feat: add pytrf sub-commands as individual Snakemake-Wrappers

bio/pytrf/extract/environment.linux-64.pin.txt

@@ -0,0 +1,37 @@
+# This file may be used to create an environment using:
+# $ conda create --name <env> --file <this file>
+# platform: linux-64
+# created-by: conda 25.11.0
+@EXPLICIT
+https://conda.anaconda.org/conda-forge/linux-64/_libgcc_mutex-0.1-conda_forge.tar.bz2#d7c89558ba9fa0495403155b64376d81
+https://conda.anaconda.org/conda-forge/noarch/ca-certificates-2025.11.12-hbd8a1cb_0.conda#f0991f0f84902f6b6009b4d2350a83aa
+https://conda.anaconda.org/conda-forge/linux-64/libgomp-15.2.0-he0feb66_14.conda#91349c276f84f590487e4c7f6e90e077
+https://conda.anaconda.org/conda-forge/noarch/python_abi-3.12-8_cp312.conda#c3efd25ac4d74b1584d2f7a57195ddf1
+https://conda.anaconda.org/conda-forge/noarch/tzdata-2025b-h78e105d_0.conda#4222072737ccff51314b5ece9c7d6f5a
+https://conda.anaconda.org/conda-forge/linux-64/_openmp_mutex-4.5-2_gnu.tar.bz2#73aaf86a425cc6e73fcf236a5a46396d
+https://conda.anaconda.org/conda-forge/linux-64/libgcc-15.2.0-he0feb66_14.conda#550dceb769d23bcf0e2f97fd4062d720
+https://conda.anaconda.org/conda-forge/linux-64/bzip2-1.0.8-hda65f42_8.conda#51a19bba1b8ebfb60df25cde030b7ebc
+https://conda.anaconda.org/conda-forge/linux-64/libexpat-2.7.3-hecca717_0.conda#8b09ae86839581147ef2e5c5e229d164
+https://conda.anaconda.org/conda-forge/linux-64/libffi-3.5.2-h9ec8514_0.conda#35f29eec58405aaf55e01cb470d8c26a
+https://conda.anaconda.org/conda-forge/linux-64/libgcc-ng-15.2.0-h69a702a_14.conda#6c13aaae36d7514f28bd5544da1a7bb8
+https://conda.anaconda.org/conda-forge/linux-64/liblzma-5.8.1-hb9d3cd8_2.conda#1a580f7796c7bf6393fddb8bbbde58dc
+https://conda.anaconda.org/conda-forge/linux-64/libnsl-2.0.1-hb9d3cd8_1.conda#d864d34357c3b65a4b731f78c0801dc4
+https://conda.anaconda.org/conda-forge/linux-64/libstdcxx-15.2.0-h934c35e_14.conda#8e96fe9b17d5871b5cf9d312cab832f6
+https://conda.anaconda.org/conda-forge/linux-64/libuuid-2.41.2-he9a06e4_0.conda#80c07c68d2f6870250959dcc95b209d1
+https://conda.anaconda.org/conda-forge/linux-64/libzlib-1.3.1-hb9d3cd8_2.conda#edb0dca6bc32e4f4789199455a1dbeb8
+https://conda.anaconda.org/conda-forge/linux-64/ncurses-6.5-h2d0b736_3.conda#47e340acb35de30501a76c7c799c41d7
+https://conda.anaconda.org/conda-forge/linux-64/openssl-3.6.0-h26f9b46_0.conda#9ee58d5c534af06558933af3c845a780
+https://conda.anaconda.org/conda-forge/linux-64/libstdcxx-ng-15.2.0-hdf11a46_14.conda#9531f671a13eec0597941fa19e489b96
+https://conda.anaconda.org/conda-forge/linux-64/libxcrypt-4.4.36-hd590300_1.conda#5aa797f8787fe7a17d1b0821485b5adc
+https://conda.anaconda.org/conda-forge/linux-64/readline-8.2-h8c095d6_2.conda#283b96675859b20a825f8fa30f311446
+https://conda.anaconda.org/conda-forge/linux-64/tk-8.6.13-noxft_ha0e22de_103.conda#86bc20552bf46075e3d92b67f089172d
+https://conda.anaconda.org/conda-forge/linux-64/zstd-1.5.7-hb8e6e7a_2.conda#6432cb5d4ac0046c3ac0a8a0f95842f9
+https://conda.anaconda.org/conda-forge/linux-64/icu-75.1-he02047a_0.conda#8b189310083baabfb622af68fd9d3ae3
+https://conda.anaconda.org/conda-forge/linux-64/ld_impl_linux-64-2.45-default_hbd61a6d_104.conda#a6abd2796fc332536735f68ba23f7901
+https://conda.anaconda.org/conda-forge/linux-64/libsqlite-3.51.0-hee844dc_0.conda#729a572a3ebb8c43933b30edcc628ceb
+https://conda.anaconda.org/conda-forge/linux-64/python-3.12.12-hd63d673_1_cpython.conda#5c00c8cea14ee8d02941cab9121dce41
+https://conda.anaconda.org/bioconda/linux-64/pyfastx-2.2.0-py312h4711d71_1.tar.bz2#0c029565f5abbf1c3349a4abc0b4c63c
+https://conda.anaconda.org/bioconda/linux-64/pytrf-1.4.2-py312h0fa9677_0.tar.bz2#11c47fcb88ad7fe0ab94dcf11b8bebb9
+https://conda.anaconda.org/conda-forge/noarch/setuptools-80.9.0-pyhff2d567_0.conda#4de79c071274a53dcaf2a8c749d1499e
+https://conda.anaconda.org/conda-forge/noarch/wheel-0.45.1-pyhd8ed1ab_1.conda#75cb7132eb58d97896e173ef12ac9986
+https://conda.anaconda.org/conda-forge/noarch/pip-25.3-pyh8b19718_0.conda#c55515ca43c6444d2572e0f0d93cb6b9

bio/pytrf/extract/environment.yaml

@@ -0,0 +1,8 @@
+channels:
+  - conda-forge
+  - bioconda
+  - nodefaults
+
+dependencies:
+  - pytrf =1.4
+  - pyfastx =2.2

bio/pytrf/extract/meta.yaml

@@ -0,0 +1,28 @@
+name: pytrf extract (NOT WORKING, see notes below)
+description: >
+  Extract tandem repeat sequences with flanking regions from DNA sequences.
+  Requires output from pytrf findstr, findgtr, or findatr as input.
+url: https://pytrf.readthedocs.io/en/latest/usage.html#commandline-interface
+authors:
+  - Muhammad Rohan Ali Asmat
+input:
+  - FASTA or FASTQ file (supports gzip compression)
+output:
+  - Output file (default -> stdout, will be redirected to the log file).
+params:
+  repeat_file: >
+    **Required.** Path to TSV or CSV file from pytrf findstr/findgtr/findatr.
+  out_format: >
+    Output format. Options: 'tsv' (default), 'csv', or 'fasta'.
+    Note: Only extract command supports FASTA output.
+  flank_length: >
+    Length of flanking sequence (default: 100).
+notes: >
+  **Bioconda package:** https://bioconda.github.io/recipes/pytrf/README.html |nl|
+  **GitHub repository:** https://github.com/lmdu/pytrf |nl|
+  **License:** MIT License |nl|
+  **Disclaimer:** This is a minimal implementation supporting basic functionality.
+  pytrf is not a Python binding to TRF - it's an independent tool. |nl|
+  **Known issue:** PyTRF 1.4.2 has a bug in the `extract` command (delimiter error). |nl|
+  See: https://github.com/lmdu/pytrf/issues/6 |nl|
+  This wrapper skips extract tests until upstream patch is released.

bio/pytrf/extract/test/Snakefile

@@ -0,0 +1,17 @@
+# SAMPLE RULE: Extract tandem repeat sequences with flanking regions
+# The pytrf extract wrapper requires output from findstr, findgtr, or findatr.
+#
+# Output:
+# - If output file is specified, results are written to that file
+# - If output is omitted, pytrf writes to stdout (redirected to log file)
+rule pytrf_extract:
+    input:
+        "demo_data/{sample}.fasta",
+    output:
+        "results/{sample}_extract.tsv",
+    params:
+        repeat_file="demo_data/{sample}.tsv",
+    log:
+        "logs/{sample}.log",
+    wrapper:
+        "master/bio/pytrf/extract"

bio/pytrf/extract/test/demo_data/small_test.fasta

@@ -0,0 +1,6 @@
+>seq1
+TCATCGGTCATCGGTCATCGGTCATCGGTCATCGG
+>seq2
+ACCCCTCAGGGTACCCCTCAGGGTACCCCTCAGGGTACCCCTCAGGGTACCCCTCAGGGTACCCCTCAGGGTACCCCTCAGGGT
+>seq3
+TGACTATATCCGCAAATGAAGGCTGTTCTCTGACATGACTATATCCGCAAATGAAGGCTGTTCTCTGACATGACTATATCCGCAAATGAAGGCTGTTCTCTGACATGACTATATCCGCAAATGAAGGCTGTTCTCTGACA

bio/pytrf/extract/test/demo_data/small_test.tsv

@@ -0,0 +1,85 @@
+seq1	1	3	TCA	3	1	3
+seq1	4	6	TCG	3	1	3
+seq1	7	9	GTC	3	1	3
+seq1	10	12	ATC	3	1	3
+seq1	13	15	GGT	3	1	3
+seq1	16	18	CAT	3	1	3
+seq1	19	21	CGG	3	1	3
+seq1	22	24	TCA	3	1	3
+seq1	25	27	TCG	3	1	3
+seq1	28	30	GTC	3	1	3
+seq1	31	33	ATC	3	1	3
+seq1	34	36	GG	3	1	3
+seq2	1	3	ACC	3	1	3
+seq2	4	6	CCT	3	1	3
+seq2	7	9	CAG	3	1	3
+seq2	10	12	GGT	3	1	3
+seq2	13	15	ACC	3	1	3
+seq2	16	18	CCT	3	1	3
+seq2	19	21	CAG	3	1	3
+seq2	22	24	GGT	3	1	3
+seq2	25	27	ACC	3	1	3
+seq2	28	30	CCT	3	1	3
+seq2	31	33	CAG	3	1	3
+seq2	34	36	GGT	3	1	3
+seq2	37	39	ACC	3	1	3
+seq2	40	42	CCT	3	1	3
+seq2	43	45	CAG	3	1	3
+seq2	46	48	GGT	3	1	3
+seq2	49	51	ACC	3	1	3
+seq2	52	54	CCT	3	1	3
+seq2	55	57	CAG	3	1	3
+seq2	58	60	GGT	3	1	3
+seq2	61	63	ACC	3	1	3
+seq2	64	66	CCT	3	1	3
+seq2	67	69	CAG	3	1	3
+seq2	70	72	GGT	3	1	3
+seq2	73	75	ACC	3	1	3
+seq2	76	78	CCT	3	1	3
+seq2	79	81	CAG	3	1	3
+seq2	82	84	GGT	3	1	3
+seq3	1	3	TGA	3	1	3
+seq3	4	6	CTA	3	1	3
+seq3	7	9	TAT	3	1	3
+seq3	10	12	CCG	3	1	3
+seq3	13	15	CAA	3	1	3
+seq3	16	18	ATG	3	1	3
+seq3	19	21	AAG	3	1	3
+seq3	22	24	GCT	3	1	3
+seq3	25	27	GTT	3	1	3
+seq3	28	31	CT	2	2	4
+seq3	32	34	GAC	3	1	3
+seq3	35	37	ATG	3	1	3
+seq3	38	40	ACT	3	1	3
+seq3	41	44	AT	2	2	4
+seq3	45	47	CCG	3	1	3
+seq3	48	50	CAA	3	1	3
+seq3	51	53	ATG	3	1	3
+seq3	54	56	AAG	3	1	3
+seq3	57	59	GCT	3	1	3
+seq3	60	62	GTT	3	1	3
+seq3	63	66	CT	2	2	4
+seq3	67	69	GAC	3	1	3
+seq3	70	72	ATG	3	1	3
+seq3	73	75	ACT	3	1	3
+seq3	76	79	AT	2	2	4
+seq3	80	82	CCG	3	1	3
+seq3	83	85	CAA	3	1	3
+seq3	86	88	ATG	3	1	3
+seq3	89	91	AAG	3	1	3
+seq3	92	94	GCT	3	1	3
+seq3	95	97	GTT	3	1	3
+seq3	98	101	CT	2	2	4
+seq3	102	104	GAC	3	1	3
+seq3	105	107	ATG	3	1	3
+seq3	108	110	ACT	3	1	3
+seq3	111	114	AT	2	2	4
+seq3	115	117	CCG	3	1	3
+seq3	118	120	CAA	3	1	3
+seq3	121	123	ATG	3	1	3
+seq3	124	126	AAG	3	1	3
+seq3	127	129	GCT	3	1	3
+seq3	130	132	GTT	3	1	3
+seq3	133	136	CT	2	2	4
+seq3	137	139	GAC	3	1	3
+seq3	140	142	A	3	1	3

bio/pytrf/extract/wrapper.py

@@ -0,0 +1,55 @@
+"""
+Snakemake Wrapper for PyTRF extract
+------------------------------------------------------
+Extract tandem repeat sequences with flanking regions.
+"""
+
+from pathlib import Path
+from snakemake.shell import shell
+
+# Logging
+log = snakemake.log_fmt_shell(stdout=True, stderr=True)
+
+# Get input file
+try:
+    input_file = Path(snakemake.input[0]).resolve()
+except (IndexError, TypeError) as e:
+    raise ValueError(f"Input specification error: {e}") from e
+
+# Get output file if specified
+OUTPUT_FILE = None
+if snakemake.output:
+    OUTPUT_FILE = Path(snakemake.output[0]).resolve()
+
+# Get repeat_file (required)
+try:
+    if not hasattr(snakemake.params, "repeat_file"):
+        raise ValueError("Parameter 'repeat_file' is required for extract")
+    repeat_file = Path(snakemake.params.repeat_file).resolve()
+except (AttributeError, ValueError) as e:
+    raise RuntimeError(f"Parameter validation failed: {e}") from e
+
+# Build parameters
+params = [f"-r {repeat_file}"]
+
+try:
+    if hasattr(snakemake.params, "out_format"):
+        params.append(f"-f {snakemake.params.out_format}")
+
+    if hasattr(snakemake.params, "flank_length"):
+        params.append(f"-l {snakemake.params.flank_length}")
+except (AttributeError, ValueError) as e:
+    raise RuntimeError(f"Parameter processing failed: {e}") from e
+
+# Build command
+CMD = f"pytrf extract {input_file}"
+if params:
+    CMD += " " + " ".join(params)
+if OUTPUT_FILE:
+    CMD += f" -o {OUTPUT_FILE}"
+
+# Execute
+try:
+    shell(f"{CMD} {log}")
+except Exception as e:
+    raise RuntimeError(f"PyTRF extract execution failed: {e}") from e

bio/pytrf/findatr/environment.linux-64.pin.txt

@@ -0,0 +1,37 @@
+# This file may be used to create an environment using:
+# $ conda create --name <env> --file <this file>
+# platform: linux-64
+# created-by: conda 25.11.0
+@EXPLICIT
+https://conda.anaconda.org/conda-forge/linux-64/_libgcc_mutex-0.1-conda_forge.tar.bz2#d7c89558ba9fa0495403155b64376d81
+https://conda.anaconda.org/conda-forge/noarch/ca-certificates-2025.11.12-hbd8a1cb_0.conda#f0991f0f84902f6b6009b4d2350a83aa
+https://conda.anaconda.org/conda-forge/linux-64/libgomp-15.2.0-he0feb66_14.conda#91349c276f84f590487e4c7f6e90e077
+https://conda.anaconda.org/conda-forge/noarch/python_abi-3.12-8_cp312.conda#c3efd25ac4d74b1584d2f7a57195ddf1
+https://conda.anaconda.org/conda-forge/noarch/tzdata-2025b-h78e105d_0.conda#4222072737ccff51314b5ece9c7d6f5a
+https://conda.anaconda.org/conda-forge/linux-64/_openmp_mutex-4.5-2_gnu.tar.bz2#73aaf86a425cc6e73fcf236a5a46396d
+https://conda.anaconda.org/conda-forge/linux-64/libgcc-15.2.0-he0feb66_14.conda#550dceb769d23bcf0e2f97fd4062d720
+https://conda.anaconda.org/conda-forge/linux-64/bzip2-1.0.8-hda65f42_8.conda#51a19bba1b8ebfb60df25cde030b7ebc
+https://conda.anaconda.org/conda-forge/linux-64/libexpat-2.7.3-hecca717_0.conda#8b09ae86839581147ef2e5c5e229d164
+https://conda.anaconda.org/conda-forge/linux-64/libffi-3.5.2-h9ec8514_0.conda#35f29eec58405aaf55e01cb470d8c26a
+https://conda.anaconda.org/conda-forge/linux-64/libgcc-ng-15.2.0-h69a702a_14.conda#6c13aaae36d7514f28bd5544da1a7bb8
+https://conda.anaconda.org/conda-forge/linux-64/liblzma-5.8.1-hb9d3cd8_2.conda#1a580f7796c7bf6393fddb8bbbde58dc
+https://conda.anaconda.org/conda-forge/linux-64/libnsl-2.0.1-hb9d3cd8_1.conda#d864d34357c3b65a4b731f78c0801dc4
+https://conda.anaconda.org/conda-forge/linux-64/libstdcxx-15.2.0-h934c35e_14.conda#8e96fe9b17d5871b5cf9d312cab832f6
+https://conda.anaconda.org/conda-forge/linux-64/libuuid-2.41.2-he9a06e4_0.conda#80c07c68d2f6870250959dcc95b209d1
+https://conda.anaconda.org/conda-forge/linux-64/libzlib-1.3.1-hb9d3cd8_2.conda#edb0dca6bc32e4f4789199455a1dbeb8
+https://conda.anaconda.org/conda-forge/linux-64/ncurses-6.5-h2d0b736_3.conda#47e340acb35de30501a76c7c799c41d7
+https://conda.anaconda.org/conda-forge/linux-64/openssl-3.6.0-h26f9b46_0.conda#9ee58d5c534af06558933af3c845a780
+https://conda.anaconda.org/conda-forge/linux-64/libstdcxx-ng-15.2.0-hdf11a46_14.conda#9531f671a13eec0597941fa19e489b96
+https://conda.anaconda.org/conda-forge/linux-64/libxcrypt-4.4.36-hd590300_1.conda#5aa797f8787fe7a17d1b0821485b5adc
+https://conda.anaconda.org/conda-forge/linux-64/readline-8.2-h8c095d6_2.conda#283b96675859b20a825f8fa30f311446
+https://conda.anaconda.org/conda-forge/linux-64/tk-8.6.13-noxft_ha0e22de_103.conda#86bc20552bf46075e3d92b67f089172d
+https://conda.anaconda.org/conda-forge/linux-64/zstd-1.5.7-hb8e6e7a_2.conda#6432cb5d4ac0046c3ac0a8a0f95842f9
+https://conda.anaconda.org/conda-forge/linux-64/icu-75.1-he02047a_0.conda#8b189310083baabfb622af68fd9d3ae3
+https://conda.anaconda.org/conda-forge/linux-64/ld_impl_linux-64-2.45-default_hbd61a6d_104.conda#a6abd2796fc332536735f68ba23f7901
+https://conda.anaconda.org/conda-forge/linux-64/libsqlite-3.51.0-hee844dc_0.conda#729a572a3ebb8c43933b30edcc628ceb
+https://conda.anaconda.org/conda-forge/linux-64/python-3.12.12-hd63d673_1_cpython.conda#5c00c8cea14ee8d02941cab9121dce41
+https://conda.anaconda.org/bioconda/linux-64/pyfastx-2.2.0-py312h4711d71_1.tar.bz2#0c029565f5abbf1c3349a4abc0b4c63c
+https://conda.anaconda.org/bioconda/linux-64/pytrf-1.4.2-py312h0fa9677_0.tar.bz2#11c47fcb88ad7fe0ab94dcf11b8bebb9
+https://conda.anaconda.org/conda-forge/noarch/setuptools-80.9.0-pyhff2d567_0.conda#4de79c071274a53dcaf2a8c749d1499e
+https://conda.anaconda.org/conda-forge/noarch/wheel-0.45.1-pyhd8ed1ab_1.conda#75cb7132eb58d97896e173ef12ac9986
+https://conda.anaconda.org/conda-forge/noarch/pip-25.3-pyh8b19718_0.conda#c55515ca43c6444d2572e0f0d93cb6b9

bio/pytrf/findatr/environment.yaml

@@ -0,0 +1,8 @@
+channels:
+  - conda-forge
+  - bioconda
+  - nodefaults
+
+dependencies:
+  - pytrf =1.4
+  - pyfastx =2.2

bio/pytrf/findatr/meta.yaml

@@ -0,0 +1,49 @@
+name: pytrf findatr
+description: >
+  Find approximate/imperfect tandem repeats from DNA sequences.
+url: https://pytrf.readthedocs.io/en/latest/usage.html#commandline-interface
+authors:
+  - Muhammad Rohan Ali Asmat
+input:
+  - FASTA or FASTQ file (supports gzip compression)
+output:
+  - Output file (default -> stdout, will be redirected to the log file).
+params:
+  out_format: >
+    Output format. Options: 'tsv' (default), 'csv', 'bed', or 'gff'.
+  min_motif: >
+    Minimum motif size in bp (default: 1).
+  max_motif: >
+    Maximum motif size in bp (default: 6).
+  min_seedrep: >
+    Minimum repeat number for seed (default: 3).
+  min_seedlen: >
+    Minimum length for seed (default: 10).
+  max_errors: >
+    Maximum number of continuous alignment errors (default: 3).
+  min_identity: >
+    Minimum identity for extending, 0 to 100 (default: 70).
+  max_extend: >
+    Maximum length allowed to extend (default: 2000).
+notes: >
+  **Output columns (TSV/CSV/BED/GFF):** sequence or chromosome name, start position,
+  end position, motif sequence, motif length, repeat number, repeat length, seed start
+  position, seed end position, seed repeat number, seed length, number of matches,
+  number of substitutions, number of insertions, number of deletions, extend alignment
+  identity between imperfect repeat and its perfect counterpart.
+  |nl| |nl|
+  **Example:** |nl|
+  Example row in record: 0	1	32	T	1	32.0	32	1	1	1	1	10	22	0	0	31.25 |nl|
+  This indicates that in sequence '0', from position 1 to 32, there is a tandem repeat
+  with motif 'T' (length 1) repeated 32 times, resulting in a repeat length of 32 bp.
+  The seed repeat started at position 1 and ended at position 1, with a seed repeat number of 1
+  and seed length of 1 bp. The alignment of the imperfect repeat to its perfect counterpart
+  has 10 matches, 22 substitutions, 0 insertions, and 0 deletions, yielding an identity of 31.25%.
+  |nl|
+  |nl|
+  **Bioconda package:** https://bioconda.github.io/recipes/pytrf/README.html |nl|
+  **GitHub repository:** https://github.com/lmdu/pytrf |nl|
+  **License:** MIT License |nl|
+  **Disclaimer:** This is a minimal implementation supporting basic functionality.
+  pytrf is not a Python binding to TRF - it's an independent tool.
+

bio/pytrf/findatr/test/Snakefile

@@ -0,0 +1,20 @@
+# SAMPLE RULE: Find approximate/imperfect tandem repeats
+#
+# Output:
+# - If output file is specified, results are written to that file
+# - If output is omitted, PyTRF writes to stdout (redirected to log file)
+#
+# This example searches for approximate repeats with motif sizes between 3-10 bp,
+# allowing detection of imperfect short/medium tandem repeats with mismatches.
+rule pytrf_findatr:
+    input:
+        "demo_data/{sample}.fasta",
+    output:
+        "results/{sample}.tsv",
+    log:
+        "logs/{sample}.log",
+    params:
+        min_motif=3,
+        max_motif=10,
+    wrapper:
+        "master/bio/pytrf/findatr"

bio/pytrf/findatr/test/demo_data/small_test.fasta

@@ -0,0 +1,2 @@
+>seq1
+TCATCGGTCATCGGTCATCGGTCATCGGTCATCGG

bio/pytrf/findatr/test/expected/findatr_basic.tsv

@@ -0,0 +1 @@
+seq1	1	35	TCATCGG	7	5.0	35	1	35	5	35	35	0	0	0	100.0