Skip to content

rna

Jump to bottom
Okerew edited this page Sep 13, 2025 · 1 revision

RNA Class

Overview

The RNA class simulates the structure, behavior, and properties of an RNA molecule, including transcription, translation, mutation, splicing, reverse transcription, and protein synthesis. It supports operations such as identifying exons, finding open reading frames (ORFs), and simulating RNA processing.

Class Definition

class RNA:
    def __init__(self, sequence):
        """
        Initialize a new RNA object.
        :param sequence: The nucleotide sequence of the RNA strand
        """
        ...

Attributes

Attribute Type Description
sequence str Nucleotide sequence of the RNA.
mutation_probabilities Dict[str, float] Mutation probabilities for each nucleotide.
ribosomes List[rRNA] List of ribosomes associated with the RNA.

Methods

Initialization

  • __init__(self, sequence) Initializes a new RNA instance with the specified sequence.

Mutation Methods

  • absolute_mutate(self, index, new_nucleotide, probability) Mutates the RNA sequence at a specific index with an absolute probability.

  • mutate(self, index, new_nucleotide) Mutates the RNA sequence at a specific index based on nucleotide-specific probabilities.

  • absolute_random_mutate(self, probability) Randomly mutates the RNA sequence with an absolute probability.

  • random_mutate(self, mutation_rate=0.01) Randomly mutates the RNA sequence with a given mutation rate.

Transcription and Translation

  • transcribe_to_mrna(self) Transcribes the RNA sequence to mRNA, incorporating post-transcriptional modifications.

  • translate_using_trna(self, coding_sequence) Translates the coding sequence of mRNA into a protein sequence using tRNA.

  • translate(self) Translates the RNA sequence into a protein sequence.

  • protein_synthesis(self) Simulates the process of protein synthesis using associated ribosomes.

RNA Processing

  • simulate_rna_processing(self) Simulates RNA processing, including 5' capping, splicing, and 3' polyadenylation.

  • identify_exons(self) Identifies exons in the RNA sequence.

  • splice_sequence(self, sequence, exons) Splices the RNA sequence by keeping only the exon regions.

  • simulate_alternative_splicing(self) Simulates alternative splicing by randomly including or excluding exons.

Reverse Transcription

  • reverse_transcribe(self) Reverse transcribes the RNA sequence into DNA.

  • advanced_reverse_transcribe(self) Performs advanced reverse transcription from RNA to DNA, including errors and template switching.

  • introduce_rt_errors(self, sequence, error_rate) Introduces errors into the sequence to simulate reverse transcription errors.

  • simulate_template_switching(self, sequence) Simulates template switching during reverse transcription.

  • reverse_transcribe_to_dna_with_priming(self, primer) Performs reverse transcription with a specific primer.

  • create_dna_from_rna(self) Creates a DNA sequence from the RNA sequence, simulating the full reverse transcription process.

Sequence Analysis

  • find_start_codons(self) Finds all start codons (AUG) in the RNA sequence.

  • find_stop_codons(self) Finds all stop codons (UAA, UAG, UGA) in the RNA sequence.

  • find_orfs(self) Finds all open reading frames (ORFs) in the RNA sequence.

  • gc_content(self) Calculates the GC content of the RNA sequence.

  • find_motif(self, motif) Finds a specific motif in the RNA sequence.

Utility Methods

  • create_rna_from_dna(self, dna_sequence) Creates an RNA sequence from a given DNA sequence.

  • to_dict(self) Converts the RNA object to a dictionary.

  • from_dict(cls, data) Creates an RNA object from a dictionary.

  • to_json(self) Converts the RNA object to a JSON string.

  • from_json(cls, json_str) Creates an RNA object from a JSON string.

  • __str__(self) Returns a string representation of the RNA.

  • __len__(self) Returns the length of the RNA sequence.

  • __eq__(self, other) Checks if two RNA objects are equal.

  • __getitem__(self, index) Allows indexing of the RNA sequence.

Example Usage

# Create an RNA object
rna = RNA(sequence="AUGCCGUAUAGCGCUAUCGA")

# Transcribe to mRNA
mrna = rna.transcribe_to_mrna()

# Translate the RNA
protein_sequence = rna.translate()
print(f"Protein sequence: {protein_sequence}")

# Simulate RNA processing
processed_rna = rna.simulate_rna_processing()

# Simulate alternative splicing
spliced_rna = rna.simulate_alternative_splicing()

# Reverse transcribe the RNA
dna_sequence = rna.reverse_transcribe()

# Find ORFs
orfs = rna.find_orfs()
print(f"Open reading frames: {orfs}")

# Calculate GC content
gc_percent = rna.gc_content()
print(f"GC content: {gc_percent:.2f}%")

# Convert RNA to dictionary and JSON
rna_dict = rna.to_dict()
rna_json = rna.to_json()

Clone this wiki locally