Skip to content

chromosome

Jump to bottom
Okerew edited this page Sep 13, 2025 · 1 revision

Chromosome Class

Overview

The Chromosome class simulates the structure, behavior, and properties of a biological chromosome, including arms, bands, centromeres, telomeres, and satellite DNA. It supports operations such as replication, crossover, mutation, inversion, transposition, and visualization.

Class Definition

class Chromosome:
    def __init__(self, dna: DNA, name: str):
        """
        Initialize a new Chromosome object.
        :param dna: DNA object representing the chromosome's genetic material
        :param name: Name of the chromosome
        """
        ...

Attributes

Attribute Type Description
name str Name of the chromosome.
p_arm ChromosomeArm Short arm of the chromosome.
q_arm ChromosomeArm Long arm of the chromosome.
centromere_position int Position of the centromere.
telomere_length int Length of the telomeres.
chromosome_type str Type of chromosome (Metacentric, Submetacentric, Acrocentric, Telocentric).
satellite_dna Optional[DNA] Satellite DNA associated with the chromosome.
constrictions List[int] Positions of constrictions on the chromosome.

Methods

Initialization and Arm Management

  • __init__(self, dna: DNA, name: str) Initializes a new Chromosome instance with the specified DNA and name.

  • set_arms(self, dna: DNA) Splits the DNA into p and q arms based on the centromere position.

  • set_chromosome_type(self, chr_type: str) Sets the chromosome type.

  • add_satellite_dna(self, satellite: DNA) Adds satellite DNA to the chromosome.

  • add_constriction(self, position: int) Adds a constriction to the chromosome.

Band Management

  • add_band(self, arm: str, start: int, end: int, staining_pattern: str) Adds a band to either the p or q arm.

Replication and Mutation

  • replicate(self, mutation_rate: float = 0.001) Replicates the chromosome, potentially introducing mutations.

  • mutate(self, mutation_rate: float = 0.001) Introduces random mutations in the chromosome.

  • _mutate_sequence(self, sequence: str, mutation_rate: float) -> str Mutates a DNA sequence with a given mutation rate.

Structural Changes

  • crossover(self, other: 'Chromosome', crossover_points: List[int]) Performs crossover with another chromosome.

  • invert(self, start: int, end: int) Inverts a segment of the chromosome.

  • _invert_dna_segment(self, dna: DNA, start: int, end: int) -> DNA Inverts a segment of DNA.

  • transpose(self, start: int, end: int, new_position: int) Transposes a segment of the chromosome to a new position.

Sequence and Property Retrieval

  • get_sequence(self) -> str Retrieves the full DNA sequence of the chromosome.

  • set_centromere(self, position: int) Sets the position of the centromere and updates arms.

  • set_telomere_length(self, length: int) Sets the length of the telomeres.

  • get_gc_content(self) -> float Calculates the GC content of the chromosome.

  • find_genes(self, min_length: int = 100) -> List[Tuple[int, int, str]] Finds potential genes in the chromosome.

Visualization

  • visualize(self) Visualizes the chromosome structure, including arms, bands, and other features.

Comparison and Serialization

  • compare(self, other: 'Chromosome') -> float Compares this chromosome with another and returns a similarity score.

  • to_dict(self) -> dict Converts the chromosome to a dictionary representation.

  • from_dict(cls, data: dict) -> 'Chromosome' Creates a chromosome from a dictionary representation.

Utility Methods

  • __str__(self) Returns a string representation of the chromosome.

  • __len__(self) Returns the length of the chromosome.

  • __eq__(self, other) Checks if two chromosomes are equal.

  • __hash__(self) Returns a hash of the chromosome.

  • __getitem__(self, index) Allows indexing of the chromosome with wrap-around behavior.

Example Usage

# Create a DNA object
dna = DNA(sequence="ATGCGATCGATCGATCGATCGATCGATCGATCGATCG")

# Create a chromosome
chromosome = Chromosome(dna=dna, name="Chr1")

# Add a band to the p arm
chromosome.add_band(arm='p', start=0, end=5, staining_pattern="G")

# Replicate the chromosome
new_chromosome = chromosome.replicate(mutation_rate=0.001)

# Perform crossover with another chromosome
other_chromosome = Chromosome(dna=DNA("ATGCGATCGATCGATCGATCGATCGATCGATCGATCG"), name="Chr2")
crossover_chromosome = chromosome.crossover(other=other_chromosome, crossover_points=[10, 20])

# Visualize the chromosome
chromosome.visualize()

# Compare two chromosomes
similarity_score = chromosome.compare(other_chromosome)
print(f"Similarity score: {similarity_score}")

# Convert chromosome to dictionary
chromosome_dict = chromosome.to_dict()

Clone this wiki locally