mrna

mRNA Class

Overview

The mRNA class represents a messenger RNA molecule, including its sequence, cap, poly-A tail, untranslated regions (UTRs), coding sequence, and ribosome binding sites. It provides methods for simulating transcription, translation, degradation, alternative splicing, and motif finding.

---

Class Definition

class mRNA:
    def __init__(self, sequence):
        """
        Initialize a new mRNA object.
        :param sequence: The nucleotide sequence of the mRNA strand
        """
        ...

---

Attributes

Attribute	Type	Description
sequence	str	Nucleotide sequence of the mRNA.
cap	str	7-methylguanosine cap at the 5' end.
poly_a_tail	str	Poly-A tail at the 3' end.
utr_5	str	5' untranslated region.
utr_3	str	3' untranslated region.
coding_sequence	str	Coding sequence of the mRNA.
ribosome_binding_sites	List[int]	Positions of ribosome binding sites.

---

Methods

Initialization and Modification

• __init__(self, sequence) Initializes a new mRNA instance with the specified sequence.

• add_cap(self) Adds a 7-methylguanosine cap to the 5' end of the mRNA.

• add_poly_a_tail(self, length=200) Adds a poly-A tail to the 3' end of the mRNA.

• set_utrs(self, utr_5, utr_3) Sets the 5' and 3' untranslated regions.

---

Sequence Analysis

• find_start_codon(self) Finds the start codon (AUG) in the mRNA sequence.

• find_stop_codons(self) Finds all stop codons (UAA, UAG, UGA) in the mRNA sequence.

• set_coding_sequence(self) Sets the coding sequence based on start and stop codons.

• find_kozak_sequence(self) Finds the Kozak consensus sequence near the start codon.

• find_motifs(self, motif) Finds all occurrences of a specific motif in the mRNA sequence.

• get_gc_content(self) Calculates the GC content of the mRNA sequence.

---

Transcription and Translation

• transcribe_to_mrna(self) Simulates transcription of DNA to mRNA.

• reverse_transcribe(self) Reverse transcribes the mRNA sequence into DNA.

• translate(self) Translates the coding sequence into a protein sequence.

---

Ribosome Binding and Degradation

• add_ribosome_binding_site(self, position) Adds a ribosome binding site at the specified position.

• simulate_degradation(self, rate=0.01) Simulates mRNA degradation by shortening the poly-A tail.

---

Alternative Splicing

• simulate_alternative_splicing(self, exon_ranges, base_inclusion_prob=0.7) Simulates alternative splicing using a probabilistic algorithm.

---

Utility Methods

• __str__(self) Returns a string representation of the mRNA.

• __len__(self) Returns the total length of the mRNA, including cap and poly-A tail.

---

Example Usage

# Create an mRNA object
mrna = mRNA(sequence="AUGCCGUAUAGCGCUAUCGA")

# Add cap and poly-A tail
mrna.add_cap()
mrna.add_poly_a_tail()

# Set UTRs
mrna.set_utrs(utr_5="AAAAA", utr_3="CCCCC")

# Set coding sequence
mrna.set_coding_sequence()

# Translate the mRNA
protein_sequence = mrna.translate()
print(f"Protein sequence: {protein_sequence}")

# Simulate degradation
mrna.simulate_degradation(rate=0.1)

# Find Kozak sequence
kozak_sequence = mrna.find_kozak_sequence()
print(f"Kozak sequence: {kozak_sequence}")

# Simulate alternative splicing
exon_ranges = [(0, 5), (5, 10), (10, 15)]
included_exons = mrna.simulate_alternative_splicing(exon_ranges)
print(f"Included exons: {included_exons}")

# Print mRNA information
print(mrna)

---