Added library tests - #88
Conversation
…plitting, and line endings
|
|
||
| def mock_library_side_effect(_organism, genes, _n_guides): | ||
| # Helper mock to simulate returning one gRNA per gene | ||
| return {gene: [{"grna": "ACGTACGTACGTACGTACGT"}] for gene in genes} |
There was a problem hiding this comment.
Can you save this grna as a module level variable here, and when testing against it in any test, compare against the variable instead of its value?
| grna = result["results"][0]["library"][0][0] | ||
|
|
||
| # Verify forward oligo = 5' overhang + gRNA sequence | ||
| assert grna["forward_oligo"] == "CACCACGTACGTACGTACGTACGT" |
There was a problem hiding this comment.
For the forward/reverse oligos comparison, can you reach into the library module and pull out the oligos in the test instead of assuming they are certain values?
| assert grna["reverse_oligo"] == "ACGTACGTACGTACGTACGTCAAA" | ||
|
|
||
| # Verify full library oligo = F1 barcode + 5' adapter + gRNA + 3' adapter + R1 barcode | ||
| assert ( |
There was a problem hiding this comment.
Same comments here as the comparisons before this - let's compare against the barcodes found in the code instead of assuming they're always going to remain the same.
| @patch("guidescanpy.flask.blueprints.library.get_control_guides") | ||
| @patch("guidescanpy.flask.blueprints.library.get_essential_genes") | ||
| @patch("guidescanpy.flask.blueprints.library.get_library_info_by_gene") | ||
| def test_library_basic_structure(mock_library_info, mock_essential, mock_controls): |
There was a problem hiding this comment.
Since the next test is called "..two_pools..", let's call this test_library_single_pool_structure.
| @patch("guidescanpy.flask.blueprints.library.get_control_guides") | ||
| @patch("guidescanpy.flask.blueprints.library.get_essential_genes") | ||
| @patch("guidescanpy.flask.blueprints.library.get_library_info_by_gene") | ||
| def test_library_two_pools(mock_library_info, mock_essential, mock_controls): |
There was a problem hiding this comment.
I think the test above for the structure is sufficient and this one is not adding much value. Let's get rid of it.
|
|
||
|
|
||
| def test_parse_unrecognized_extension(data_folder): | ||
| file = os.path.join(data_folder, "test_invalid.csv") |
There was a problem hiding this comment.
For this test, since the contents of the .csv don't matter, let's use the tmp_path fixture in pytest to create a temporary file and pass it in (let's call it sacCer3_regions.csv to indicate that the file might be valid - it's only the extension we're testing). The file test_invalid.csv can be deleted.
| @patch("guidescanpy.flask.blueprints.library.get_control_guides") | ||
| @patch("guidescanpy.flask.blueprints.library.get_essential_genes") | ||
| @patch("guidescanpy.flask.blueprints.library.get_library_info_by_gene") | ||
| def test_library_unix_line_endings(mock_library_info, mock_essential, mock_controls): |
There was a problem hiding this comment.
This test will not xfail since I merged your other PR. However, instead or removing the xfail, let's get rid of this test - the test test_parsing.py::test_parse_txt covers something close to this anyway . If you want, you can replace one of the \n in test_parse_txt with \r\n so we're covering both cases.
|
Thanks @owenyu23 - see my comments, all mostly minor changes requested. |
2 participants
Added test cases for library.py covering:
Oligo construction (forward, reverse, and library oligos)
Basic output structure
Pool splitting across multiple pools
Unix line endings (xfail due to known bug for previous line splitting, which I addressed in fix-library-todos branch)