Requiring no external dependencies (except a samtools installation for BAM reading)
pip install simplesam
For complete module documentation visit ReadTheDocs.
>>> from simplesam import Reader, WriterRead from SAM/BAM files
# can also read BAM
>>> in_file = open('data/NA18510.sam', 'r')
>>> in_sam = Reader(in_file)Access alignments using an iterator interface
>>> x = next(in_sam)
>>> type(x)
<class 'simplesam.Sam'>
>>> x
Sam(1:2:SRR011051.1022326)
>>> x.qname
'SRR011051.1022326'
>>> x.rname
'1'
>>> x.pos
2
>>> x.seq
'AACCCTAACCCCTAACCCTAACCCTAACCCTACCCCTAACCCTACCCCTCC'
>>> x.qual
'?<:;;=;>;<<<>96;<;;99;<=3;4<<:(;,<;;/;57<;%6,=:,((3'
>>> x.cigar
'8M1I42M'
>>> x.cigars
((8, 'M'), (1, 'I'), (42, 'M'))
>>> x.gapped('seq')
'AACCCTAACCCTAACCCTAACCCTAACCCTACCCCTAACCCTACCCCTCC'
>>> len(x)
50
>>> x.flag
35
>>> x.mapped
True
>>> x.paired
True
>>> x.duplicate
False
>>> x.secondary
False
>>> x.coords
[2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51]
>>> x.tags
{'H1': 0, 'UQ': 33, 'RG': 'SRR011051', 'H0': 0, 'MF': 130, 'Aq': 25, 'NM': 2}
>>> str(x)
'SRR011051.1022326\t35\t1\t2\t255\t8M1I42M\t*\t0\t0\tAACCCTAACCCCTAACCCTAACCCTAACCCTACCCCTAACCCTACCCCTCC\t?<:;;=;>;<<<>96;<;;99;<=3;4<<:(;,<;;/;57<;%6,=:,((3\tAq:i:25\tH0:i:0\tH1:i:0\tMF:i:130\tNM:i:2\tRG:Z:SRR011051\tUQ:i:33\n'Read the SAM sequence header structure
>>> from pprint import pprint
>>> pprint(in_sam.header)
{'@HD': OrderedDict([('VN:1.0', ['GO:none', 'SO:coordinate'])]),
'@SQ': {'SN:1': ['LN:247249719'],
'SN:2': ['LN:242951149'],
'SN:3': ['LN:199501827'],
'SN:4': ['LN:191273063'],
'SN:5': ['LN:180857866'],
'SN:6': ['LN:170899992'],
'SN:7': ['LN:158821424'],
'SN:8': ['LN:146274826'],
...
'@RG': {'ID:SRR011049': ['PL:ILLUMINA',
'PU:BI.PE.080626_SL-XAN_0002_FC304CDAAXX.080630_SL-XAN_0007_FC304CDAAXX.5',
'LB:Solexa-5112',
'PI:330',
'SM:NA18510',
'CN:BI'],
'ID:SRR011050': ['PL:ILLUMINA',
'PU:BI.PE.080626_SL-XAN_0002_FC304CDAAXX.080630_SL-XAN_0007_FC304CDAAXX.6',
'LB:Solexa-5112',
'PI:330',
'SM:NA18510',
'CN:BI'],
...}
}
}Write SAM files from Sam objects
# Reader and Writer can also use the context handler (with: statement)
>>> out_file = open('test.sam', 'w')
>>> out_sam = Writer(out_file, in_sam.header)
>>> out_sam.write(x)
>>> out_sam.close()Write SAM files from Sam objects to stdout (allows samtools view compression)
>>> from sys import stdout
>>> stdout_sam = Writer(stdout, in_sam.header)
>>> stdout_sam.write(x)
>>> stdout_sam.close()$ python my_script_that_uses_simplesam.py | samtools view -hbo test.bamAn example script pileup.py is installed with this module.
This script will generate an output that is similar to samtools pileup with the addition of several optional columns that summarize
counts for individual nucleotides (ACTGN) and deletions with respect to the reference (-). This script leverages the Sam.gapped() and
Sam.parse_md() methods to reconstruct position-specific counts from SAM alignment records.
$ pileup.py -h
usage: pileup [-h] [--version] [-c] [-i STATS] bam pileup
generate a simple pileup-like file from a sorted/indexed BAM file
positional arguments:
bam sorted/indexed BAM file
pileup pileup output file
optional arguments:
-h, --help show this help message and exit
--version show program's version number and exit
-c, --counts display counts for A/C/T/G/N/- separately (default: False)
-i STATS, --stats STATS
tabulate mismatches to output file