/. Nonetheless, we believe the SC lesson does not target complete beginners to programming. That is why we do not use its content and we have developed our own materials. {% endhint %}

On this page, you will find:

Python 101

This lesson is an introduction to programming and the Python programming language. This lesson targets complete beginners. We start by typing a few lines of code in the Python shell and then use the Jupyter Notebook, an open-source web application that allows you to create and share documents that contain live code, equations, visualizations and explanatory text.

You can download the Jupyter Notebook for this lesson: python-101.ipynb. GitHub allows to preview its content if you just want to know what is in this notebook: click here to see this notebook on GitHub.

Python 102

This lesson aims at plotting figures with Matplotlib and using NumPy, the fundamental package for scientific computing with Python. This lesson has been created by Björn Grüning. Now that you know the basics of programming with Python, let's have some fun with nice charts!

You can download the Jupyter Notebook for this lesson: python-102.ipynb. GitHub allows to preview its content if you just want to know what is in this notebook: click here to see this notebook on GitHub.

Jupyter Notebook

The Jupyter Notebook (formerly known as the IPython Notebook) is an interactive computational environment, in which you can combine code execution, rich text, mathematics, plots and rich media.

{% hint style='working' %} There is a public demo at: http://try.jupyter.org/. Yet, it is not always up and you should not use it during a workshop. It is better to setup a dedicated Jupyter instance. {% endhint %}

When you open the Jupyter Notebook, you get redirect to your own workspace, that is a virtual filesystem where you can upload your notebooks, create files, and organize them as you wish. Each user gets its own workspace to avoid collisions:

Uploading a notebook

You can upload the notebooks we provide by clicking on "Upload" on the right, which opens a file explorer. Select the notebook you want to upload:

Confirm the file upload by clicking the blue "Upload" button again. The Jupyter Notebook gives you the ability to rename the file into your workspace here, but it is optional:

Once uploaded, you should see the uploaded notebook into your workspace:

You can open this notebook by clicking on it. For instance, the screenshot below is what you should see by opening the Python 101 notebook we provide:

Playing with a notebook

So far, you have uploaded and opened a notebook. Now, you probably want to use it. When you open a notebook, you get an editor à la Microsoft Word or Google Doc (well, with the exception that Jupyter is more powerful as you can execute code and it is Open Source).

A notebook is usually configured for a specific programming language. If you use the Python notebooks we provide, then the configured programming language is set to Python 3 (this information is displayed on the top right corner). If you start a new notebook, Jupyter will ask you which programming language you intend to use.

A notebook contains a set of cells. Each cell contains either code or text (written in a lightweight markup language called Markdown). In the screenshot below, the very first cell of our Python 101 notebook contains a "text cell" and the second cell contains some Python code:

You can add new cells at the end of a notebook by clicking the "+" button in the second menu bar. To render the text you wrote in a "text cell" or execute the code in a "code cell", you have to run the cell by clicking on the "play" symbol (alternatively, you can use the keyboard shortcut alt + ENTER):

By default, the type of cell is "code" but you can change it to "Markdown" if you intend to write notes in plain text. You can find the type of the current cell by looking at the dropdown, which also lets you change its type:

Tip: in a "code cell", it is possible to run Bash commands by prepending the command with an exclamation mark, e.g., !ls.

That's it!

Instructor notes

{% hint style='working' %} These notes are mainly written for the instructors. Yet, they contain most (if not all) lines of code and important points taught during a workshop, which may be interesting if you want to remember how much you learnt during a workshop. {% endhint %}

🐍 in the shell

$ python3
>>>  # this is the python shell
>>>  # type ^D or exit() to quit
  • Python is an interpreted language
  • Run it from the shell

Variables

>>> x = 2  # integer
>>> is_dna = True  # boolean
>>> is_dna
True
>>> pi = 3.14  # float
>>> gnu = "A GNU is Not UNIX"  # string
>>> print(gnu)
"A GNU is Not UNIX"
>>> coordinates = [0.4, 1.2, 0.3]  # list
>>> coordinates = {'x': 0.4, 'y': 1.2, 'z': 0.3}  # dict

Naming conventions

  • Use [A-Z], [a-z], [0-9] & _
  • Use snake case: is_dna
  • ⚠️ a variable name with cannot start with a number
  • ⚠️ you cannot use python keywords as names (e.g. list, import, etc.)

Operations on variables

>>> a = 4
>>> b = a + 1
>>> b
5
>>> a / 2  # integer division
2
>>> a ** 2  # power
4
>>> 'gc' * 4
'gcgcgcgc'
>>> seq = 'atgc'
>>> seq = seq + 'gc' * 4
>>> seq
'atgcgcgcgcgc'

Exercise ideas:

  • Compute the area of a circle of 10 cm diameter using two variables Pi and D (the diameter)
  • Generate a 100 nucleotides long poly-A sequence without typing the A key multiple times

Working with lists

>>> peptide = ['PRO', 'GLY', 'ALA']
>>> first_aa = peptide[0]
>>> first_aa
'PRO'
>>> second_peptide = ['ARG', 'ASN', 'ASP']
>>> peptide + second_peptide
['PRO', 'GLY', 'ALA', 'ARG', 'ASN', 'ASP']
>>> peptide.append('ARG')
>>> peptide
['PRO', 'GLY', 'ALA', 'ARG']
>>> peptide.pop()
'ARG'
>>> peptide
['PRO', 'GLY', 'ALA']

More on lists

Lists can be nested!

>>> crds = [[0.4, 1.2, 9.3], [0.5, 1.8, 9.1]]
>>> len(crds)
2
>>> len(crds[1])
3
>>> crds[0]
[0.4, 1.2, 9.3]
>>> crds[1][2]
9.1

Loops

>>> peptide = ['PRO', 'GLY', 'ALA', 'ARG', 'ASN']
>>> for aa in peptide:
...     print(aa)
...
PRO
GLY
ALA
ARG
ASN

Comparison operators

>>> a = 5
>>> a == 5  # equal
True
>>> a != 2  # different than
True
>>> a > 5  # greater than
False
>>> a >= 5  # greater than or equal
True
>>> a < 5  # lower than
False
>>> a <= 5  # lower than or equal
True

while loops

>>> i = 1
>>> while i < 10:
...     print('^' * i)
...     i += 1  # identical to i = i + 1
^
^^
^^^
^^^^
^^^^^
^^^^^^
^^^^^^^
^^^^^^^^
^^^^^^^^^

Control flow statements (1)

>>> sequence = 'atgc'
>>> size = len(sequence)
>>> if size == 4:
...    print('Sequence length: OK')
Sequence length: OK
>>> if size == 4 and sequence == 'atgc':
...    print('Sequence match')
Sequence match
>>> if size == 6 or sequence == 'atgc':
...    print('Sequence match')
Sequence match
>>> if sequence == 'a' * len(sequence):
...    print('We have a Poly-A sequence')
... else:
...    print('Sequence is not a Poly-A')

Control flow statements (2)

>>> sequence = 'atgc'
>>> for nt in sequence:
...     if nt == 'a':
...         print('Found A')
...     elif nt == 't':
...         print('Found T')
...     else:
...         print('No A or T found')
Found A
Found T
No A or T found
No A or T found

Exercise ideas:

  • Given the following sequence, calculate the ratio of each nucleotide type it contains:
seq = 'ATGCTCGCGGCGCTAGCTACTAGCTAGCA'
  • Given these crambine (alpha carbons) 10-first coordinates, calculate the peptide barycenter (mean coordinates):
ca_trace = [  
    #     x,      y,     z
    [16.967, 12.784, 4.338],  # THR
    [13.856, 11.469, 6.066],  # THR
    [13.660, 10.707, 9.787],  # CYS
    [10.646, 8.991, 11.408],  # CYS
    [9.448, 9.034, 15.012],  # PRO
    [8.673, 5.314, 15.279],  # SER
    [8.912, 2.083, 13.258],  # ILE
    [5.145, 2.209, 12.453],  # VAL
    [5.598, 5.767, 11.082],  # ALA
    [8.496, 4.609, 8.837],  # ARG
]

Working with files

>>> f = open('./foo.fasta')
>>> for line in f:
...     print(line)
...
>foo

ATGCTCGCGGCGCTAGCTACTAGCTAGCA

>>> f.close()
>>> # alternative method: the with statement
>>> with open('./foo.fasta') as f:
...     lines = f.readlines()
>>> lines
['>foo\n', 'ATGCTCGCGGCGCTAGCTACTAGCTAGCA\n']

Exercise ideas:

  • Download the crambine sequence in fasta format from the PDB. Save this file in your working directory and store the amino-acids sequence in a seq variable.

Using modules

>>> import math
>>> math.pi
3.141592653589793
>>> from math import pi
>>> pi
3.141592653589793
>>> from urllib import request
>>> url = 'http://www.rcsb.org/too/long/url'
>>> response = request.urlopen(url)
>>> for line in response.readlines():
...     print(line)
b'>1CRN:A|PDBID|CHAIN|SEQUENCE\n'
b'TTCCPSIVARSNFNVCRLPGTPEAICATYTGCIIIPGATCPGDYAN\n'

Exercise ideas:

  • Re-implement your solution from the exercise 3.1 using the urllib module to download a fasta sequence from the PDB.

Functions

Isolate repetitive tasks in fonctions:

>>> def get_dna_complement(sequence):
...     complement = ''
...     for nt in sequence:
...         if nt == 'A':
...             complement += 'T'
...         elif nt == 'T':
...             complement += 'A'
...         elif nt == 'G':
...             complement += 'C'
...         elif nt == 'C':
...             complement += 'G'
...         else:
...             print("Unknown nucleotide:", nt)
...     return complement
>>> complement = get_dna_complement('ATGC')
>>> complement
'TACG'

Variables scope

>>> a = 10
>>> def foo():
...     a = 0
...     print("in foo:", a)
>>> foo()
in foo: 0
>>> print(a)
10