crispr

CRISPR Class

---

Overview

The CRISPR class simulates CRISPR-Cas9 genome editing operations. It provides methods for finding target sequences, cutting DNA, inserting, deleting, and replacing sequences, as well as simulating off-target effects.

---

Class Definition

class CRISPR:
    def __init__(self, guide_rna: str):
        """
        Initialize a new CRISPR object.
        :param guide_rna: The guide RNA sequence used to target specific DNA sequences
        """
        ...

---

Attributes

Attribute	Type	Description
guide_rna	str	The guide RNA sequence used to target specific DNA sequences.

---

Methods

Initialization

• __init__(self, guide_rna: str) Initializes a new CRISPR instance with the specified guide RNA sequence.

---

Target Sequence Detection

• find_target_sequence(self, dna: DNA) -> List[int] Finds all occurrences of the target sequence in the DNA.

  • Parameters:

    • dna: The DNA object to search in.

  • Returns: A list of starting indices of the target sequence.

---

DNA Editing Operations

• cut_dna(self, dna: DNA, index: int) -> Tuple[DNA, DNA] Simulates cutting the DNA at the specified index.

  • Parameters:

    • dna: The DNA object to cut.
    • index: The index at which to cut the DNA.

  • Returns: Two DNA objects representing the cut fragments.

• insert_sequence(self, dna: DNA, insert_seq: str, index: int) -> DNA Inserts a sequence into the DNA at the specified index.

  • Parameters:

    • dna: The DNA object to modify.
    • insert_seq: The sequence to insert.
    • index: The index at which to insert the sequence.

  • Returns: A new DNA object with the inserted sequence.

• delete_sequence(self, dna: DNA, start: int, end: int) -> DNA Deletes a sequence from the DNA between the specified indices.

  • Parameters:

    • dna: The DNA object to modify.
    • start: The starting index of the sequence to delete.
    • end: The ending index of the sequence to delete.

  • Returns: A new DNA object with the sequence deleted.

• replace_sequence(self, dna: DNA, replacement: str, start: int, end: int) -> DNA Replaces a sequence in the DNA with a new sequence.

  • Parameters:

    • dna: The DNA object to modify.
    • replacement: The replacement sequence.
    • start: The starting index of the sequence to replace.
    • end: The ending index of the sequence to replace.

  • Returns: A new DNA object with the replaced sequence.

---

Genome Editing

• edit_genome(self, dna: DNA, edit_type: str, *args) -> DNA Performs a CRISPR edit on the DNA.

  • Parameters:

    • dna: The DNA object to edit.
    • edit_type: The type of edit to perform ('insert', 'delete', or 'replace').
    • *args: Additional arguments specific to the edit type.

  • Returns: A new DNA object with the edit applied.

  • Raises: ValueError if the edit type is invalid.

---

Off-Target Effects

• simulate_off_target_effects(self, dna: DNA, mutation_rate: float = 0.1) -> DNA Simulates off-target effects of CRISPR editing.

  • Parameters:

    • dna: The DNA object to potentially modify.
    • mutation_rate: The probability of an off-target mutation occurring.

  • Returns: A potentially modified DNA object.

---

Example Usage

# Initialize a DNA object
dna = DNA(sequence="ATGCGATCGATCGATCGATCGATCGATCG")

# Initialize a CRISPR object with a guide RNA
guide_rna = "GATC"
crisp = CRISPR(guide_rna)

# Find target sequences
target_sites = crisp.find_target_sequence(dna)
print(f"Target sites: {target_sites}")

# Edit the genome by inserting a sequence
edited_dna = crisp.edit_genome(dna, 'insert', "TTTT")
print(f"Edited DNA sequence: {edited_dna.sequence}")

# Edit the genome by deleting a sequence
edited_dna = crisp.edit_genome(dna, 'delete', 4)
print(f"Edited DNA sequence: {edited_dna.sequence}")

# Edit the genome by replacing a sequence
edited_dna = crisp.edit_genome(dna, 'replace', "AAAA")
print(f"Edited DNA sequence: {edited_dna.sequence}")

# Simulate off-target effects
mutated_dna = crisp.simulate_off_target_effects(dna)
print(f"Mutated DNA sequence: {mutated_dna.sequence}")

---

Expected Output

Target sites: [2, 8, 14, 20, 26]
Edited DNA sequence: ATGCGATTTTTTCGATCGATCGATCGATCGATCG
Edited DNA sequence: ATGCGAT
Edited DNA sequence: ATGCAAACGATCGATCGATCGATCGATCG
Off-target mutation occurred at position 12
Mutated DNA sequence: ATGCGATCGATAGATCGATCGATCGATCG

---

Dependencies

• random: For simulating random off-target effects and selecting target sites.
• DNA: Class representing DNA sequences.

---

Error Handling

• The edit_genome method raises a ValueError if an invalid edit type is provided.
• The find_target_sequence method returns an empty list if no target sites are found.

---

Notes

• The CRISPR class is designed to simulate basic CRISPR-Cas9 genome editing operations.
• The edit_genome method supports three types of edits: insert, delete, and replace.
• The simulate_off_target_effects method simulates potential unintended mutations that can occur during CRISPR editing.