File tree Expand file tree Collapse file tree
Expand file tree Collapse file tree Original file line number Diff line number Diff line change @@ -28,7 +28,7 @@ params {
2828 adapterremoval_adapter2 = ' AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT'
2929 adapterremoval_trim_quality_stretch = false
3030 keep_phix = false
31- skip_short_read_qc = false
31+ skip_shortread_qc = false
3232 // long read preprocessing options
3333 longread_adaptertrimming_tool = " porechop_abi"
3434 longread_filtering_tool = " filtlong"
Original file line number Diff line number Diff line change 376376 "type" : " boolean" ,
377377 "description" : " Skip read preprocessing using fastp or adapterremoval."
378378 },
379- "skip_short_read_qc " : {
379+ "skip_shortread_qc " : {
380380 "type" : " boolean" ,
381381 "description" : " Skip all QC steps for short reads." ,
382382 "help" : " Skips clipping and removal of phiX sequences as well as the second FastQC run. Does not affect host sequence removal."
Original file line number Diff line number Diff line change @@ -136,7 +136,7 @@ workflow MAG {
136136 ch_host_fasta,
137137 ch_host_bowtie2index,
138138 ch_phix_db_file,
139- params. skip_short_read_qc ,
139+ params. skip_shortread_qc ,
140140 )
141141
142142 ch_versions = ch_versions. mix(SHORTREAD_PREPROCESSING . out. versions)
You can’t perform that action at this time.
0 commit comments