feat!: Pin wrapper versions in meta-wrappers; add alignoth_report meta-wrapper #4678
There are no files selected for viewing
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| @@ -0,0 +1,9 @@ | ||||||||||||||||||
| import pandas as pd | ||||||||||||||||||
|
|
||||||||||||||||||
| def get_alignoth_tables(wildcards, results_dir): | ||||||||||||||||||
| count = count_variants(wildcards) | ||||||||||||||||||
| return [f"{results_dir}/alignoth/{{sample}}/{i}/" for i in range(count)] | ||||||||||||||||||
|
|
||||||||||||||||||
|
|
||||||||||||||||||
| def count_variants(wildcards): | ||||||||||||||||||
| return sum(1 for _ in open(checkpoints.vembrane_table.get(sample=wildcards.sample).output[0], "r")) - 1 | ||||||||||||||||||
|
||||||||||||||||||
| def count_variants(wildcards): | |
| return sum(1 for _ in open(checkpoints.vembrane_table.get(sample=wildcards.sample).output[0], "r")) - 1 | |
| count_variants = lambda wildcards: sum(1 for line in open(checkpoints.vembrane_table.get(sample=wildcards.sample).output[0])) - 1 |
Suggested change
| def count_variants(wildcards): | |
| return sum(1 for _ in open(checkpoints.vembrane_table.get(sample=wildcards.sample).output[0], "r")) - 1 | |
| def count_variants(wildcards): | |
| with open(checkpoints.vembrane_table.get(sample=wildcards.sample).output[0]) as f: | |
| return sum(1 for _ in f) - 1 |
🤖 Prompt for AI Agents
In meta/bio/alignoth_report/common.smk around lines 8-9, replace the def
count_variants(...) one-liner with a lambda that does not leave a file handle
open; e.g. assign count_variants = lambda wildcards:
len(Path(checkpoints.vembrane_table.get(sample=wildcards.sample).output[0]).read_text().splitlines())
- 1 and ensure pathlib.Path is imported at the top of the file if not already
present.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,5 @@ | ||
| name: alignoth_report | ||
| description: Export variants via vembrane and create alignment plots with alignoth for a Datavzrd report. | ||
| authors: | ||
| - Felix Wiegand | ||
| - Felix Mölder | ||
fxwiegand marked this conversation as resolved.
Show resolved
Hide resolved
|
||
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,52 @@ | ||
| include: "common.smk" | ||
|
|
||
| checkpoint vembrane_table: | ||
| input: | ||
| "<results>/{sample}.bcf", | ||
| output: | ||
| "<results>/tables/{sample}.tsv" | ||
| log: | ||
| "<logs>/vembrane_table/{sample}.log" | ||
| params: | ||
| expression="INDEX, CHROM, POS, REF, ALT", | ||
| extra="" | ||
| wrapper: | ||
| "v7.6.1/bio/vembrane/table" | ||
|
|
||
|
|
||
| rule alignoth: | ||
| input: | ||
| bam="<results>/mapped/{sample}.bam", | ||
| bam_idx="<results>/mapped/{sample}.bam.bai", | ||
| reference="resources/genome.fa", | ||
| reference_idx="resources/genome.fa.fai", | ||
| vcf="<results>/{sample}.bcf", | ||
| vcf_idx="<results>/{sample}.bcf.csi", | ||
| overview="<results>/tables/{sample}.tsv" | ||
| output: | ||
| directory("<results>/alignoth/{sample}/{index}/") | ||
| params: | ||
| extra=lambda wc, input: f"--around-vcf-record {wc.index} -f tsv" | ||
| log: | ||
| "<logs>/alignoth/{sample}_{index}.log" | ||
| wrapper: | ||
| "v7.9.1/bio/alignoth" | ||
|
|
||
|
|
||
| rule datavzrd: | ||
| input: | ||
| config=workflow.source_path("resources/template.datavzrd.yaml"), | ||
| overview="<results>/tables/{sample}.tsv", | ||
| plot_tables=lambda wc: get_alignoth_tables(wc, "<results>") | ||
| output: | ||
| report( | ||
| directory("<results>/datavzrd-report/{sample}"), | ||
| htmlindex="index.html", | ||
| ), | ||
| # config = "resources/datavzrd/{sample}.rendered_config.yaml" | ||
| params: | ||
| max_index=lambda wc: count_variants(wc) | ||
| log: | ||
| "<logs>/datavzrd/{sample}.log", | ||
| wrapper: | ||
| "v7.9.1/utils/datavzrd" |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,56 @@ | ||
| __use_yte__: true | ||
|
|
||
| default-view: variants | ||
|
|
||
| datasets: | ||
| variants: | ||
| path: ?input.overview | ||
| separator: "\t" | ||
| links: | ||
| alignment plot: | ||
| column: INDEX | ||
| view: "{value}" | ||
| ?for i in range(params.max_index): | ||
| ?f"{i}.coverage": | ||
| path: ?f"{input.plot_tables[i]}/{wildcards.sample}.coverage.tsv" | ||
| separator: "\t" | ||
| ?f"{i}.reference": | ||
| path: ?f"{input.plot_tables[i]}/{wildcards.sample}.reference.tsv" | ||
| separator: "\t" | ||
| ?f"{i}.reads": | ||
| path: ?f"{input.plot_tables[i]}/{wildcards.sample}.reads.tsv" | ||
| separator: "\t" | ||
| ?f"{i}.highlight": | ||
| path: ?f"{input.plot_tables[i]}/{wildcards.sample}.highlight.tsv" | ||
| separator: "\t" | ||
| views: | ||
| variants: | ||
| dataset: variants | ||
| render-table: | ||
| columns: | ||
| SAMPLE: | ||
| label: sample | ||
| CHROM: | ||
| label: chromosome | ||
| POS: | ||
| label: position | ||
| INDEX: | ||
| display-mode: hidden | ||
| REF: | ||
| label: reference allele | ||
| spell: | ||
| url: v1.5.0/med/alleles | ||
| ALT: | ||
| label: alternative allele | ||
| spell: | ||
| url: v1.5.0/med/alleles | ||
| ?for i in range(params.max_index): | ||
| ?i: | ||
| hidden: true | ||
| datasets: | ||
| reads: ?f"{i}.reads" | ||
| reference: ?f"{i}.reference" | ||
| coverage: ?f"{i}.coverage" | ||
| highlight: ?f"{i}.highlight" | ||
| render-plot: | ||
| spec-path: ?f"{input.plot_tables[i]}/{wildcards.sample}.vl.json" |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,8 @@ | ||
| from snakemake.utils import min_version | ||
|
|
||
| min_version("9.13.1") | ||
|
|
||
| module alignoth_report: | ||
| meta_wrapper: "file:../master/meta/bio/alignoth_report" | ||
|
|
||
| use rule * from alignoth_report |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,2 @@ | ||
| >1 | ||
| TGTGCACCCAGGCTAATTAATGTTCATGGGAACTAATTAGAGCTGACATGTACAGCCAGCCTTTTGCTTACTCTGCGGGATCTTGTTCTGTGTGATTTCTCTAGGGGGAGCCTGCTCACTTTGAGTATTTGATGTATCCATTGCACTCAGCACCCATCACCGGTCTAGCTACCTGCATCCGCAAACCCCTTATAGCCACCTGTTCTCTGGATCGATCCATCCGCCTTTGGAATTATGAAACAAAGTAAGGAATGAAAGGCTTGCCTACTTTATTATGCAAGACCCCAGTTGTGAATTTATGTGAATTATTTTAATTACAGTGTTCCAAACTTTAATTATTTAGAAGCTTTCAGTTGGAAAAGATTTTTAAAAAATCAAGTCAGTCAACCTACCTGTTTCTCACTCTTGCGTGGGCTAGAAAACTACTTTGTGGTTTATTTAATGCTTACCACATGCTAGACACTGGGGACATGAAGAGATGAAGACAACACCTCAGTCTCTCACCTTCTTACATAAACTCCTGGGTCCCTCCAGCTCTCCTATCCCCTTGTTTCCCACAGGAACTGCTCTTTGCTTCAGGGAGCTCTCCAGACCCTTTCTTCCTCATCTTTCTCCCAGGACATCACTATCTCAACCACCCCCAACTCCCTCCTGACTTTACCTTCCAGCACAGCTTCCCTGGGAAGCTCCAACCCTAGGTGGACCCCCACCCCCTACTGTTTTCTTTGTTCTTATGTACAACTTCTGGGGCTTCTGGGGAAAAAATACTTGGACAATACTCATGAATTTTGGAATATAAACAGAGCTATGTCTTCAGCATCGCTAGACCACACCTTGACCAGTCTCCCTATCTACCATGCTCCACGCTGGACATTATCCCCTAATAACCAAGATCTAGAAAAGAGAGGAACCAACAATTGCAAACAGTAGTGTGTCTCAAATACGATGATAACAATATATATCAGATACAGTAGATGACTGGAAGGATTTAGTGAGCTAAGCTTACAATTCAGTAATTGATCTTTTTCACAGCACCCTGGAACTATTTAAGGAATACCAAGAAGAGGCATATTCCATCAGCCTTCATCCATCTGGACACTTCATTGTAGTAGGGTTTGCTGACAAACTACGCCTCATGAATCTACTCATTGATGATATACGTTCTTTCAAAGAATACTCTGTTAGAGGATGCGGAGAGGTAAAAAAAAAACTGCTGAAGACAAAAGTCCAGTTTCTTAGAAAGCCACGGCTGAAATATCAGGAACTAACATGATCTGGGGAGGTGGGACCAAAATCTGTCTTGGAGAACTACAGTGGCTTAAAAAAAGGGGGAAGGAGGAAATCCAGTTATTTTCCCAGCAACCTTATTGAGTATATGGTTCCATCCCCATATTCTTATGTCCACCAGACTATTTCATTGAACCTAAAACCTTGTGAGATCCCCGCTATGATAAGTCCTGTCTGTAATTGTGGAATATTAACAAATATTTTAAAAGAAAAGTAATCTCAGAATCAGAGTCACAGCTAAGAAGGTGAGGTTGGAGACGGAGGAGCCAGGGAAAAATAAGCATCAATGGTGAGAGGTAATAAAGAGCGCATCAGCTTTCCCTGAGGTGTCTTGCAGAAACAAGGCAATGATTTCAGGAATTACTTCCCCGGCTCTGAAACATGCTTCTACAGGCAAAATGATTGCTTGTGGTCCCAACGGCTTAATGATTTGTGGGCCTGACAGTGTCAGCATCTGGCCACTATGAGTTACAGGAATAATGAAAGTGTCTGAAAATGTCAGCCACTCCTCAGTCTCATTTGCACCTTCCCCCCACTCCCACCCTCACACGTAGTTTCAGTCTGAACTCGTTGGGAAAAGCACCTCTTGACTGTAACCTCTAATTAGACTGCTCACTTCCTGCTTGCTTGCTCTCTTGCTGTCTTTCCCTATAGTGTTCCTTTAGCAATGGAGGTCACCTGTTTGCTGCAGTCAATGGAAATGTGATTCACGTTTACACCACCACGAGCCTAGAGAACATCTCAAGCCTGAAAGGACACACAGGGAAGGTAAGTGAGTGAACAGTCTCTGGGGAAACAAGGGGCACGGAGCCAAGTATGCCGCCAGCCAGTGGGATACAGGTGAACAAAAGAGAGATGGTTCCTTTCCTCATGGGTTCACTGTCTACTTGGGGAAAGAGACAATAAAACAAATGCACAGACAAATGTAGTTACTAATTGCAGTTCCACTGAAAGAAAAACATGGTGTTGTTGTGAGAGAAATAATGAAGGGGGCGGCATAATTTAGGTGGCTGTATTTGCAAAGGCTTGGTCCTATAAGAGTGAGTAGGAGTTAATCAGACACAACTGGTGGGGATAATCACTGCAGATAGGGATCCAAAGGCCAGAGATGGGAGACTCATAGG |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1 @@ | ||
| 1 2411 3 2411 2412 |
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
Binary file not shown.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| Original file line number | Diff line number | Diff line change |
|---|---|---|
| @@ -0,0 +1,4 @@ | ||
| wrappers: | ||
| - bio/vembrane/table | ||
| - bio/alignoth | ||
| - utils/datavzrd |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Oops, something went wrong.
Oops, something went wrong.
Add this suggestion to a batch that can be applied as a single commit.
This suggestion is invalid because no changes were made to the code.
Suggestions cannot be applied while the pull request is closed.
Suggestions cannot be applied while viewing a subset of changes.
Only one suggestion per line can be applied in a batch.
Add this suggestion to a batch that can be applied as a single commit.
Applying suggestions on deleted lines is not supported.
You must change the existing code in this line in order to create a valid suggestion.
Outdated suggestions cannot be applied.
This suggestion has been applied or marked resolved.
Suggestions cannot be applied from pending reviews.
Suggestions cannot be applied on multi-line comments.
Suggestions cannot be applied while the pull request is queued to merge.
Suggestion cannot be applied right now. Please check back later.
Uh oh!
There was an error while loading. Please reload this page.