Skip to content

Add Knuth-Morris-Pratt (KMP) string matching algorithm [HACKTOBERFEST 2025]#157

Merged
siriak merged 9 commits into
TheAlgorithms:masterfrom
piyushkumar0707:add-kmp-string-matching
Oct 16, 2025
Merged

Add Knuth-Morris-Pratt (KMP) string matching algorithm [HACKTOBERFEST 2025]#157
siriak merged 9 commits into
TheAlgorithms:masterfrom
piyushkumar0707:add-kmp-string-matching

Conversation

@piyushkumar0707

Copy link
Copy Markdown
Contributor

Description:

## 🚀 Overview
This PR implements the **Knuth-Morris-Pratt (KMP)** algorithm - one of the most important string matching algorithms that achieves linear time complexity through intelligent preprocessing.

## ✨ Features
-**O(n + m) time complexity** - Linear performance vs O(n*m) naive approach
-**Failure function computation** - Detailed preprocessing with visualization
-**Multiple search variants** - Find first, count all, find all occurrences
-**Performance benchmarking** - Speed comparison with naive methods
-**DNA sequence analysis** - Bioinformatics application examples
-**Educational visualization** - Step-by-step algorithm explanation

## 🎯 Why This Matters
KMP algorithm is fundamental for:
- **Text editors** - Find/replace functionality in IDEs and word processors
- **Bioinformatics** - DNA/RNA sequence analysis and pattern matching
- **Web search engines** - Efficient text indexing and searching
- **Plagiarism detection** - Finding copied text segments
- **Data compression** - Identifying repeated patterns
- **Network security** - Intrusion detection pattern matching

## 📚 Implementation Details
- **Time Complexity:** O(n + m) where n = text length, m = pattern length
- **Space Complexity:** O(m) for the failure function array
- **Preprocessing:** O(m) time to build failure function
- **No backtracking:** Never re-examines text characters

## 🔧 Advanced Functions
- **`compute_failure_function()`** - Core preprocessing with detailed comments
- **`kmp_search()`** - Find all occurrences with position tracking
- **`kmp_search_first()`** - Optimized for finding first occurrence only
- **`kmp_count()`** - Count occurrences without storing positions
- **`visualize_failure_function()`** - Educational visualization tool

## 🧬 Real-World Applications
**DNA Sequence Matching:**
```r
dna_sequence <- "ATCGATCGATCGAATCGATCGATCGAATCGATCG"
pattern <- "ATCG"
matches <- kmp_search(dna_sequence, pattern)
# Finds all genetic marker occurrences

- Implement efficient O(n+m) string pattern matching
- Include failure function computation with detailed explanation
- Add multiple search variants (first occurrence, count, all matches)
- Performance comparison with naive string matching
- Comprehensive examples including DNA sequence analysis
- Create String Manipulation section in DIRECTORY.md
Copilot AI review requested due to automatic review settings October 4, 2025 19:01

Copilot AI left a comment

Copy link
Copy Markdown

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Pull Request Overview

This PR implements the Knuth-Morris-Pratt (KMP) string matching algorithm in R, providing an efficient O(n+m) solution for finding pattern occurrences in text. The implementation includes educational features, performance comparisons, and real-world application examples.

  • Core KMP algorithm with failure function preprocessing
  • Multiple search variants (find all, find first, count occurrences)
  • Educational tools including failure function visualization and performance benchmarking

Reviewed Changes

Copilot reviewed 2 out of 2 changed files in this pull request and generated 2 comments.

File Description
string_manipulation/kmp_string_matching.r Complete KMP algorithm implementation with multiple search functions, performance testing, and educational examples
DIRECTORY.md Added entry for the new KMP string matching algorithm

Tip: Customize your code reviews with copilot-instructions.md. Create the file or learn how to get started.

Comment thread DIRECTORY.md Outdated
## String Manipulation
* [KMP String Matching](https://github.com/TheAlgorithms/R/blob/HEAD/string_manipulation/kmp_string_matching.r)

```

Copilot AI Oct 4, 2025

Copy link

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

The closing code block fence ``` on line 91 is not valid Markdown syntax here. This appears to be a stray code fence that should be removed.

Suggested change
```

Copilot uses AI. Check for mistakes.

Copy link
Copy Markdown
Member

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

The issue is indeed there
image

# Test 3: Edge cases
cat("3. Edge Cases\n")
cat("Empty pattern:", length(kmp_search("hello", "")), "matches\n")
cat("Empty text:", length(kmp_search("", "hello")), "matches\n")

Copilot AI Oct 4, 2025

Copy link

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

There's trailing whitespace at the end of this line that should be removed for consistency.

Suggested change
cat("Empty text:", length(kmp_search("", "hello")), "matches\n")
cat("Empty text:", length(kmp_search("", "hello")), "matches\n")

Copilot uses AI. Check for mistakes.

Copy link
Copy Markdown
Member

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

This is still an issue

Copy link
Copy Markdown
Member

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Why are you resolving this comment without applying the change or replying to the comment? It's a valid issue that must be fixed

Copy link
Copy Markdown
Contributor Author

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

@siriak Thank you for the feedback! I've addressed the issues you mentioned:

Fixed DIRECTORY.md formatting:

  • Corrected the Wiggle Sort indentation (was 4 spaces, now 2 spaces like other entries)
  • Cleaned up formatting issues

Enhanced KMP edge case testing:

  • Added tests for identical strings
  • Added tests for pattern at start/end positions
  • Improved output formatting with consistent array display

The formatting and test coverage issues you identified have been resolved. Please review the latest commit.

@siriak

siriak commented Oct 4, 2025

Copy link
Copy Markdown
Member

Please check comments

@piyushkumar0707

Copy link
Copy Markdown
Contributor Author

@siriak all conflicts resolved

# Test 3: Edge cases
cat("3. Edge Cases\n")
cat("Empty pattern:", length(kmp_search("hello", "")), "matches\n")
cat("Empty text:", length(kmp_search("", "hello")), "matches\n")

Copy link
Copy Markdown
Member

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Why are you resolving this comment without applying the change or replying to the comment? It's a valid issue that must be fixed

- Fix indentation issue with Wiggle Sort entry (was 4 spaces, now 2 spaces)
- Remove extra trailing content and formatting issues
- Add comprehensive edge case tests for KMP algorithm
- Include tests for identical strings, pattern at start/end positions
- Address reviewer feedback about missing test cases and formatting

This addresses @siriak's valid concerns about proper formatting and test coverage.
@piyushkumar0707 piyushkumar0707 force-pushed the add-kmp-string-matching branch from 0d2c157 to 2908f89 Compare October 6, 2025 16:01
Copilot AI review requested due to automatic review settings October 13, 2025 08:13

Copilot AI left a comment

Copy link
Copy Markdown

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Pull Request Overview

Copilot reviewed 2 out of 3 changed files in this pull request and generated 2 comments.

Comment thread string_manipulation/kmp_string_matching.r
Comment thread string_manipulation/kmp_string_matching.r
Copilot AI review requested due to automatic review settings October 16, 2025 14:09

Copilot AI left a comment

Copy link
Copy Markdown

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Copilot encountered an error and was unable to review this pull request. You can try again by re-requesting a review.

@siriak siriak requested review from Copilot and siriak October 16, 2025 14:24

Copilot AI left a comment

Copy link
Copy Markdown

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

Pull Request Overview

Copilot reviewed 2 out of 3 changed files in this pull request and generated 2 comments.

Comment thread string_manipulation/kmp_string_matching.r
Comment thread string_manipulation/kmp_string_matching.r
@siriak siriak merged commit b083bc9 into TheAlgorithms:master Oct 16, 2025
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment

Labels

None yet

Projects

None yet

Development

Successfully merging this pull request may close these issues.

4 participants