Skip to content
Merged
Show file tree
Hide file tree
Changes from 2 commits
Commits
File filter

Filter by extension

Filter by extension

Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
9 changes: 9 additions & 0 deletions tools/vrhyme/.shed.yml
Original file line number Diff line number Diff line change
@@ -0,0 +1,9 @@
name: vrhyme
owner: bgruening
description: Tool for dereplication and binning virus genomes from metagenomes.
homepage_url: https://github.com/AnantharamanLab/vRhyme
long_description:
vRhyme is a tool for binning viral genomes from metagenomes. It groups viral contigs into metagenome-assembled genomes (vMAGs) using sequence features, read coverage patterns, and machine learning. It also includes an optional dereplication function to remove redundant sequences.
remote_repository_url: https://github.com/bgruening/galaxytools/tree/master/tools/vrhyme
categories:
- Metagenomics
21 changes: 21 additions & 0 deletions tools/vrhyme/macros.xml
Original file line number Diff line number Diff line change
@@ -0,0 +1,21 @@
<macros>
<token name="@TOOL_VERSION@">1.1.0</token>
<token name="@VERSION_SUFFIX@">galaxy0</token>
<xml name="requirements">
<requirements>
<requirement type="package" version="@TOOL_VERSION@">vrhyme</requirement>
<requirement type="package" version="3.23">mummer</requirement>
<requirement type="package" version="1.1.3">scikit-learn</requirement>
</requirements>
</xml>
<xml name="biotools">
<xrefs>
<xref type="bio.tools">vRhyme</xref>
</xrefs>
</xml>
<xml name="citations">
<citations>
<citation type="doi">10.1093/nar/gkac341</citation>
</citations>
</xml>
</macros>
12,000 changes: 12,000 additions & 0 deletions tools/vrhyme/test-data/Test_simulated.fastq

Large diffs are not rendered by default.

13 changes: 13 additions & 0 deletions tools/vrhyme/test-data/example_coverage_values.tsv
Original file line number Diff line number Diff line change
@@ -0,0 +1,13 @@
scaffold avg_SRR2046222_trim stdev_SRR2046222_trim avg_SRR2046235_trim stdev_SRR2046235_trim avg_SRR2046236_trim stdev_SRR2046236_trim
virus_1__0:13792 96.32359338747099 24.813803138227193 336.82207076566124 48.53375006850304 292.5810614849188 50.93065819442028
virus_1__13792:29888 87.37972166998011 21.574192260474437 342.9219681908549 45.861610044217755 289.34505467196817 48.29033273320929
virus_1__29888:34019 91.07334785766159 23.463248535880197 355.4468651658194 65.05538501584905 294.38828370854515 61.928534242372756
virus_1__34019:45164 91.42009869896815 25.906158249588273 348.6326603858232 49.327479050402346 287.1410497981158 49.03400296998417
virus_1__45164:63646 88.59002375296912 23.092473303597128 323.18004750593826 77.47367574377701 265.3235154394299 56.6744031670385
virus_2__0:13100 101.29984732824427 27.351034700963805 441.32977099236643 62.53809305658163 297.72587786259544 49.31367633676957
virus_2__13100:24602 103.90975482524779 28.36762220733677 450.5150408624587 63.64019699678692 297.76864893062077 59.07434359506686
virus_2__24602:37063 103.00722253430703 26.666693441816133 442.6597383837573 62.15227015869699 290.2397881389937 50.04145100932727
virus_2__37063:44358 104.55274955170353 28.469833814916036 442.5375074716079 68.57615997501904 309.4928272564256 53.75696434636587
virus_3__0:6773 8497.161466885605 1752.9154817117605 14112.200328407225 2891.864467713525 30100.58401751505 6225.80141987776
virus_4__0:8428 0.23421926910299004 1.1266316629605762 19.504983388704318 9.602139891487262 22.572259136212626 11.527000319991355
virus_5__0:8378 0.4128929142248269 1.0539541679344029 118.62892914224827 25.736327963856304 36.50879062333511 16.065928782271936
26 changes: 26 additions & 0 deletions tools/vrhyme/test-data/example_scaffolds.fasta

Large diffs are not rendered by default.

682 changes: 682 additions & 0 deletions tools/vrhyme/test-data/example_scaffolds.prodigal.faa

Large diffs are not rendered by default.

1,419 changes: 1,419 additions & 0 deletions tools/vrhyme/test-data/example_scaffolds.prodigal.ffn

Large diffs are not rendered by default.

28 changes: 28 additions & 0 deletions tools/vrhyme/test-data/example_scaffolds_replication.fasta

Large diffs are not rendered by default.

Original file line number Diff line number Diff line change
@@ -0,0 +1,3 @@
scaffold type mismatches length repeat
virus_3__0:6773 DTR 0 95 GAGGTAAAACCTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTTGATGGAACTGACCAA
virus_5__0:8378 DTR 0 94 CAGCGACCAAGTGATTAACAGTCACCTACTCTACCGCTGAGCTAATCCGGAACATTTGAAAGTTTCTCTTAAAAAATGGTGTCAAGAGAGGGAC
Original file line number Diff line number Diff line change
@@ -0,0 +1,48 @@
Command: /usr/local/bin/vRhyme -i /tmp/tmpotozv0b0/files/8/3/d/dataset_83df77e8-a4c9-46b0-b633-114fb5c21d74.dat -o output_dir -t 1 -g /tmp/tmpotozv0b0/files/0/0/8/dataset_008e4fd2-3980-4e3d-bd5f-3020cf0fe335.dat -p /tmp/tmpotozv0b0/files/4/4/1/dataset_441f8fc8-519a-43f4-bfa1-3e4a7a47d9a0.dat -c /tmp/tmpotozv0b0/files/5/3/3/dataset_533e8f0c-6cb1-4d62-a539-c670773791b7.dat -l 2000

Date: 2025-04-02 (y-m-d)
Start: 16:27:22 (h:m:s)
Program: vRhyme v1.1.0


Time (min) | Log
--------------------------------------------------------------------
0.0 Initializing and validating vRhyme parameters
0.01 Performing pairwise coverage comparisons
0.03 Generating codon usage features
0.03 Generating nucleotide features
0.04 Performing pairwise distance calculations
0.04 Performing machine learning classification
0.05 Generating networks of bins
0.15 Extracting information for all possible unique bins
0.15 Running mmseqs2 linclust for bin redundancy scoring
0.15 Parsing linclust protein clusters
0.15 Scoring all possible unique bins
0.15 Identifying best set of bins from 20 iterations
0.15 Extracting binning summary statistics for each iteration
0.15 Writing finalized bin sequences to individual fasta files
0.15 vRhyme binning complete

Memory usage: 0.45
Runtime (min): 0.15
Bins generated: 2
Binned sequences: 9 (90.0%)
Input sequences: 10
Binned proteins: 139
Redundant proteins: 0 (0.0%)
Best iteration: 0
vRhyme score: 0.8506


______________________________________________________________________

## ## ## ##
## ## ## ## ## ## ## ## # ## ##
## ## ## ## ## ## ## ## ## ## ## #
## ## ## ## ## ## ## ## ## ## ## ## ##
## ## ## #### ## ## ## ## ## ## ## ##
## ## ## ## ## ## ## ## ## ## ##
### ## ## ## ## ## ## ## ## ## ## ##
______________________________________________________________________


Original file line number Diff line number Diff line change
@@ -0,0 +1,21 @@
iteration sequences redundancy bins proteins score
0 9 0 2 139 0.8506
1 9 0 2 139 0.8506
4 9 0 2 139 0.8506
19 9 0 2 139 0.8506
2 8 0 2 136 0.7375
3 8 0 2 136 0.7375
5 8 0 2 136 0.7375
6 8 0 2 136 0.7375
7 8 0 2 136 0.7375
8 8 0 2 136 0.7375
9 8 0 2 136 0.7375
10 8 0 2 136 0.7375
11 8 0 2 136 0.7375
12 8 0 2 136 0.7375
13 8 0 2 136 0.7375
14 8 0 2 136 0.7375
15 8 0 2 136 0.7375
16 8 0 2 136 0.7375
17 8 0 2 136 0.7375
18 8 0 2 136 0.7375
Original file line number Diff line number Diff line change
@@ -0,0 +1,10 @@
scaffold bin
virus_2__0:13100 1
virus_2__13100:24602 1
virus_2__24602:37063 1
virus_2__37063:44358 1
virus_1__0:13792 2
virus_1__13792:29888 2
virus_1__29888:34019 2
virus_1__34019:45164 2
virus_1__45164:63646 2
Original file line number Diff line number Diff line change
@@ -0,0 +1,3 @@
bin members proteins redundancy
1 4 63 0
2 5 76 0
Loading
Loading